The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	85382	165902	4413616	integrase,plate,tail,holin,tRNA	Burkholderia_phage(55.17%)	70	140718:140737	178135:178154
WP_013696163.1|85382_87353_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_013696164.1|87349_88039_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_013696165.1|88095_88866_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	31.4	1.7e-21
WP_013696166.1|88904_89792_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	37.3	3.8e-17
WP_013696167.1|89799_90933_+	anion permease	NA	NA	NA	NA	NA
WP_013696168.1|91197_91728_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_013696169.1|91889_92741_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013696170.1|92817_93087_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_013696171.1|93213_93684_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_013696172.1|93686_94226_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_013696173.1|94270_95812_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013696174.1|95884_96763_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_013696175.1|96835_98230_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013696176.1|98389_98815_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_013696177.1|98993_100760_+	AMP-binding protein	NA	V9VFW4	Human_respiratory_syncytial_virus	27.1	1.4e-39
WP_013696179.1|101434_102295_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013696180.1|102445_103573_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_013696181.1|104128_106381_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_013696182.1|106872_110796_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013696183.1|110882_112022_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013696184.1|112301_113456_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013696185.1|113487_114297_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013696186.1|114354_114966_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013696187.1|115062_115494_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_148270227.1|115771_118279_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.5e-135
WP_017919799.1|118313_118502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013696189.1|118593_119073_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_013696190.1|119303_120713_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_013696191.1|120750_122148_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_013696192.1|122144_122939_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_013696193.1|123030_124551_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013696194.1|124888_126031_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013696195.1|126092_127178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013696196.1|127223_128945_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_013696197.1|129161_130550_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_013696198.1|130579_131725_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_013696199.1|131868_134799_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.3	5.8e-256
WP_013696200.1|134862_135246_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013696201.1|135289_136408_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_013696202.1|137306_137711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013696203.1|137913_138966_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013696204.1|139437_141522_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.4	4.4e-101
140718:140737	attL	CACGCTGGAGGCGCTCGGCT	NA	NA	NA	NA
WP_013696205.1|141637_142576_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_044273610.1|142995_144102_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	78.7	1.3e-160
WP_013696209.1|144903_147696_-	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	85.5	0.0e+00
WP_017920741.1|147698_147902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013696210.1|147898_148381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013696211.1|148465_148714_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	85.4	8.0e-34
WP_013696212.1|148823_149027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148270229.1|149154_149592_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	54.9	1.3e-31
WP_017920744.1|149781_150069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013696214.1|150264_151362_-	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	61.8	2.9e-120
WP_013696215.1|151361_151844_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	71.8	4.7e-46
WP_013696216.1|151858_154804_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	30.9	7.0e-92
WP_013696217.1|154800_154920_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	83.8	1.6e-11
WP_013696218.1|154928_155264_-|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	80.4	6.3e-34
WP_013696219.1|155333_155843_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	69.8	2.3e-67
WP_013696220.1|155870_157043_-|tail	phage tail sheath protein	tail	E5E3V0	Burkholderia_phage	80.5	1.4e-181
WP_013696221.1|157092_157959_-|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	71.6	1.1e-77
WP_013696222.1|157977_160527_-	hypothetical protein	NA	E5E3V2	Burkholderia_phage	55.3	1.8e-229
WP_013696223.1|160529_161087_-|tail	phage tail protein I	tail	E5E3V3	Burkholderia_phage	79.4	7.0e-78
WP_013696224.1|161064_161970_-|plate	baseplate J/gp47 family protein	plate	E5E3V4	Burkholderia_phage	79.7	3.6e-132
WP_013696225.1|161966_162329_-	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	75.0	2.3e-45
WP_013696226.1|162325_163024_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	75.0	1.5e-90
WP_013696227.1|163255_163672_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	46.7	2.6e-29
WP_013696229.1|163806_164256_-	hypothetical protein	NA	E5E3W1	Burkholderia_phage	64.1	3.6e-40
WP_013696230.1|164252_165065_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	75.6	1.4e-111
WP_013696231.1|165061_165334_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	76.7	1.3e-29
WP_013696232.1|165335_165680_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	80.5	6.1e-40
WP_013696233.1|165695_165902_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	70.6	2.1e-19
178135:178154	attR	CACGCTGGAGGCGCTCGGCT	NA	NA	NA	NA
>prophage 2
