The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	20326	66668	3069926	bacteriocin,transposase,protease,holin	Planktothrix_phage(25.0%)	46	NA	NA
WP_003568480.1|20326_21184_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|21263_21446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490759.1|21496_21676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572828.1|22173_23409_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_012490760.1|23612_26186_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|26198_26900_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_012490761.1|27179_27731_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003584074.1|27774_28581_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003584076.1|28585_28906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566351.1|29131_29812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490762.1|29744_30248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490763.1|30267_32418_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_012490764.1|32486_33374_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014951491.1|33555_34161_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|34284_35178_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_012490766.1|35226_35865_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|36093_37470_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_012490767.1|37692_38037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|38112_38472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490768.1|38712_40155_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003577239.1|40349_40985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577240.1|41034_41346_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003577242.1|41514_41703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577243.1|41834_42446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659032.1|42803_43277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568611.1|43428_43767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490769.1|44100_44811_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003592450.1|44797_45127_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_012490770.1|46007_46223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490771.1|46569_47445_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012490772.1|47790_48441_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_012490773.1|48609_50025_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003562575.1|50406_51099_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562576.1|51797_52118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490774.1|52306_53182_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	1.0e-11
WP_012490775.1|53274_54867_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_012490776.1|55204_56578_-	MFS transporter	NA	NA	NA	NA	NA
WP_011673959.1|56755_57079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490777.1|57259_60571_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|60567_61170_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|61420_61681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|61893_62556_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|62555_63485_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|63496_64126_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012490780.1|64128_65382_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|66014_66668_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	334914	395357	3069926	transposase,protease	Staphylococcus_phage(50.0%)	57	NA	NA
WP_014566389.1|334914_335604_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024109404.1|335667_336354_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012490911.1|336436_336826_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003577580.1|336857_337382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566391.1|337371_337641_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012490773.1|337748_339164_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_016363600.1|339589_340315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577587.1|340314_340995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490915.1|340984_341773_-	membrane protein	NA	NA	NA	NA	NA
WP_012490917.1|342223_343750_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	7.4e-53
WP_012490918.1|344020_345142_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012490919.1|345134_346103_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003573439.1|346103_346415_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012490920.1|346556_347843_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003604285.1|347859_348282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|348303_349164_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_012490921.1|349276_349918_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_003563255.1|350204_351035_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003563257.1|351027_351897_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012490922.1|351936_352932_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_003563261.1|353486_354266_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	1.0e-05
WP_012490923.1|355519_356254_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_003601683.1|356160_357159_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_012490924.1|357217_358099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563273.1|360810_361209_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003563277.1|361321_361693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563280.1|363705_364548_+	serine hydrolase	NA	NA	NA	NA	NA
WP_016364816.1|364644_365124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490929.1|365123_365354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586699.1|365437_366421_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003586701.1|366779_367604_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012490930.1|367590_368328_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003601683.1|369325_370324_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_012490933.1|371047_371902_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	29.2	8.4e-14
