The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	603207	613098	3937511		Synechococcus_phage(50.0%)	9	NA	NA
WP_014469853.1|603207_604500_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_014469854.1|604575_605295_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	9.8e-48
WP_014469855.1|605294_605549_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	35.8	2.1e-05
WP_014469856.1|605545_606229_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014469857.1|606212_608441_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.8e-159
WP_014469858.1|608416_609847_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_014469859.1|609938_610979_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	8.2e-64
WP_014469860.1|610975_611563_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	1.0e-26
WP_014469861.1|611559_613098_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	2.3e-78
>prophage 2
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1071152	1077405	3937511		Staphylococcus_phage(66.67%)	9	NA	NA
WP_013352733.1|1071152_1072268_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
WP_014470033.1|1072248_1072896_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352731.1|1072910_1074107_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_013352730.1|1074139_1074604_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352729.1|1074720_1075095_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352728.1|1075160_1075682_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_076983148.1|1075769_1075859_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352727.1|1076066_1076822_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_013352726.1|1076811_1077405_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
>prophage 3
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1179978	1192767	3937511	holin	Bacillus_phage(100.0%)	13	NA	NA
WP_014470066.1|1179978_1180959_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.9	8.5e-79
WP_076982859.1|1181222_1181657_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470068.1|1181700_1182471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470069.1|1182977_1184864_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	55.0	5.6e-111
WP_014470070.1|1184876_1185335_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	5.2e-71
WP_009967548.1|1185642_1185759_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_014470071.1|1185987_1186191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470072.1|1187308_1187641_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	5.3e-41
WP_014470073.1|1187633_1188884_+	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	91.8	1.0e-222
WP_014472510.1|1190361_1190622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|1190977_1191229_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_014472511.1|1191241_1191613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470079.1|1191720_1192767_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	52.0	5.7e-81
>prophage 4
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1207415	1219093	3937511	integrase	Bacillus_phage(83.33%)	19	1198282:1198297	1225664:1225679
1198282:1198297	attL	CTTTTCAAAAGACAGT	NA	NA	NA	NA
WP_014470085.1|1207415_1208042_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	32.8	1.9e-23
WP_014470086.1|1208113_1208524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470087.1|1208617_1208800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470088.1|1208828_1209881_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
WP_014470089.1|1209877_1210378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472516.1|1210545_1210761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470091.1|1210805_1211807_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	87.0	5.7e-171
WP_014470092.1|1211820_1212237_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	65.5	5.3e-46
WP_014470093.1|1212236_1212722_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.5	2.2e-59
WP_014470094.1|1212810_1213659_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014470095.1|1213677_1213830_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470096.1|1213830_1214106_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	1.2e-09
WP_014470097.1|1214119_1215451_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	42.6	1.3e-21
WP_014470098.1|1215450_1215807_-	hypothetical protein	NA	O64055	Bacillus_phage	78.8	2.4e-47
WP_014470099.1|1215878_1216346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470100.1|1216366_1217164_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.2	1.5e-17
WP_014470101.1|1217202_1217928_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	31.8	4.7e-26
WP_014470102.1|1217924_1218431_-	hypothetical protein	NA	O64060	Bacillus_phage	66.7	1.7e-62
WP_014470103.1|1218427_1219093_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	51.1	1.6e-49
1225664:1225679	attR	ACTGTCTTTTGAAAAG	NA	NA	NA	NA
>prophage 5
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1224397	1235591	3937511		Bacillus_phage(66.67%)	8	NA	NA
WP_014470110.1|1224397_1227463_-	heavy metal transporter	NA	A0A0K2FLD6	Brevibacillus_phage	30.0	8.1e-51
WP_014470111.1|1227462_1228470_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.5	9.6e-09
WP_014470112.1|1228578_1229079_-	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	32.5	1.1e-18
WP_014470114.1|1229312_1229465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470115.1|1229479_1230697_-	hypothetical protein	NA	O64073	Bacillus_phage	97.3	9.8e-226
WP_014470116.1|1230708_1230918_-	YonK family protein	NA	NA	NA	NA	NA
WP_014470118.1|1232541_1232817_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	7.0e-39
WP_014470119.1|1233074_1235591_-	hypothetical protein	NA	O64076	Bacillus_phage	83.1	0.0e+00
>prophage 6
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1238692	1246141	3937511		Bacillus_phage(100.0%)	9	NA	NA