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	399740	453165	4413616	plate,integrase,transposase,protease	Acanthocystis_turfacea_Chlorella_virus(10.0%)	54	394986:395004	457524:457542
394986:395004	attL	CGGCCGGCGTCGCGCTCTG	NA	NA	NA	NA
WP_013696412.1|399740_400466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013696413.1|400746_405447_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_013696414.1|405546_407013_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_013696415.1|407115_408873_-	ABC transporter ATP-binding protein/permease	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	31.1	1.7e-05
WP_013696416.1|409604_410762_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013696417.1|410789_410987_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_013696418.1|411028_411844_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013696419.1|411840_412962_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_013696420.1|413285_414107_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	2.6e-20
WP_013696421.1|414103_414871_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_013696422.1|414886_415393_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_013696423.1|415448_416366_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_013696424.1|416475_417102_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013696425.1|417098_417368_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_013696426.1|417581_418508_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.4e-22
WP_013696427.1|418504_419260_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013696428.1|419279_419519_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013696429.1|419535_420891_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013696430.1|420887_421544_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013696431.1|421584_422913_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_013696432.1|423071_424142_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.6	6.8e-21
WP_013696433.1|424224_424812_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_013696434.1|424887_425508_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_013696435.1|425504_426146_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_013696436.1|426308_427064_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_013696437.1|427150_427924_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_013696438.1|427923_428349_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_013696439.1|428345_428711_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_042284878.1|428774_429167_+	membrane protein	NA	NA	NA	NA	NA
WP_013696441.1|429192_429558_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_013696442.1|429673_429913_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_013696443.1|429939_430494_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_013696444.1|430541_431321_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.9	8.4e-29
WP_013696445.1|431480_432689_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.2	2.0e-08
WP_013696446.1|432710_433457_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013696447.1|433677_434298_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_013696448.1|434297_435680_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_013696449.1|435702_436461_+	cytochrome c1	NA	NA	NA	NA	NA
WP_012734444.1|436556_437168_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013696450.1|437235_437736_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.8	3.5e-20
WP_013696452.1|438967_440011_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	37.1	4.0e-50
WP_013696453.1|440308_440521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013696456.1|441400_442651_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	4.5e-40
WP_162471352.1|443218_443719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013696457.1|443948_444392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013696458.1|444780_445965_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	2.0e-18
WP_013696459.1|446061_446847_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_013696460.1|446843_448190_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013696461.1|448290_448908_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_013696462.1|449281_449953_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013696463.1|449989_450508_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013696464.1|450523_452014_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013696465.1|452090_452594_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013696466.1|452682_453165_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
457524:457542	attR	CAGAGCGCGACGCCGGCCG	NA	NA	NA	NA
>prophage 3
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	753433	762400	4413616		Chrysochromulina_ericina_virus(16.67%)	7	NA	NA
WP_013696724.1|753433_755380_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	3.2e-146
WP_013696725.1|755595_756732_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.0e-22
WP_085963624.1|756754_758599_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.4	1.8e-53
WP_013696727.1|758696_759512_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.9	6.3e-35
WP_013696728.1|759558_760242_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	29.3	6.7e-06
WP_013696729.1|760238_760769_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_013696730.1|760798_762400_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	28.8	3.1e-17
>prophage 4
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	978944	988319	4413616	tRNA	Bacillus_virus(33.33%)	7	NA	NA
WP_013696917.1|978944_980063_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	2.0e-23
WP_013696918.1|980180_980969_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	30.5	2.3e-10
WP_013696919.1|981107_982070_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	43.9	2.5e-62
WP_013696920.1|982364_984677_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.8	3.4e-86
WP_013696921.1|984721_985405_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013696922.1|985622_986933_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.2e-80
WP_013696923.1|987017_988319_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.1e-93
>prophage 5
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	1082462	1090845	4413616		Bacillus_phage(16.67%)	8	NA	NA
WP_013697003.1|1082462_1083863_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.1	3.9e-77