WP_012490934.1|371904_372684_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014566730.1|372696_373821_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_003604304.1|374168_375104_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_012490936.1|375115_376522_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_012490937.1|376537_377035_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012490938.1|377077_377818_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012490939.1|377962_378760_-	protein SipE	NA	NA	NA	NA	NA
WP_003586715.1|378770_379613_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_012490940.1|379616_380384_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586720.1|380409_380919_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003586723.1|380946_381354_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012490941.1|381648_384387_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_014951596.1|384428_385724_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_012490943.1|386133_387591_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_012490944.1|387592_388063_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012490945.1|388064_389006_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_012490946.1|389035_389509_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003586737.1|389505_389823_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014566402.1|389838_390924_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012490948.1|390946_391921_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_012490949.1|391927_392614_+	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_012490950.1|392732_394199_+	xylulokinase	NA	NA	NA	NA	NA
WP_012490951.1|394358_395357_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.5e-49
>prophage 3
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	552513	610673	3069926	integrase,transposase	Lactobacillus_phage(59.09%)	71	553034:553049	584359:584374
WP_003577893.1|552513_553443_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
553034:553049	attL	TCGTTGCTGGCGTCGG	NA	NA	NA	NA
WP_012491046.1|553636_554182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569067.1|554502_555672_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003573997.1|555784_556045_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003589914.1|556134_556755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491047.1|556738_556975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589919.1|557167_557875_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|558033_558456_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|558448_558802_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|559045_559294_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|559335_559536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|559506_560340_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_010493122.1|560400_561159_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|561159_561339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572196.1|561331_561583_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|561648_562005_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|562089_562293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|562275_562821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010493132.1|563001_563316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589923.1|563308_564055_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_012491048.1|564069_564894_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	74.7	9.6e-116
WP_003574016.1|564893_565412_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003564822.1|565458_565881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572217.1|565882_566620_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	1.3e-47
WP_010493149.1|566631_566919_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_010493151.1|566988_567321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|567835_568279_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_003572221.1|568792_569446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491050.1|569696_570695_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	3.9e-55
WP_003573729.1|570890_571109_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|572641_572977_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|573096_573429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|573458_574187_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_014951815.1|574120_575062_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_016364094.1|575107_575971_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_010493185.1|576700_576979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|576990_577257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|577275_577452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|577453_577681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493190.1|577723_578965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493192.1|578942_580493_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_012491056.1|580502_580922_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012491057.1|580930_581509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491058.1|581535_583995_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012491059.1|583991_586049_+	hypothetical protein	NA	NA	NA	NA	NA
584359:584374	attR	TCGTTGCTGGCGTCGG	NA	NA	NA	NA
WP_003582234.1|586054_586390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566422.1|586373_586970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491061.1|586950_588879_+	type IV secretory pathway, VirB4 protein	NA	NA	NA	NA	NA
WP_012491062.1|588880_589891_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	37.9	1.2e-14
WP_012491063.1|589906_590551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491064.1|590547_590955_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014566423.1|590944_591766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491066.1|592360_592561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491067.1|592557_592815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491068.1|592853_593288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491069.1|593280_594525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016379926.1|594566_594812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566736.1|594798_597330_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_012491073.1|597945_598335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660106.1|598337_598481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491077.1|599236_599683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491078.1|600185_601067_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_012491079.1|601083_601443_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012491080.1|601521_602193_+	class A sortase	NA	NA	NA	NA	NA