WP_014470124.1|1238692_1238869_+	hypothetical protein	NA	O64080	Bacillus_phage	92.1	1.3e-09
WP_076983670.1|1238922_1239138_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	1.6e-30
WP_003230987.1|1239182_1239371_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_014470125.1|1239452_1240670_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.7	6.4e-201
WP_014470126.1|1240985_1241840_+	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	85.6	5.3e-125
WP_014470127.1|1241845_1242763_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	87.9	2.4e-139
WP_014470128.1|1242764_1243367_+	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	99.5	1.1e-105
WP_014470129.1|1243368_1245165_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.7	0.0e+00
WP_014470130.1|1245433_1246141_+	phage antirepressor KilAC domain-containing protein	NA	A0A1P8CWY0	Bacillus_phage	49.2	1.3e-52
>prophage 7
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1254525	1281758	3937511	integrase	Bacillus_phage(82.35%)	46	1256869:1256882	1260697:1260710
WP_014417903.1|1254525_1254708_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
WP_014470146.1|1254778_1255030_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	7.1e-22
WP_014470147.1|1255032_1255248_+	hypothetical protein	NA	O64089	Bacillus_phage	52.1	8.8e-13
WP_014470148.1|1255259_1255391_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	2.7e-17
WP_014470150.1|1255491_1256028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470151.1|1256046_1256709_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_014470152.1|1256746_1256905_+	hypothetical protein	NA	NA	NA	NA	NA
1256869:1256882	attL	GGAAACTTTATTAT	NA	NA	NA	NA
WP_014470154.1|1257135_1258296_+	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	23.2	1.6e-07
WP_014470155.1|1258322_1258451_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_014470156.1|1258777_1258978_+	hypothetical protein	NA	O64096	Bacillus_phage	61.5	1.9e-14
WP_014470157.1|1258983_1259322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470158.1|1259366_1259600_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	60.0	8.9e-11
WP_014470159.1|1259583_1260666_+|integrase	tyrosine-type recombinase/integrase	integrase	O64099	Bacillus_phage	63.3	1.1e-124
WP_014470160.1|1260752_1262144_+	hypothetical protein	NA	O64100	Bacillus_phage	74.6	9.6e-201
1260697:1260710	attR	ATAATAAAGTTTCC	NA	NA	NA	NA
WP_014470161.1|1262164_1263142_+	hypothetical protein	NA	O64101	Bacillus_phage	74.5	7.6e-136
WP_014470163.1|1263773_1263989_+	YopT family protein	NA	O64103	Bacillus_phage	64.3	2.8e-19
WP_014472527.1|1264926_1265127_+	hypothetical protein	NA	M4ZRU5	Bacillus_phage	82.8	7.1e-25
WP_014470168.1|1265123_1265501_+	hypothetical protein	NA	R4JKA5	Bacillus_phage	38.8	1.9e-18
WP_014470169.1|1265500_1265710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470170.1|1265706_1266042_+	hypothetical protein	NA	O64111	Bacillus_phage	76.6	2.2e-42
WP_014470171.1|1266110_1266908_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	54.2	1.6e-70
WP_014470172.1|1266941_1267127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_186434520.1|1267132_1267384_+	hypothetical protein	NA	O64116	Bacillus_phage	83.3	1.1e-33
WP_014470174.1|1267407_1267602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470175.1|1267634_1268027_+	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.9	6.3e-25
WP_014470176.1|1268065_1268905_+	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	59.1	1.6e-78
WP_096034861.1|1269027_1269249_+	hypothetical protein	NA	O64123	Bacillus_phage	93.0	3.7e-30
WP_014470178.1|1269262_1269637_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	63.4	1.7e-35
WP_014470179.1|1269751_1269916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470180.1|1270001_1270253_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	56.5	1.6e-18
WP_014470181.1|1270292_1270655_+	hypothetical protein	NA	A0A0S2MUT8	Bacillus_phage	49.0	4.4e-33
WP_014470184.1|1271505_1271703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470186.1|1271920_1272733_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.1	4.2e-140
WP_014470187.1|1272802_1273477_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_014470188.1|1273547_1273793_+	hypothetical protein	NA	O64132	Bacillus_phage	84.1	2.5e-27
WP_014471975.1|1273818_1274070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470190.1|1274085_1274565_+	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	35.4	4.0e-13
WP_014470191.1|1274613_1275501_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_014470192.1|1275490_1275763_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_014470193.1|1275837_1276056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470194.1|1276166_1276988_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	61.0	1.3e-85
WP_014470195.1|1276984_1278727_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.5	1.0e-220
WP_014470196.1|1278765_1279482_+	serine/threonine protein phosphatase	NA	M4H0M1	Listeria_phage	38.3	9.7e-40
WP_014470197.1|1279503_1279881_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	4.5e-52
WP_014470198.1|1280031_1280388_+	hypothetical protein	NA	O64139	Bacillus_phage	76.1	2.0e-41
WP_014470199.1|1280420_1281758_+	hypothetical protein	NA	A0A0K2FMB7	Brevibacillus_phage	28.5	7.7e-06
>prophage 8
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1285157	1312825	3937511	tRNA	Bacillus_phage(90.0%)	39	NA	NA
WP_014470202.1|1285157_1286222_+	hypothetical protein	NA	A0A218KBY7	Bacillus_phage	38.9	6.5e-64
WP_014470203.1|1286233_1287922_+	DHH family phosphoesterase	NA	A0A1P8CX07	Bacillus_phage	43.3	3.3e-123
WP_014470204.1|1287939_1290231_+	DNA polymerase I	NA	A0A0K0N6N8	Gordonia_phage	28.0	7.8e-06
WP_014470205.1|1290238_1290985_+	3D domain-containing protein	NA	O64147	Bacillus_phage	53.0	1.6e-53
WP_014470208.1|1291527_1291731_+	YorP family protein	NA	O64150	Bacillus_phage	82.1	3.5e-27