WP_013697004.1|1083831_1084809_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	3.3e-14
WP_013697005.1|1084865_1085858_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.7	8.2e-29
WP_013697006.1|1085933_1086269_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020381247.1|1086504_1087407_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.4e-51
WP_013697008.1|1087505_1088732_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_013697009.1|1088912_1089836_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.6	2.2e-44
WP_013697010.1|1089942_1090845_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.1	5.4e-19
>prophage 6
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	1198228	1226360	4413616	tail,terminase,portal	Synechococcus_phage(11.76%)	30	NA	NA
WP_013697117.1|1198228_1200316_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	36.2	2.3e-97
WP_013697118.1|1200318_1200522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697119.1|1200523_1201996_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	37.5	1.4e-72
WP_013697120.1|1202060_1204139_+	peptidase U35	NA	A0A076G7Y9	Pseudoalteromonas_phage	33.7	2.0e-69
WP_013697121.1|1204224_1204560_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013697122.1|1204562_1204868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697123.1|1204864_1205290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270251.1|1205332_1206253_+	hypothetical protein	NA	A0A2I5ARB3	Synechococcus_phage	38.0	5.4e-51
WP_013697125.1|1206334_1206673_+	hypothetical protein	NA	G8CLB3	Synechococcus_phage	34.3	4.6e-08
WP_013697126.1|1206711_1207047_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_013697127.1|1207094_1209917_+|tail	phage tail length tape measure family protein	tail	L7P7M2	Pseudomonas_phage	29.0	3.2e-25
WP_013697128.1|1209916_1210414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697129.1|1210404_1210953_+	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	40.2	2.2e-31
WP_013697130.1|1210949_1211336_+	C40 family peptidase	NA	A0A0B4ZZC7	Achromobacter_phage	42.1	1.0e-19
WP_013697131.1|1211313_1214496_+	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	43.7	7.6e-161
WP_148270096.1|1214559_1216467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133167945.1|1216558_1217044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697133.1|1217040_1217598_+	glycoside hydrolase family 108 protein	NA	A0A0E3JI96	Rhodoferax_phage	63.6	3.1e-57
WP_013697134.1|1217594_1218227_+	hypothetical protein	NA	Q775E2	Bordetella_phage	48.7	6.8e-37
WP_013697135.1|1218460_1219246_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.8	2.9e-130
WP_013697136.1|1219423_1219627_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_160167511.1|1220010_1220394_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	37.1	9.2e-13
WP_013697139.1|1220504_1220867_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	47.5	3.3e-20
WP_013697140.1|1221068_1221395_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044274140.1|1221837_1223589_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	26.9	3.2e-44
WP_013697142.1|1223741_1224173_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_013697143.1|1224179_1224677_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.5	1.9e-18
WP_013697144.1|1224666_1225140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044273720.1|1225027_1225633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697146.1|1225643_1226360_+	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	36.6	2.0e-21
>prophage 7
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	1651968	1716035	4413616	integrase,transposase	Bacillus_phage(50.0%)	56	1646630:1646645	1701887:1701902
1646630:1646645	attL	CGGGCCCAGGACGGCC	NA	NA	NA	NA
WP_044273763.1|1651968_1653354_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_085963582.1|1653416_1654552_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.8	8.3e-17
WP_013696456.1|1655795_1657046_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	4.5e-40
WP_013697495.1|1659250_1660909_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_013697496.1|1661532_1662444_+	transporter	NA	NA	NA	NA	NA
WP_080562371.1|1662606_1662744_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_148270106.1|1662837_1663044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697497.1|1663136_1664387_+	MFS transporter	NA	NA	NA	NA	NA
WP_013697498.1|1664494_1665412_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697499.1|1665569_1666448_+	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_013697500.1|1666465_1667272_+	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_013697501.1|1667331_1668915_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_013697502.1|1668986_1670165_+	CoA transferase	NA	NA	NA	NA	NA
WP_080562320.1|1670206_1670839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085963582.1|1670866_1672002_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.8	8.3e-17
WP_080562322.1|1671975_1672947_+	MFS transporter	NA	NA	NA	NA	NA
WP_013697503.1|1672939_1673710_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_193373205.1|1673784_1673907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193373208.1|1673922_1674294_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697505.1|1674910_1676386_-	MFS transporter	NA	NA	NA	NA	NA
WP_013697506.1|1676918_1678523_+	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_013697507.1|1678572_1679385_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.0	4.5e-09
WP_013697508.1|1679401_1680439_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_044274218.1|1680457_1680973_+	VOC family protein	NA	NA	NA	NA	NA
WP_013697510.1|1681009_1681615_+	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_013697511.1|1681649_1682534_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013697512.1|1682545_1684165_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_013697513.1|1684154_1684475_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_044274220.1|1684533_1685985_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013697515.1|1686000_1687461_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013697516.1|1687495_1688221_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697517.1|1688406_1689846_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013697518.1|1690090_1691020_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_013697519.1|1691040_1691562_-	4-hydroxyphenylacetate 3-monooxygenase, reductase component	NA	NA	NA	NA	NA