WP_012491081.1|602327_602558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168760.1|602978_604535_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_095691935.1|605219_606007_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003586210.1|605961_606339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491083.1|606374_606647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491084.1|606706_609511_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.6	1.5e-72
WP_014566738.1|610052_610673_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.9	1.1e-55
>prophage 4
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	620305	631680	3069926	transposase	Lactobacillus_phage(100.0%)	12	NA	NA
WP_123796556.1|620305_621093_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_123031263.1|621544_622288_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.4	1.5e-136
WP_012491102.1|622560_622692_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	90.7	2.3e-16
WP_003593245.1|622948_623866_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003593246.1|624012_624621_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.8e-50
WP_010010565.1|624631_625900_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.7	1.8e-49
WP_012491102.1|626173_626305_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	90.7	2.3e-16
WP_123031263.1|626577_627321_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.4	1.5e-136
WP_012491103.1|627525_629205_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012491105.1|629551_629749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|629723_630077_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012491106.1|630177_631680_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	886456	954562	3069926	capsid,protease,tRNA,holin,head,integrase,portal,tail,terminase,transposase	Lactobacillus_phage(94.23%)	73	913103:913119	959627:959643
WP_011674296.1|886456_887959_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003564071.1|888253_888802_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014566463.1|889181_890900_+	APC family permease	NA	NA	NA	NA	NA
WP_003569394.1|891186_892395_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003564079.1|892397_893426_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003564081.1|893438_894452_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003564083.1|894487_894841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566464.1|894926_896102_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003564087.1|896347_896626_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_012491223.1|896856_898950_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.9	6.1e-151
WP_003564091.1|899142_899583_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003569415.1|905642_906290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564111.1|906470_907655_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.5e-141
WP_003564114.1|907768_909262_+	MFS transporter	NA	NA	NA	NA	NA
WP_012491224.1|909356_909827_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003569431.1|910070_911549_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003598039.1|911545_912271_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_003578172.1|912371_913055_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
913103:913119	attL	AAGGATCTTGGTCGCAA	NA	NA	NA	NA
WP_003578174.1|913633_916045_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003564130.1|916310_917954_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012491225.1|917958_918669_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003569458.1|918811_919027_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003569460.1|919143_919965_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_012491226.1|919961_920465_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012491227.1|920788_921928_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	100.0	2.4e-218
WP_003598052.1|922045_923113_-	Abi family protein	NA	A0A0N7IRA5	Lactobacillus_phage	100.0	1.1e-207
WP_003598055.1|923257_923689_-	hypothetical protein	NA	A0A0P0IJV8	Lactobacillus_phage	100.0	6.8e-73
WP_012491228.1|923758_924241_-	hypothetical protein	NA	A0A0P0IZP3	Lactobacillus_phage	100.0	2.1e-83
WP_003598059.1|924244_924538_-	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	100.0	5.7e-47
WP_012491229.1|924721_925582_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	100.0	2.8e-158
WP_012491230.1|925568_925937_-	helix-turn-helix domain-containing protein	NA	A0A0P0I3L3	Lactobacillus_phage	100.0	2.8e-59
WP_003578190.1|926192_926390_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_012491231.1|926386_927109_+	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	100.0	1.4e-126
WP_014951753.1|927116_927329_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	100.0	7.8e-30
WP_003657835.1|927437_927662_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_012491233.1|927750_927963_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
WP_012491234.1|927972_928848_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	100.0	1.1e-170
WP_012491235.1|928850_929045_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	100.0	2.5e-30
WP_012491236.1|929044_929932_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	100.0	8.6e-163
WP_012491237.1|929940_930186_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	100.0	2.6e-37
WP_012491238.1|930190_931036_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	100.0	1.0e-133
WP_012491239.1|931073_931895_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	100.0	6.1e-155
WP_012491240.1|931891_932191_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	100.0	2.1e-49
WP_014566466.1|932153_932438_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	100.0	8.8e-45
WP_014566751.1|932406_932754_+	hypothetical protein	NA	A0A0P0IQU7	Lactobacillus_phage	100.0	1.5e-62
WP_012491243.1|932746_933325_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	100.0	1.1e-105