WP_014470209.1|1291735_1291894_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	66.7	8.4e-13
WP_014470210.1|1291890_1292388_+	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	81.2	8.7e-72
WP_014470211.1|1292396_1292915_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	87.2	4.5e-87
WP_014470212.1|1292935_1293178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144653880.1|1293263_1294757_+	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	99.2	1.8e-266
WP_014470214.1|1294803_1295022_+	hypothetical protein	NA	O64155	Bacillus_phage	61.4	1.1e-15
WP_014470217.1|1295791_1296016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470219.1|1296342_1296816_+	hypothetical protein	NA	O64162	Bacillus_phage	67.3	2.1e-59
WP_014470221.1|1296969_1297290_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	79.2	8.4e-44
WP_014470222.1|1297302_1297710_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	74.0	1.3e-49
WP_014470223.1|1297723_1298071_+	hypothetical protein	NA	O64164	Bacillus_phage	89.5	4.5e-51
WP_014470224.1|1298115_1298421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470225.1|1298462_1298756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470226.1|1298789_1299167_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	47.4	4.2e-18
WP_014470227.1|1299173_1299386_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.4	2.3e-29
WP_014470228.1|1299399_1299732_+	hypothetical protein	NA	O64168	Bacillus_phage	86.0	5.5e-14
WP_014470229.1|1299783_1300140_+	hypothetical protein	NA	O64171	Bacillus_phage	96.6	2.3e-58
WP_014470230.1|1300136_1300532_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	1.5e-63
WP_104843608.1|1300539_1301217_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	1.4e-120
WP_014470236.1|1304049_1304571_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	88.4	4.0e-83
WP_014470238.1|1305129_1305849_+	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	44.7	5.2e-49
WP_014470241.1|1306319_1306676_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
WP_014470242.1|1306724_1307153_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	2.0e-72
WP_014470243.1|1307274_1307439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470244.1|1307780_1308053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470245.1|1308045_1308345_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	57.0	3.2e-21
WP_014470247.1|1308816_1309656_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	89.6	9.4e-151
WP_014470248.1|1309655_1310174_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.6	7.1e-32
WP_014470249.1|1310272_1310599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470250.1|1310610_1310994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470251.1|1310990_1311350_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	46.3	1.9e-20
WP_014470252.1|1311349_1311703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470254.1|1311933_1312173_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_014470255.1|1312270_1312825_+	Holliday junction resolvase RecU	NA	O64195	Bacillus_phage	92.7	1.1e-91
>prophage 9
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	1561595	1571956	3937511		Bacillus_phage(71.43%)	14	NA	NA
WP_007611720.1|1561595_1562216_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_013352414.1|1562564_1562993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352413.1|1563148_1563598_+	YndM family protein	NA	NA	NA	NA	NA
WP_013352412.1|1563625_1564456_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352411.1|1564442_1564592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352410.1|1564698_1565520_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352409.1|1565725_1565911_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352408.1|1565920_1566355_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352407.1|1566525_1566765_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_014470354.1|1567052_1569470_+	peptidase G2	NA	D6R401	Bacillus_phage	50.1	5.0e-221
WP_013352405.1|1569635_1569803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352404.1|1570131_1570668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016935991.1|1571084_1571174_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352403.1|1571335_1571956_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
>prophage 10
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	2113565	2149374	3937511	plate,portal,tail,capsid,terminase,holin	Bacillus_phage(30.3%)	47	NA	NA
WP_014470491.1|2113565_2114444_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
WP_014470492.1|2114457_2114721_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	6.7e-23
WP_013351964.1|2114734_2114998_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_014470493.1|2115051_2115849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470494.1|2115903_2116068_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.4	1.0e-13
WP_014470495.1|2116067_2116394_-	XkdW family protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	39.8	1.2e-13
WP_014470496.1|2116405_2118169_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	50.0	6.6e-13
WP_013351959.1|2118171_2118444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470497.1|2118440_2119019_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	1.8e-12
WP_014470498.1|2119002_2120049_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.0e-69
WP_014470499.1|2120041_2120467_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.2	3.3e-11
WP_013351955.1|2120616_2120883_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_013351954.1|2120882_2121860_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351953.1|2121873_2122533_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_014470500.1|2122525_2127730_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	9.0e-42