WP_013697520.1|1691848_1692496_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013697521.1|1692526_1693837_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_044273767.1|1694154_1695243_+	porin	NA	NA	NA	NA	NA
WP_013697523.1|1695263_1696007_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013697524.1|1696071_1696446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013697525.1|1696530_1697727_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_013697526.1|1697981_1699463_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_013697527.1|1699505_1700720_-	porin	NA	NA	NA	NA	NA
WP_013697528.1|1700839_1702288_-	APC family permease	NA	NA	NA	NA	NA
1701887:1701902	attR	CGGGCCCAGGACGGCC	NA	NA	NA	NA
WP_013697529.1|1702693_1703827_-	amidase	NA	NA	NA	NA	NA
WP_013697530.1|1703823_1704381_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_013697531.1|1704426_1704813_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_013697532.1|1704885_1705386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013697533.1|1705382_1706660_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_044273769.1|1706810_1707839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697534.1|1707783_1708755_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013697535.1|1709061_1710201_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_013697536.1|1710271_1710694_+	RidA family protein	NA	NA	NA	NA	NA
WP_013697537.1|1710759_1712055_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_080562324.1|1712197_1713148_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697539.1|1713201_1713924_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	30.9	2.6e-24
WP_085963582.1|1714899_1716035_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.8	8.3e-17
>prophage 8
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	2074960	2117322	4413616	tail,tRNA,integrase,transposase	uncultured_Caudovirales_phage(27.27%)	47	2106015:2106032	2128524:2128541
WP_013688836.1|2074960_2075980_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080562333.1|2076269_2076689_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013697814.1|2076790_2077417_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_013697815.1|2077448_2079134_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_013697816.1|2079720_2080455_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_013697817.1|2080510_2081398_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697818.1|2081475_2082171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697819.1|2082249_2082963_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013697820.1|2083034_2083286_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_013697821.1|2083449_2084511_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_013697822.1|2084647_2085286_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_013697823.1|2085807_2088282_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.8	3.8e-67
WP_013697824.1|2088435_2089185_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_148270266.1|2089212_2090190_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_013697826.1|2090318_2091014_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_013697827.1|2091354_2092074_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697828.1|2092194_2093214_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013697829.1|2093263_2093923_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013697830.1|2094030_2094825_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043216401.1|2094930_2095959_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_013697832.1|2096036_2096903_-	arginyltransferase	NA	NA	NA	NA	NA
WP_013697833.1|2097334_2098078_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_013697834.1|2098088_2098634_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013697835.1|2099121_2099619_+	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_013697836.1|2099625_2099964_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_013697837.1|2100120_2100549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013697838.1|2100927_2102085_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_013697839.1|2102096_2102930_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_013697840.1|2102926_2103895_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	7.2e-30
WP_013697841.1|2103937_2104153_+	molybdopterin-binding protein	NA	NA	NA	NA	NA
WP_013697842.1|2104309_2104507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697843.1|2104542_2104800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697844.1|2105042_2106080_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2106015:2106032	attL	ATCCATCATCGGTGCAAC	NA	NA	NA	NA
WP_013697845.1|2106197_2107274_+|integrase	site-specific integrase	integrase	I6NSG1	Burkholderia_phage	53.0	7.4e-108
WP_013697846.1|2107258_2107519_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	68.7	1.3e-26
WP_044273814.1|2107515_2107956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044274284.1|2107948_2108245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013697848.1|2108554_2109328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697850.1|2111371_2111875_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_013697851.1|2111956_2112259_+|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	1.3e-06
WP_013697853.1|2112669_2113425_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.8	7.6e-35
WP_013697854.1|2113399_2113606_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	53.7	1.4e-12
WP_013697855.1|2113615_2114665_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.8	1.6e-83
WP_017918170.1|2114737_2115187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697856.1|2115183_2115750_+	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	53.7	2.4e-49
WP_013697857.1|2115752_2116376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697858.1|2116536_2117322_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.1	1.9e-129
2128524:2128541	attR	ATCCATCATCGGTGCAAC	NA	NA	NA	NA
>prophage 9
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	3110467	3180913	4413616	terminase,integrase,transposase,plate,tail,tRNA,portal,head,capsid,protease	uncultured_Caudovirales_phage(25.0%)	72	3101202:3101222	3145760:3145780