WP_012491244.1|933338_933761_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	100.0	5.5e-75
WP_012491245.1|933765_934029_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	100.0	6.1e-40
WP_012491246.1|934052_934376_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	100.0	9.7e-56
WP_012491247.1|934454_934904_+	hypothetical protein	NA	A0A0P0IZR0	Lactobacillus_phage	100.0	1.2e-80
WP_012491248.1|935128_935509_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	100.0	2.5e-71
WP_003582259.1|935578_935953_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_012491250.1|935955_937686_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	100.0	0.0e+00
WP_012491251.1|937704_938940_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	100.0	2.6e-234
WP_012491252.1|938917_939625_+|protease	Clp protease ClpP	protease	A0A0P0HRU7	Lactobacillus_phage	100.0	7.2e-128
WP_014566753.1|939629_940859_+|capsid	phage major capsid protein	capsid	A0A0P0IV50	Lactobacillus_phage	99.8	1.6e-228
WP_012491254.1|940932_941181_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	100.0	9.1e-38
WP_003582271.1|941194_941521_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|941459_941798_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491256.1|941781_942111_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	100.0	3.1e-57
WP_012491257.1|942100_942484_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	100.0	4.5e-68
WP_014566754.1|942495_943143_+	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	99.5	2.8e-118
WP_003595114.1|943219_943585_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_003582283.1|943665_943827_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	100.0	7.5e-25
WP_012491260.1|943846_946819_+	tape measure protein	NA	A0A0P0IZN3	Lactobacillus_phage	100.0	1.3e-292
WP_012491261.1|946825_947521_+	hypothetical protein	NA	A0A0P0HRV6	Lactobacillus_phage	100.0	8.3e-129
WP_014566469.1|947517_951924_+|tail	phage tail protein	tail	A0A0N7IRA4	Lactobacillus_phage	100.0	0.0e+00
WP_012491263.1|951952_952378_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	100.0	8.8e-73
WP_012491264.1|952380_952650_+	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	100.0	2.4e-39
WP_012491265.1|952695_952989_+	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	100.0	4.0e-48
WP_012491266.1|952978_953413_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	100.0	7.4e-51
WP_012491267.1|953412_953601_+	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
WP_012491268.1|953587_954562_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	100.0	9.1e-198
959627:959643	attR	AAGGATCTTGGTCGCAA	NA	NA	NA	NA
>prophage 6
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	1011684	1070161	3069926	capsid,protease,holin,head,integrase,portal,tail,terminase	Lactobacillus_phage(86.79%)	64	1035335:1035353	1070243:1070261
WP_003564220.1|1011684_1012020_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003564222.1|1012211_1013171_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003578277.1|1013172_1014000_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003583985.1|1014010_1015066_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_012491289.1|1015131_1016085_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	47.9	8.9e-81
WP_012491290.1|1016668_1018396_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.9	3.3e-182
WP_003569557.1|1018630_1019278_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014566477.1|1019270_1020281_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014566756.1|1021051_1023418_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003564240.1|1023575_1024223_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003578292.1|1024428_1026444_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_012491295.1|1026711_1029603_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003564246.1|1029954_1030494_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|1030656_1031544_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|1031540_1032569_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_012491296.1|1032573_1033521_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|1033906_1034362_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|1034478_1035069_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
1035335:1035353	attL	TGTGCAATTTGTGTGCAAT	NA	NA	NA	NA
WP_012491297.1|1035473_1036625_-|integrase	site-specific integrase	integrase	Q8W767	Lactobacillus_phage	100.0	2.2e-219
WP_012491298.1|1036735_1037497_-	hypothetical protein	NA	A0A1B0YA83	Lactobacillus_phage	100.0	1.2e-144
WP_012491299.1|1037515_1037746_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	100.0	7.2e-37
WP_012491300.1|1038001_1038781_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	100.0	9.1e-116
WP_012491301.1|1038852_1039257_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	100.0	2.1e-76
WP_012491302.1|1039253_1039580_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	100.0	3.4e-56
WP_012491304.1|1040050_1040824_+	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	100.0	1.3e-143
WP_012491305.1|1040855_1041179_+	DUF771 domain-containing protein	NA	A0A1B0Y6D5	Lactobacillus_phage	100.0	1.2e-58
WP_012491308.1|1041446_1041758_-	hypothetical protein	NA	A0A1B0YA89	Lactobacillus_phage	100.0	8.2e-52
WP_012491309.1|1041818_1042010_+	hypothetical protein	NA	A0A1B0Y2S8	Lactobacillus_phage	100.0	6.4e-31
WP_012491310.1|1042023_1042263_+	hypothetical protein	NA	A0A1B0Y2S6	Lactobacillus_phage	100.0	7.7e-34
WP_012491311.1|1042267_1042762_+	siphovirus Gp157 family protein	NA	A0A1B0Y2S7	Lactobacillus_phage	100.0	9.9e-84
WP_012491312.1|1042773_1043004_+	hypothetical protein	NA	A0A1B0Y3N2	Lactobacillus_phage	100.0	3.0e-35
WP_012491313.1|1043003_1044371_+	DEAD/DEAH box helicase	NA	A0A1B0YC45	Lactobacillus_phage	100.0	1.6e-264
WP_012491314.1|1044372_1045113_+	AAA family ATPase	NA	A0A1B0YEB5	Lactobacillus_phage	100.0	4.1e-134
WP_012491315.1|1045115_1045625_+	hypothetical protein	NA	A0A1B0Y6E2	Lactobacillus_phage	100.0	4.1e-93
WP_012491316.1|1045691_1046489_+	bifunctional DNA primase/polymerase	NA	A0A1B0Y4T1	Lactobacillus_phage	100.0	1.4e-151
WP_012491317.1|1046493_1047729_+	helicase	NA	A0A1B0Y896	Lactobacillus_phage	100.0	1.1e-237
WP_012491318.1|1048003_1048318_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	100.0	1.4e-54