WP_015239684.1|2127717_2127870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|2127911_2128358_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|2128432_2128876_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_013351950.1|2128877_2130275_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_013351949.1|2130274_2130484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351948.1|2130480_2130927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351947.1|2130923_2131427_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351946.1|2131423_2131780_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_014470501.1|2131776_2132160_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_013351945.1|2132176_2133112_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_013351944.1|2133138_2133981_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_044051899.1|2134000_2135392_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351942.1|2135440_2136739_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_014470502.1|2136735_2137530_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.4	1.2e-59
WP_013351940.1|2137644_2138154_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_013351939.1|2138266_2138470_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351938.1|2138459_2138801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154863.1|2138898_2139066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470503.1|2139065_2139866_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.7	8.0e-59
WP_014470504.1|2139765_2140593_-	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_014470505.1|2140582_2140762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351934.1|2140952_2141291_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351933.1|2141438_2142029_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351932.1|2142171_2142774_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351931.1|2142883_2143261_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351930.1|2143298_2144252_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_003154881.1|2144395_2144530_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_088030497.1|2144519_2145656_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_013351928.1|2145860_2146328_+	DinB family protein	NA	NA	NA	NA	NA
WP_014470506.1|2146471_2147236_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014470507.1|2147403_2147595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470508.1|2148021_2149374_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	1.0e-13
>prophage 11
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	2184740	2187746	3937511		Bacillus_phage(100.0%)	6	NA	NA
WP_013351886.1|2184740_2185115_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
WP_014470521.1|2185128_2185338_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351885.1|2185788_2186064_+	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_013351884.1|2186713_2187106_-	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351883.1|2187098_2187428_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351882.1|2187587_2187746_+	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
>prophage 12
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	2191904	2262029	3937511	plate,portal,tail,terminase,holin,integrase,head,coat	uncultured_Caudovirales_phage(51.79%)	102	2197592:2197609	2247033:2247050
WP_127721184.1|2191904_2191985_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_013351878.1|2192268_2192604_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.8	3.2e-25
WP_013351877.1|2192807_2193269_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014470524.1|2193393_2193615_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	69.4	1.6e-25
WP_014470525.1|2193924_2194869_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_014470526.1|2194941_2195499_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	82.2	1.4e-89
WP_014470527.1|2195548_2195803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471698.1|2196411_2196765_+	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	50.4	2.4e-23
WP_013351872.1|2196786_2197122_+	hypothetical protein	NA	NA	NA	NA	NA
2197592:2197609	attL	GTCCCCAATTCGTCCCCA	NA	NA	NA	NA
WP_014470529.1|2197707_2198745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470530.1|2198763_2199486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470531.1|2199502_2200051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158306074.1|2200199_2200526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472584.1|2200804_2202625_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	43.2	3.9e-109
WP_014470534.1|2202637_2203078_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470535.1|2203243_2203474_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_014470536.1|2203943_2204819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470537.1|2204834_2205212_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_014470538.1|2205252_2206410_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	64.1	4.7e-68
WP_014470539.1|2206464_2206728_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.0e-27
WP_013351240.1|2206743_2207022_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.7	1.1e-28
WP_014470541.1|2207085_2207280_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.5	8.2e-18
WP_014470542.1|2207269_2207734_-	hypothetical protein	NA	O64053	Bacillus_phage	34.9	6.6e-05
WP_014470543.1|2207752_2208973_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.3	6.1e-50
WP_014470544.1|2208987_2209617_-	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	82.8	1.4e-90
WP_014470545.1|2209613_2210789_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	71.9	1.1e-152
WP_014470546.1|2210781_2211138_-	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	60.2	5.7e-33
WP_014472588.1|2211134_2211482_-	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	58.3	2.9e-29
WP_014470548.1|2211481_2212450_-	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	58.9	7.6e-104