3101202:3101222	attL	CACACGCCCATGATGCAGCAG	NA	NA	NA	NA
WP_085963601.1|3110467_3111285_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.8	2.3e-08
WP_052307285.1|3111427_3111715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698662.1|3111755_3112541_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	83.2	3.8e-130
WP_025101137.1|3112701_3113325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698664.1|3113327_3113894_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	54.3	8.2e-50
WP_017918170.1|3113890_3114340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698665.1|3114413_3115463_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.8	1.2e-83
WP_013698666.1|3115472_3115679_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	8.4e-13
WP_013698667.1|3115653_3116532_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.2	2.2e-33
WP_013698668.1|3116541_3118980_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.6	4.0e-53
WP_013698669.1|3119061_3119364_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	37.7	8.6e-06
WP_013697850.1|3119445_3119949_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_013698670.1|3119959_3121129_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.6	2.8e-161
WP_013698671.1|3121200_3121917_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	58.6	3.2e-59
WP_013698672.1|3121930_3123895_-|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	58.2	1.2e-127
WP_013698673.1|3123882_3124461_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	46.7	3.8e-34
WP_013698674.1|3124450_3125347_-|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	39.4	2.3e-46
WP_013698675.1|3125343_3125676_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	9.4e-22
WP_013698676.1|3125678_3125876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698677.1|3125926_3126607_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	32.5	7.6e-26
WP_013698678.1|3126603_3127134_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	42.0	1.5e-24
WP_013698679.1|3127123_3127654_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	34.9	3.7e-20
WP_013698680.1|3127657_3127948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698681.1|3127949_3128945_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	63.3	1.1e-118
WP_013698682.1|3129021_3129366_-|head	head decoration protein	head	NA	NA	NA	NA
WP_013698683.1|3129395_3130496_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.6	6.1e-49
WP_013698684.1|3130492_3131983_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	1.2e-135
WP_013698685.1|3131979_3132186_-	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	3.8e-05
WP_193373197.1|3132196_3134200_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.4	9.3e-181
WP_013698687.1|3134162_3134732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698688.1|3134844_3135039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698689.1|3135286_3136060_-	zinc finger-like domain-containing protein	NA	NA	NA	NA	NA
WP_013698690.1|3136276_3138778_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.9	3.8e-99
WP_013698691.1|3138936_3139320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749044.1|3139306_3139849_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.2	7.6e-29
WP_013698693.1|3140274_3140778_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	36.0	2.6e-07
WP_080562350.1|3140731_3141247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698694.1|3141351_3141594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270168.1|3141628_3142006_+	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_013698696.1|3142005_3143538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698698.1|3144040_3144277_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_044273910.1|3144233_3145535_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.5	4.4e-139
WP_013698699.1|3145654_3148402_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.9	1.3e-23
3145760:3145780	attR	CACACGCCCATGATGCAGCAG	NA	NA	NA	NA
WP_013698700.1|3148385_3149678_+	membrane protein	NA	NA	NA	NA	NA
WP_013698701.1|3149762_3150311_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_013698702.1|3150343_3151570_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013698703.1|3152190_3152967_-	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	29.4	6.4e-13
WP_013698704.1|3152971_3154117_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_013698705.1|3154226_3155129_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_044273913.1|3155173_3155755_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013698707.1|3155804_3157007_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013698708.1|3157016_3157676_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013698709.1|3157758_3158394_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_013698710.1|3158473_3159304_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_044274432.1|3159391_3160288_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_193373198.1|3160432_3161362_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_013698713.1|3161510_3162035_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_013698714.1|3162073_3163024_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_013698715.1|3163075_3163435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698716.1|3163551_3163971_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_013698717.1|3164053_3165337_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.6	1.7e-151
WP_013698718.1|3165434_3166289_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	8.9e-48
WP_013698719.1|3166285_3167947_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	4.4e-152
WP_044273914.1|3168207_3169017_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013698721.1|3169290_3171783_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_013698722.1|3171935_3172721_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_013698723.1|3172725_3173478_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-35
WP_013698724.1|3173470_3174724_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013698725.1|3175044_3176151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698726.1|3176160_3177855_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	26.3	9.1e-28
WP_111946549.1|3178176_3179205_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	35.5	3.5e-06
WP_013698728.1|3179383_3180913_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.4	2.0e-82