WP_012491319.1|1048324_1048609_+	hypothetical protein	NA	A0A1B0Y2T1	Lactobacillus_phage	100.0	6.8e-45
WP_014951787.1|1048577_1048925_+	hypothetical protein	NA	A0A1B0Y2S9	Lactobacillus_phage	99.1	2.2e-58
WP_012491321.1|1048917_1049505_+	HNH endonuclease	NA	A0A1B0Y2T0	Lactobacillus_phage	100.0	9.9e-107
WP_012491322.1|1049491_1049746_+	hypothetical protein	NA	A0A1B0Y3N3	Lactobacillus_phage	100.0	2.3e-44
WP_012491323.1|1049742_1050147_+	transcriptional regulator	NA	A0A1B0YC57	Lactobacillus_phage	100.0	9.3e-72
WP_012491324.1|1050311_1050692_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	100.0	1.5e-71
WP_003582259.1|1050760_1051135_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_003582261.1|1051137_1052868_+|terminase	terminase large subunit	terminase	A0A1B0Y6B8	Lactobacillus_phage	99.7	0.0e+00
WP_012491327.1|1052886_1054122_+|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	100.0	1.2e-234
WP_014566759.1|1054099_1054807_+|protease	Clp protease ClpP	protease	A0A0P0HRU7	Lactobacillus_phage	98.7	1.4e-126
WP_014566760.1|1054811_1056041_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	99.8	1.6e-228
WP_012491330.1|1056114_1056363_+	hypothetical protein	NA	A0A1B0Y2R9	Lactobacillus_phage	100.0	7.0e-38
WP_003582271.1|1056376_1056703_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|1056641_1056980_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491256.1|1056963_1057293_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	100.0	3.1e-57
WP_012491257.1|1057282_1057666_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	100.0	4.5e-68
WP_012491333.1|1057677_1058325_+	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	100.0	1.2e-118
WP_003595114.1|1058401_1058767_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_014566481.1|1059029_1062200_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	99.9	0.0e+00
WP_012491336.1|1062206_1062902_+	hypothetical protein	NA	A0A1B0Y2S2	Lactobacillus_phage	100.0	8.3e-129
WP_014566761.1|1062898_1067302_+|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	99.9	0.0e+00
WP_012491263.1|1067330_1067756_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	100.0	8.8e-73
WP_012491338.1|1067758_1068028_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	100.0	1.3e-40
WP_012491339.1|1068075_1068462_+	hypothetical protein	NA	A0A1B0YC31	Lactobacillus_phage	100.0	5.6e-66
WP_004562059.1|1068442_1068649_+	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	100.0	1.4e-12
WP_012491341.1|1068645_1069107_+|holin	phage holin	holin	A0A1B0Y6C9	Lactobacillus_phage	100.0	1.2e-70
WP_012491342.1|1069108_1070161_+	peptidoglycan recognition protein	NA	A0A1B0Y4R9	Lactobacillus_phage	100.0	2.3e-207
1070243:1070261	attR	TGTGCAATTTGTGTGCAAT	NA	NA	NA	NA
>prophage 7
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	1209009	1286525	3069926	capsid,holin,head,integrase,portal,tail,terminase,transposase	Lactobacillus_phage(87.1%)	86	1209001:1209060	1286475:1287591
1209001:1209060	attL	GACGAATTGTCAACTCAAGTGCAACTTTTTACCCATGAAGACTTCTGATGGCGTCTTCCA	NA	NA	NA	NA
WP_003601683.1|1209009_1210008_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_012491408.1|1210066_1210948_+	DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_012491409.1|1210922_1211243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566766.1|1211256_1212870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491411.1|1213067_1214516_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_012491412.1|1214596_1216450_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012491413.1|1216536_1217367_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_012491414.1|1218032_1220696_-	YfhO family protein	NA	NA	NA	NA	NA
WP_012491415.1|1221006_1222746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491416.1|1223097_1224027_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.7	3.9e-73
WP_014566504.1|1224113_1224752_-	YkyA family protein	NA	NA	NA	NA	NA
WP_012491418.1|1224879_1225845_+	membrane protein	NA	NA	NA	NA	NA
WP_080513729.1|1225992_1226121_+	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_003566521.1|1226804_1227005_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.2e-19
WP_012491419.1|1227246_1227729_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003661214.1|1227728_1228370_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	47.7	8.5e-27
WP_003566514.1|1228560_1229139_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003566511.1|1229145_1230474_+	purine permease	NA	Q9KX94	Enterobacteria_phage	31.7	1.6e-35
WP_003598329.1|1230494_1231604_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_012491420.1|1231673_1232969_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	28.5	4.4e-14
WP_012491421.1|1233090_1233660_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003566502.1|1233669_1234416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491422.1|1234501_1236757_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.6	4.7e-157
WP_003566498.1|1237222_1237828_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003566496.1|1237999_1238857_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_014566769.1|1239070_1240411_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012491423.1|1240537_1241722_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	100.0	6.6e-227
WP_012491424.1|1241850_1242180_-	hypothetical protein	NA	A0A0P0IJW6	Lactobacillus_phage	100.0	1.7e-39
WP_012491425.1|1242172_1242631_-	hypothetical protein	NA	A0A0P0ID57	Lactobacillus_phage	100.0	1.2e-86
WP_012491427.1|1242929_1243355_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	100.0	9.8e-64
WP_012491428.1|1243453_1244347_-	hypothetical protein	NA	A0A1B0YE50	Lactobacillus_phage	100.0	4.3e-162
WP_014566771.1|1244397_1245741_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	100.0	7.6e-195
WP_012491430.1|1245830_1246181_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	100.0	3.3e-57
WP_012491431.1|1246237_1246816_-	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	100.0	8.8e-108
WP_012491432.1|1246874_1247294_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	100.0	1.2e-77
WP_012491433.1|1247283_1247622_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	100.0	7.0e-57
WP_003585053.1|1247761_1247962_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	100.0	6.2e-29
WP_003574526.1|1247998_1248310_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	100.0	2.2e-52