WP_014470549.1|2212433_2212793_-	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	72.9	1.1e-44
WP_014470550.1|2212807_2213365_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	67.0	2.4e-62
WP_014470551.1|2213365_2218021_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	49.7	5.2e-118
WP_014470552.1|2218179_2218479_-	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	41.7	1.7e-06
WP_014470553.1|2218579_2218975_-	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	2.3e-38
WP_014470554.1|2218991_2220026_-	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	63.6	7.0e-124
WP_014470555.1|2220030_2220501_-	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	57.0	4.4e-49
WP_014470556.1|2220457_2220847_-	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	58.8	9.3e-29
WP_014470557.1|2220846_2221350_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	58.9	6.2e-49
WP_014470558.1|2221354_2221690_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J6J9	uncultured_Caudovirales_phage	56.8	1.2e-29
WP_014470559.1|2221704_2222574_-	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	43.0	3.9e-51
WP_014470560.1|2222585_2222789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470561.1|2222802_2223663_-	hypothetical protein	NA	A0A1L2JY55	Aeribacillus_phage	77.1	4.5e-124
WP_014470562.1|2223677_2224397_-	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	50.6	2.5e-51
WP_014470564.1|2224664_2226098_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	58.9	4.2e-151
WP_014470565.1|2226101_2227307_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.0	1.2e-202
WP_014470566.1|2227293_2228049_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	57.2	7.1e-57
WP_014470567.1|2228226_2228538_-	hypothetical protein	NA	Q9T202	Bacillus_phage	54.6	2.1e-23
WP_014470568.1|2228666_2229296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470569.1|2229442_2229904_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	51.2	4.4e-25
WP_014470570.1|2229903_2230110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470572.1|2230454_2230745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470573.1|2230950_2231589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472594.1|2231598_2232321_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_014470575.1|2232452_2232623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472595.1|2232633_2233068_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.1	2.8e-50
WP_014470577.1|2233202_2233553_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_014470578.1|2233763_2234177_-	hypothetical protein	NA	O64129	Bacillus_phage	86.8	5.0e-65
WP_014470579.1|2234258_2235098_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0S2SXP3	Bacillus_phage	57.2	7.8e-89
WP_014470580.1|2235101_2235359_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.2	3.9e-07
WP_014470581.1|2235372_2235774_-	hypothetical protein	NA	A0A0S2MUR2	Bacillus_phage	45.2	4.5e-26
WP_014470582.1|2235770_2236001_-	hypothetical protein	NA	J9PL10	Bacillus_phage	44.2	2.3e-11
WP_014470583.1|2235997_2236465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155894.1|2236496_2236700_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_014470584.1|2236781_2236934_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.6e-08
WP_014470585.1|2236991_2237420_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	3.6e-42
WP_014470586.1|2237514_2237658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031378524.1|2237650_2238445_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.0	4.5e-62
WP_014470588.1|2238362_2239070_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_076983677.1|2239267_2240005_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	44.0	2.2e-50
WP_014470591.1|2240024_2240942_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.1	1.5e-88
WP_014470592.1|2240941_2241127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470593.1|2241229_2241433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470594.1|2241429_2241687_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.7	2.1e-08
WP_014470595.1|2241683_2242256_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.6	3.4e-59
WP_014470596.1|2242406_2242598_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470597.1|2242608_2242833_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	79.7	3.6e-25
WP_014470598.1|2242990_2243377_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	70.7	1.1e-26
WP_014470599.1|2243695_2244670_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	77.5	4.5e-80
WP_014470600.1|2244686_2245169_+	PH domain-containing protein	NA	O64019	Bacillus_phage	90.6	4.8e-75
WP_014470601.1|2245235_2245757_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	64.0	1.6e-55
WP_014470602.1|2245761_2246991_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	50.0	4.2e-107
WP_013351871.1|2247332_2248508_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
2247033:2247050	attR	GTCCCCAATTCGTCCCCA	NA	NA	NA	NA
WP_014470603.1|2248500_2249622_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_013351869.1|2249991_2250714_+	esterase family protein	NA	NA	NA	NA	NA
WP_013351868.1|2250739_2251255_+	YjcG family protein	NA	NA	NA	NA	NA
WP_013351867.1|2251259_2251691_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351866.1|2251848_2252082_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013351865.1|2252082_2252820_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	6.7e-28
WP_013351864.1|2252812_2253535_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351863.1|2253571_2254324_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_013351862.1|2254389_2254644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470605.1|2254764_2257050_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	32.9	5.4e-84
