The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015388	Desulfobacca acetoxidans DSM 11109, complete sequence	3282536	992118	1060677	3282536	integrase,transposase,tRNA	Staphylococcus_phage(33.33%)	60	1005525:1005546	1033835:1033856
WP_013705839.1|992118_993489_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_013705840.1|993485_994229_-	Jag N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013705841.1|994246_995947_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_013705842.1|996163_996382_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.5	6.6e-16
WP_013705843.1|996365_996743_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_013705844.1|996793_996928_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_013705845.1|997448_998771_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_013705846.1|998826_999324_+	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_013705847.1|999331_999994_+	histidinol phosphate phosphatase domain-containing protein	NA	NA	NA	NA	NA
WP_041283797.1|1000273_1000660_+	RidA family protein	NA	NA	NA	NA	NA
WP_013705849.1|1000747_1001539_+	DUF169 domain-containing protein	NA	NA	NA	NA	NA
WP_013705850.1|1002039_1002687_+	succinate dehydrogenase/fumarate reductase cytochrome b subunit	NA	NA	NA	NA	NA
WP_013705851.1|1002683_1004504_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_013705852.1|1004516_1005248_+	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
1005525:1005546	attL	CCAAGAATATCAAGGGGTTAGC	NA	NA	NA	NA
WP_041283798.1|1005599_1005827_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013705853.1|1006105_1007818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013705854.1|1008146_1008815_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013705855.1|1008826_1012231_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_148231280.1|1012552_1013182_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_013705857.1|1013371_1014625_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013705858.1|1014897_1016115_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013705859.1|1016135_1017005_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_041283800.1|1017043_1018054_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013705861.1|1018023_1018791_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.2e-14
WP_013705862.1|1018787_1019546_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.1e-12
WP_013705863.1|1019691_1020678_+	MCE family protein	NA	NA	NA	NA	NA
WP_013705864.1|1020746_1022162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705866.1|1023319_1024096_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013705867.1|1024166_1024607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705869.1|1024967_1027235_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	32.1	1.4e-31
WP_013705870.1|1027231_1028554_+	5-methylcytosine restriction system component-like protein	NA	NA	NA	NA	NA
WP_013705871.1|1028743_1028980_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013705872.1|1028984_1029140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705873.1|1029302_1030148_+|integrase	site-specific integrase	integrase	G8C7K6	Escherichia_phage	33.1	1.1e-29
WP_052301891.1|1030430_1030847_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013705874.1|1031047_1031446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705875.1|1031442_1032108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705876.1|1032126_1032831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705877.1|1032839_1033562_+	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_013705878.1|1034147_1035170_-	WYL domain-containing protein	NA	NA	NA	NA	NA
1033835:1033856	attR	GCTAACCCCTTGATATTCTTGG	NA	NA	NA	NA
WP_013705879.1|1035703_1036711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148231178.1|1036770_1037094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705881.1|1037551_1038091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705882.1|1038094_1039252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705883.1|1039266_1040646_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013705884.1|1040645_1041896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705885.1|1041892_1045417_+	SAM-dependent DNA methyltransferase	NA	Q8V6N5	Halorubrum_phage	28.5	4.4e-08
WP_013705886.1|1045418_1046942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705887.1|1047036_1047861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705888.1|1047885_1048839_+	transcriptional coactivator p15/PC4 family protein	NA	NA	NA	NA	NA
WP_013705889.1|1049218_1050403_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	24.5	6.0e-10
WP_013705890.1|1050404_1050830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148231281.1|1051003_1052435_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_169311504.1|1052495_1052639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052301892.1|1052697_1053264_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_148231179.1|1053241_1053898_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013705893.1|1054391_1055555_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	27.4	2.6e-34
WP_041284213.1|1055659_1057216_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	34.4	5.0e-73
WP_148231180.1|1057492_1058743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013705896.1|1058922_1060677_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_015388	Desulfobacca acetoxidans DSM 11109, complete sequence	3282536	1687226	1696226	3282536	head,protease	uncultured_Caudovirales_phage(50.0%)	8	NA	NA
WP_148231204.1|1687226_1688684_+	hypothetical protein	NA	A0A2H4JE58	uncultured_Caudovirales_phage	27.9	1.2e-44
WP_041283856.1|1688879_1689131_+	ChaB family protein	NA	NA	NA	NA	NA
WP_013706449.1|1689163_1690393_+	DUF935 domain-containing protein	NA	A0A2H4JAU9	uncultured_Caudovirales_phage	45.9	3.9e-97
WP_013706450.1|1690389_1691493_+|protease	phage protease	protease	H7BWC3	unidentified_phage	32.2	7.5e-31
WP_013706451.1|1691495_1691894_+	DUF2190 family protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	35.7	5.8e-10
WP_013706452.1|1691913_1692804_+|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	47.3	1.0e-75
WP_013706453.1|1692878_1693196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013706454.1|1693298_1696226_+	hypothetical protein	NA	A0A2I7QM87	Vibrio_phage	35.7	3.1e-07