WP_012491434.1|1248603_1248750_+	hypothetical protein	NA	A0A1B0YC03	Lactobacillus_phage	100.0	1.0e-20
WP_012491435.1|1248815_1249364_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	100.0	1.1e-99
WP_003594176.1|1249342_1249564_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	100.0	1.8e-37
WP_014951828.1|1249804_1250212_+	hypothetical protein	NA	A0A1B0Y842	Lactobacillus_phage	100.0	1.1e-75
WP_012491438.1|1250224_1251088_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	100.0	1.1e-159
WP_014566774.1|1251068_1251869_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.5	3.1e-143
WP_012491440.1|1251884_1252850_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	100.0	1.3e-140
WP_012491441.1|1252976_1253357_-	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	100.0	1.4e-66
WP_012491442.1|1253691_1253904_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
WP_012491443.1|1253900_1254350_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	100.0	1.2e-72
WP_012491444.1|1254396_1254651_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	100.0	2.6e-40
WP_003661419.1|1254647_1255013_+	endodeoxyribonuclease	NA	A0A0P0I7M2	Lactobacillus_phage	100.0	1.8e-66
WP_012491445.1|1255025_1255319_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	2.6e-47
WP_012491447.1|1255324_1255522_+	hypothetical protein	NA	A0A1B0Y850	Lactobacillus_phage	100.0	2.8e-29
WP_012491448.1|1255892_1256336_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	100.0	1.3e-79
WP_012491450.1|1257820_1258969_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	100.0	4.6e-225
WP_016379922.1|1258961_1259285_+	phage-related protein, ribonucleoside-diphosphate reductase	NA	A0A0P0IJY9	Lactobacillus_phage	100.0	1.0e-57
WP_012491452.1|1259321_1259894_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	100.0	1.0e-84
WP_012491453.1|1259877_1261131_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	100.0	3.5e-250
WP_012491454.1|1261135_1262563_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	99.8	2.8e-264
WP_012491455.1|1262528_1263521_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	100.0	1.6e-186
WP_012491456.1|1263645_1264284_+	DUF4355 domain-containing protein	NA	A0A0P0IQJ5	Lactobacillus_phage	100.0	7.2e-87
WP_003605853.1|1264296_1264611_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	100.0	2.7e-50
WP_012491457.1|1264624_1265665_+|capsid	major capsid protein	capsid	A0A0P0I7J2	Lactobacillus_phage	100.0	6.7e-191
WP_003605849.1|1265794_1266172_+	hypothetical protein	NA	A0A0P0IXC0	Lactobacillus_phage	100.0	7.4e-31
WP_012491458.1|1266175_1267054_+	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	100.0	5.9e-180
WP_012491459.1|1267053_1267428_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	100.0	1.0e-64
WP_012491460.1|1267432_1267735_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	100.0	4.7e-52
WP_012491461.1|1267731_1268097_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	100.0	1.6e-59
WP_003566400.1|1268097_1268502_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	100.0	4.6e-71
WP_012491462.1|1268513_1269113_+|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	100.0	6.1e-104
WP_003566397.1|1269251_1269587_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	100.0	9.4e-54
WP_003595195.1|1269685_1270039_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	100.0	8.7e-58
WP_012491464.1|1270031_1273367_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	100.0	0.0e+00
WP_012491465.1|1273369_1275334_+|tail	phage tail family protein	tail	A0A0P0I7K0	Lactobacillus_phage	100.0	0.0e+00
WP_012491466.1|1275330_1278450_+|tail	phage tail protein	tail	A0A0P0IXD5	Lactobacillus_phage	100.0	0.0e+00
WP_012491467.1|1278459_1278783_+	hypothetical protein	NA	A0A0P0IJM9	Lactobacillus_phage	100.0	3.5e-53
WP_003573798.1|1278775_1278907_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	100.0	6.5e-19
WP_003581984.1|1278962_1279238_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_003594199.1|1279252_1279666_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	100.0	3.1e-46
WP_012491470.1|1279676_1280861_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	100.0	5.1e-227
WP_012491471.1|1280905_1281130_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	100.0	7.2e-34
WP_012491472.1|1281771_1282551_-	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_003564892.1|1282652_1282940_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012491473.1|1283121_1283652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491474.1|1283732_1284584_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003564898.1|1284580_1285330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601683.1|1285526_1286525_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
1286475:1287591	attR	TGGAAGACGCCATCAGAAGTCTTCATGGGTAAAAAGTTGCACTTGAGTTGACAATTCGTCCCAGAAAAAAAGCCCGGCGACAAGCACCGAGCTAGCTTCACAGTCAGTTTTTTAGGATTTGACCACATCGACATTAGCATACAAGTTTGCAATGATTGCCAGCATGTCTTTTTCAGTCCGGTCCCAGCCGATCGTTTTAAGAAAGGCTTGACCATTTTGGACTTGGTTGCTGATCGCGTCAGGGTTGGCACAAGCATTTGCAAGCGTTTTGGCCAGATCTCGTTCATCAAGGTGACTGGCAAAATAGGTCCCGTCTTTCAAGAAGTAGCTTCCTGTGCCTTCCTTAAAATCAATGAGTGGCAGGCCAGTGCTCATCATTTCATAAGGGACAAGCGAAAAATTGGTCATAGATGGCGCGATCCCGAAATCAGCACTTTGGTAAAGTCGATTTAATTCCGGGGGAGTCAGCTTACCAAGGTTTTCACCATTGATGAATCGTTTGCTGCGGCCGGTACCGAAGTATTGAATTTTGAGATCGATTCCTTTGGCGCGCAGTAACTGGCGGCAATTTTCGAGGACAATCTGAATGTTGATGGGTGCGCGCCGCGGGCTGCTCCACTTGGTATAGACAGCAAGCTTGATTTGCTTCTTTTGTTGATAAGGTCCCATGTCGCGTTCCTTGAATGGATACCGTGCGACATCGACAGGAAAGTTAATCACATCAATAGGACTGTGAACCTTGCAATGCATGGTGATCATGTGGGCACACCATGGACCAAGCGATACCATGTGCAGACCTAGACTGTAAGTTCGTCGCGCCATCTGATAGCGATCGCCATATGGATAGAAATACGGTTCGTAATCTTGAACAAAATACATTTTGTACCCCGGTTTGTTCTTGATCACATAAACGGATTCCCATAACGTGGCGACCCAAATATCGGAACGATGGGACTCAAGTTCGCCCATTGGCAGACAGGTTCCTTTGTAACCGGGATAATTAAATTCAGCATTCTGAATCATTTCGTCTTGGCTTTGTGGGACATAGCTTAAATAGTAGACATCGTAACCGGCGTTGGCCAGCAGCGTACCTAGATGCAGCATCGTTGTTTGACCG	NA	NA	NA	NA
>prophage 8
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	1377479	1433175	3069926	lysis,transposase,tRNA	Leptospira_phage(28.57%)	54	NA	NA