WP_013351860.1|2257117_2257372_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_014470606.1|2257538_2257718_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013351859.1|2257809_2258007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351858.1|2258295_2258652_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_014470608.1|2258822_2259209_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|2259246_2259561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351855.1|2259653_2260154_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|2260303_2260786_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|2260934_2261378_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_164848957.1|2261435_2262029_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 13
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	2581928	2641371	3937511	tRNA,coat,protease	uncultured_Mediterranean_phage(33.33%)	59	NA	NA
WP_013353029.1|2581928_2582372_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014470772.1|2582384_2584589_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.5e-09
WP_013353031.1|2584747_2585260_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	7.2e-29
WP_013353032.1|2585265_2587623_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	2.8e-91
WP_013353033.1|2587678_2588005_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_013353034.1|2588068_2588566_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_013353035.1|2588696_2590916_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.9	3.5e-27
WP_013353036.1|2590952_2591249_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_013353037.1|2591363_2592920_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_013353038.1|2592927_2593584_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013353039.1|2593750_2594137_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2594189_2594450_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014470773.1|2594481_2595624_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.6	1.4e-88
WP_013353041.1|2595651_2596680_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013353042.1|2596705_2596906_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013353043.1|2596898_2597903_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	5.2e-07
WP_003152683.1|2597913_2598519_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038463270.1|2598653_2599130_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014470776.1|2599539_2600133_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014470777.1|2600281_2601433_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014470778.1|2601559_2602663_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014470779.1|2602662_2603511_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014470780.1|2603492_2605058_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013353051.1|2605163_2606315_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.5	5.1e-30
WP_013353052.1|2606311_2606854_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013353053.1|2606880_2607738_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2607753_2608197_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_013353054.1|2608250_2609537_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013353055.1|2609568_2610147_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2610463_2610748_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038462961.1|2610760_2611102_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2611104_2611413_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013353057.1|2611558_2612425_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013353058.1|2612417_2613221_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2613349_2614153_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013353059.1|2614155_2614836_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014470782.1|2614889_2615408_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013353061.1|2615404_2616268_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013353062.1|2616298_2617312_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_013353063.1|2617403_2618099_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013353064.1|2618130_2618700_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013353065.1|2618841_2619843_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013353066.1|2619969_2620722_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013353067.1|2620861_2622154_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013353068.1|2622212_2624855_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_013353069.1|2625305_2625497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353070.1|2625511_2626534_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013353071.1|2626567_2628091_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353072.1|2628223_2629513_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_088613212.1|2629541_2630516_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013353074.1|2630518_2631301_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013353075.1|2631290_2632232_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2632266_2633097_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_013353076.1|2633104_2634472_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013353077.1|2634668_2635160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353078.1|2635192_2635780_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013353079.1|2635776_2638101_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	8.8e-183
WP_013353080.1|2638299_2639958_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_014470784.1|2640108_2641371_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	2.5e-147
>prophage 14
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	2866111	2941657	3937511	plate,portal,tail,capsid,terminase,holin,integrase,head,protease	Bacillus_phage(28.57%)	79	2904062:2904109	2941829:2941876
WP_014470850.1|2866111_2866516_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2866651_2867089_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2867213_2867363_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2867359_2867803_-	FixH family protein	NA	NA	NA	NA	NA
WP_013353278.1|2867919_2868393_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2868518_2868746_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2868742_2869312_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2869438_2869687_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2869883_2871215_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2871237_2872278_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2872335_2872494_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2872666_2873782_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_014470853.1|2873778_2875242_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	2.4e-77
WP_013353287.1|2875329_2876148_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2876206_2877031_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_014470854.1|2877018_2878755_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2878751_2880164_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2880447_2881167_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013353292.1|2881310_2881781_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_014470856.1|2889128_2889710_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2889741_2891271_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2891290_2891821_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013353296.1|2891967_2892456_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2892457_2893039_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2893109_2894318_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|2894335_2895808_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|2896008_2896569_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|2896735_2897275_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_013353302.1|2897438_2898107_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|2898130_2898976_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|2899115_2900291_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|2901207_2901531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|2902223_2903354_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|2903741_2903945_+	hypothetical protein	NA	NA	NA	NA	NA
2904062:2904109	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_013353310.1|2906637_2907033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353311.1|2907022_2907436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470866.1|2907621_2907846_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
WP_014470867.1|2907968_2908271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470868.1|2908326_2908632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353313.1|2908646_2910062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470869.1|2910112_2910478_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_014470870.1|2910508_2910751_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
WP_013353316.1|2911214_2911886_-	M15 family metallopeptidase	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
WP_013353317.1|2911927_2912335_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	67.2	1.6e-39
WP_013353318.1|2912372_2912546_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
WP_013353319.1|2912548_2912830_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
WP_038463007.1|2912826_2914104_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	52.9	1.8e-81
WP_013353321.1|2914117_2916706_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
WP_013353322.1|2916720_2918601_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	26.8	8.5e-51
WP_013353323.1|2918615_2919449_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013353324.1|2919460_2923234_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	56.4	9.5e-110
WP_013353325.1|2923300_2923486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353326.1|2923497_2923848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353327.1|2923935_2924520_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
WP_013353328.1|2924552_2924936_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014470873.1|2924932_2925316_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
WP_013353329.1|2925315_2925639_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
WP_014470874.1|2925625_2925922_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
WP_013353330.1|2925977_2927171_-|capsid	phage major capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
WP_014470875.1|2927208_2927805_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
WP_013353331.1|2927797_2929042_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
WP_014470876.1|2929046_2929250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353332.1|2929261_2930965_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
WP_013353333.1|2930961_2931435_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_013353334.1|2931706_2931940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353335.1|2931954_2932338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470877.1|2932352_2932643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470878.1|2932636_2932828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353336.1|2933214_2933493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353337.1|2933489_2933669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470882.1|2934091_2934283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470883.1|2934463_2934634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353339.1|2934648_2935398_-	Bro-N domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	39.8	1.6e-21