WP_003599410.1|1377479_1378409_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491515.1|1378847_1379558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491519.1|1381449_1382031_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012491520.1|1382126_1383206_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_012491521.1|1383210_1384143_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_012491522.1|1384211_1384532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491523.1|1384713_1386468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491524.1|1387073_1387262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491525.1|1387263_1387443_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012491526.1|1387557_1388166_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157847124.1|1388090_1388480_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	37.1	5.1e-11
WP_016364311.1|1388370_1388835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014951865.1|1388831_1389038_+|transposase	transposase domain-containing protein	transposase	S5VTD3	Leptospira_phage	40.7	2.9e-05
WP_003565106.1|1389344_1389956_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_012491531.1|1390131_1390614_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003565110.1|1390790_1392494_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003574834.1|1392802_1393960_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_012491532.1|1393976_1395194_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003570094.1|1395499_1396153_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_014566514.1|1396525_1399168_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.4	2.7e-151
WP_012491533.1|1399460_1400738_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003565122.1|1400929_1401574_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003565124.1|1401635_1402304_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003565127.1|1402443_1403445_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012491534.1|1403533_1404394_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003574845.1|1404395_1404926_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012491535.1|1404939_1405596_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_003565134.1|1405596_1406394_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003565136.1|1407059_1407716_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003565139.1|1407728_1408367_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	2.6e-28
WP_003565141.1|1408363_1409176_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012491536.1|1409408_1410842_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003565145.1|1410926_1411046_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_003565147.1|1411396_1411729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565149.1|1411904_1412336_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_003565152.1|1412338_1413280_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_003565154.1|1413292_1413658_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_014566515.1|1413654_1415802_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003565157.1|1415816_1416782_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_012491540.1|1416812_1418192_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_003570121.1|1418191_1419283_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_003565163.1|1419288_1420143_+	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_003565166.1|1420252_1421599_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003574874.1|1421623_1422883_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_003565171.1|1422900_1423356_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_003565173.1|1423367_1423661_+	YggT family protein	NA	NA	NA	NA	NA
WP_012491541.1|1423667_1424447_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_012491542.1|1424504_1425287_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_012491543.1|1425533_1428320_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.0	5.4e-86
WP_003570139.1|1428332_1428554_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_003565182.1|1428690_1429596_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_003658327.1|1429771_1431208_+	MFS transporter	NA	NA	NA	NA	NA
WP_003565187.1|1431304_1432516_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	26.3	1.5e-32
WP_003578969.1|1432512_1433175_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
>prophage 9
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	2044808	2066648	3069926	transposase,protease	unidentified_phage(40.0%)	18	NA	NA
WP_012491745.1|2044808_2045570_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003599410.1|2045737_2046667_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491746.1|2046791_2047559_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012491747.1|2047871_2049467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566275.1|2050167_2050497_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012491748.1|2050873_2051518_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_012491750.1|2053067_2053712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491751.1|2053692_2053983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796558.1|2054412_2055199_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012491754.1|2055897_2056419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101869771.1|2056591_2057708_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.6	1.0e-27
WP_003595460.1|2058967_2059876_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003599410.1|2060159_2061089_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491757.1|2061202_2062099_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_014566584.1|2062102_2062960_-	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_012491759.1|2062959_2064045_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_012491760.1|2064073_2065693_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002816607.1|2065964_2066648_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
>prophage 10
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	2505793	2567659	3069926	bacteriocin,transposase,protease	unidentified_phage(28.57%)	65	NA	NA
WP_003567328.1|2505793_2506072_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2506095_2506380_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003588783.1|2506573_2506870_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014566636.1|2506971_2508327_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2508632_2508944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2509016_2509367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491940.1|2509540_2510920_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_012491943.1|2513588_2513726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016370360.1|2514094_2515213_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2515217_2516024_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016370359.1|2516385_2516583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566639.1|2517129_2517369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599800.1|2517641_2517815_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003591780.1|2517853_2518027_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_012491945.1|2518348_2518573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566641.1|2518887_2519052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491947.1|2519289_2520090_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012491948.1|2520378_2520537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599808.1|2520652_2520985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566643.1|2521240_2521909_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003588837.1|2521889_2522081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580886.1|2522399_2522735_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580888.1|2522853_2523450_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012491950.1|2523720_2524029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567374.1|2524164_2524380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567376.1|2524376_2524610_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014566644.1|2524881_2525835_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	4.8e-10
WP_003580891.1|2526039_2526774_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012491951.1|2526799_2527963_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_012491952.1|2528473_2529850_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_012491953.1|2529982_2530741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566645.1|2531032_2532640_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003596096.1|2533027_2535745_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.1	1.2e-61
WP_003580900.1|2536044_2536410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585579.1|2536563_2537937_-	MFS transporter	NA	NA	NA	NA	NA
WP_012491954.1|2537976_2539506_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2539751_2539943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567403.1|2540071_2540710_+	cation transporter	NA	NA	NA	NA	NA
WP_003567405.1|2540730_2541063_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567408.1|2541183_2542125_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012491956.1|2542121_2543018_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567413.1|2543014_2543758_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_012491957.1|2544033_2545500_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012491958.1|2545700_2545970_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003599410.1|2546137_2547067_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003567418.1|2547105_2547225_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003576335.1|2547425_2548343_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567422.1|2548582_2549224_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012491959.1|2549341_2549974_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003599857.1|2550130_2550655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491960.1|2550917_2552753_+	membrane protein	NA	NA	NA	NA	NA
WP_003585593.1|2552903_2553806_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2554049_2554199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491961.1|2554803_2557197_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_012491962.1|2557371_2558556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566650.1|2558790_2560632_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012491964.1|2560798_2561152_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003567441.1|2561145_2561556_-	CrcB family protein	NA	NA	NA	NA	NA
WP_014566651.1|2562145_2562433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491966.1|2562607_2562868_+	2-phosphoglycerate dehydratase	NA	W6LP63	Streptococcus_phage	61.8	5.0e-10
WP_003567447.1|2563249_2564197_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567449.1|2564256_2565030_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
WP_003567451.1|2565029_2565812_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003606005.1|2565808_2566612_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003599410.1|2566729_2567659_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
>prophage 11
NC_017474	Lacticaseibacillus paracasei, complete sequence	3069926	3023616	3034985	3069926	capsid,head,portal,tail,terminase	uncultured_Caudovirales_phage(37.5%)	17	NA	NA
WP_012492208.1|3023616_3024255_-	helix-turn-helix domain-containing protein	NA	L0P7E1	Lactobacillus_phage	27.6	2.4e-05
WP_003594046.1|3024422_3024698_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012492209.1|3024765_3024987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492211.1|3025097_3025289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492212.1|3025335_3025626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566704.1|3025622_3025811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566705.1|3025794_3026607_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.2	6.7e-13
WP_012492215.1|3026619_3028206_+	primase	NA	A0A1B1P7L5	Bacillus_phage	27.9	4.0e-25
WP_012492216.1|3028531_3028867_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012492217.1|3028871_3029057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014952495.1|3029053_3029476_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.4	1.2e-21
WP_010489224.1|3029592_3030063_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	26.5	4.6e-06
WP_012492218.1|3030059_3031763_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.1	2.3e-116
WP_014952496.1|3031728_3031908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010489222.1|3031912_3033094_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.5	2.8e-60
WP_012492220.1|3033080_3034637_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	32.0	4.6e-34
WP_003574397.1|3034691_3034985_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