WP_014470884.1|2937820_2937994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470885.1|2938260_2938395_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_013353340.1|2938439_2939402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470886.1|2939606_2939786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013353341.1|2939972_2940506_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013353342.1|2940505_2941657_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.8	7.8e-31
2941829:2941876	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
>prophage 15
NC_017188	Bacillus amyloliquefaciens TA208, complete sequence	3937511	3046867	3099303	3937511	plate,portal,tail,terminase,bacteriocin,holin,integrase,coat	Bacillus_phage(28.57%)	61	3038746:3038761	3096010:3096025
3038746:3038761	attL	TTTTCCGGCTGATTCT	NA	NA	NA	NA
WP_003151973.1|3046867_3047203_-|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014470922.1|3047269_3047842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470925.1|3049014_3049776_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470927.1|3050261_3050564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470928.1|3050690_3050948_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	6.6e-23
WP_038463031.1|3050968_3051907_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.0	1.4e-94
WP_013351581.1|3051986_3052196_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_014470930.1|3052199_3052388_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|3052388_3052658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080292733.1|3052672_3054223_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.0	6.1e-55
WP_014470933.1|3054268_3056833_-	peptidase G2	NA	D6R401	Bacillus_phage	74.3	0.0e+00
WP_014470934.1|3056847_3058248_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_014470935.1|3058259_3059684_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	3.1e-61
WP_014470936.1|3059690_3061913_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	37.8	3.4e-59
WP_014470937.1|3062161_3062770_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_014470938.1|3063102_3063474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470939.1|3063531_3064086_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_014470940.1|3064110_3064500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470941.1|3064506_3064914_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
WP_038463040.1|3064910_3065246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470943.1|3065246_3065633_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	4.6e-20
WP_014470944.1|3065646_3065838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470945.1|3065894_3066803_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	9.3e-80
WP_014470946.1|3066834_3067401_-	hypothetical protein	NA	M1NRH2	Streptococcus_phage	30.7	6.1e-05
WP_014470947.1|3067491_3068316_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.4	2.0e-73
WP_014470948.1|3068315_3069956_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.5	1.4e-163
WP_014470949.1|3069961_3070393_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	2.5e-30
WP_014470950.1|3070409_3072164_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
WP_014470951.1|3072246_3072795_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_014470954.1|3073295_3073541_-	hypothetical protein	NA	A0A2H4IZN0	uncultured_Caudovirales_phage	68.3	1.6e-05
WP_014470955.1|3073812_3074091_-	hypothetical protein	NA	A0A217EQU8	Bacillus_phage	42.4	3.9e-13
WP_014470956.1|3074927_3075527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470957.1|3076219_3077011_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	31.9	7.2e-28
WP_014470958.1|3077097_3077595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470959.1|3077608_3078385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470960.1|3078497_3078731_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470961.1|3078847_3079651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470962.1|3080150_3080327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470963.1|3080319_3080661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470964.1|3080657_3080984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470965.1|3081021_3081564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470966.1|3081556_3081694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470967.1|3082161_3083337_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	35.3	2.9e-57
WP_014470968.1|3083456_3083672_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470970.1|3083987_3084326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470972.1|3084921_3085149_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470973.1|3085208_3085391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470974.1|3085421_3086147_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.9	6.6e-20
WP_014470975.1|3086306_3087338_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.3	6.7e-34
WP_013353444.1|3087568_3087931_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.9	4.0e-18
WP_014470976.1|3088005_3088860_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014470977.1|3088980_3090201_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.5	1.7e-12
WP_014470978.1|3090335_3090572_-	YuzB family protein	NA	NA	NA	NA	NA
WP_014470979.1|3090838_3091906_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470980.1|3091943_3092270_-	YuzD family protein	NA	NA	NA	NA	NA
WP_171866182.1|3092349_3092685_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	43.5	2.9e-10
WP_038463286.1|3092717_3094700_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_013353450.1|3094801_3095731_-	homoserine kinase	NA	NA	NA	NA	NA
WP_014470982.1|3095727_3096786_-	threonine synthase	NA	NA	NA	NA	NA
3096010:3096025	attR	TTTTCCGGCTGATTCT	NA	NA	NA	NA
WP_013353452.1|3096785_3098087_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_014472214.1|3098286_3099303_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