>prophage 10
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	3469191	3492842	4413616	tail,integrase,transposase	uncultured_Caudovirales_phage(23.08%)	23	3462520:3462535	3493469:3493484
3462520:3462535	attL	CGCCGCGATCTGCTCG	NA	NA	NA	NA
WP_160167524.1|3469191_3470679_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	28.5	9.2e-16
WP_013698984.1|3471170_3471956_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.4	6.5e-130
WP_013698986.1|3472371_3472938_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	54.3	8.2e-50
WP_044273930.1|3472934_3473384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698987.1|3473456_3474506_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.6	1.4e-82
WP_013698988.1|3474515_3474722_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	53.7	3.2e-12
WP_013698989.1|3474696_3475452_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.0	8.4e-34
WP_013698991.1|3477527_3477830_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	37.7	6.6e-06
WP_013698992.1|3477911_3478415_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_013698995.1|3480603_3480987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013698996.1|3480973_3481516_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.2	5.8e-29
WP_013698997.1|3481914_3482466_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	39.1	3.0e-12
WP_148270180.1|3482410_3482869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698998.1|3482996_3483215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044274453.1|3483264_3483627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013699000.1|3483626_3485003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044274454.1|3485104_3485467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127841020.1|3485450_3485909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013699002.1|3485921_3486575_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_085963582.1|3486756_3487892_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.8	8.3e-17
WP_013699004.1|3488178_3490368_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_013699005.1|3490360_3491590_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.2	4.4e-16
WP_013699006.1|3491684_3492842_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.6e-44
3493469:3493484	attR	CGAGCAGATCGCGGCG	NA	NA	NA	NA
>prophage 11
NC_015381	Burkholderia gladioli BSR3 chromosome 1, complete sequence	4413616	3649146	3660058	4413616	tRNA,protease	Klosneuvirus(14.29%)	9	NA	NA
WP_013699139.1|3649146_3651984_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	5.0e-79
WP_013699140.1|3651986_3652487_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_013699141.1|3652594_3653806_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	1.1e-38
WP_013699142.1|3653886_3654333_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.6	8.7e-47
WP_013699143.1|3654446_3656744_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	8.5e-170
WP_013699144.1|3656740_3657055_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	3.4e-13
WP_004196460.1|3657586_3657790_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_013699146.1|3657927_3659520_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_013699147.1|3659692_3660058_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.8	3.6e-06
>prophage 1
NC_015376	Burkholderia gladioli BSR3 chromosome 2, complete sequence	3700833	2006194	2014698	3700833		Bacillus_phage(33.33%)	9	NA	NA
WP_013690377.1|2006194_2007523_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.5	2.0e-14
WP_013690378.1|2007519_2008266_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	2.2e-26
WP_160167541.1|2008265_2008430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013690379.1|2008426_2008798_-	GFA family protein	NA	NA	NA	NA	NA
WP_013690380.1|2009078_2009630_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013690381.1|2010008_2011430_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.9	3.9e-80
WP_013690382.1|2011434_2012634_+	alginate O-acetyltransferase	NA	A0A125RNN9	Pseudomonas_phage	27.5	1.2e-18
WP_013690383.1|2012755_2014390_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	1.3e-169
WP_013690384.1|2014407_2014698_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	42.6	6.1e-17
>prophage 1
NC_015383	Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence	403586	86694	107340	403586	integrase,transposase	Stx2-converting_phage(50.0%)	20	83213:83229	109227:109243
83213:83229	attL	GCGACGCTCGCGATCGT	NA	NA	NA	NA
WP_013700063.1|86694_87624_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148270754.1|88857_89103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270756.1|89169_89379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700064.1|89391_89691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700065.1|89740_89986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700066.1|90423_90741_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	37.0	1.0e-04
WP_013700069.1|92199_93879_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013700070.1|94214_95357_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_013700071.1|95420_96335_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	31.0	1.7e-17
WP_013700072.1|97104_98217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044275941.1|99151_99394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270758.1|99488_99827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270760.1|99839_100232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700073.1|100206_102042_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013700074.1|102317_102797_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013700075.1|103012_103336_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_013700076.1|103385_103808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013700077.1|103804_104149_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.0	2.9e-42
WP_013700078.1|104179_105775_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	2.2e-132
WP_013700079.1|106206_107340_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
109227:109243	attR	ACGATCGCGAGCGTCGC	NA	NA	NA	NA
>prophage 2
NC_015383	Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence	403586	113114	172749	403586	transposase	Tupanvirus(16.67%)	53	NA	NA
WP_044275990.1|113114_114107_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	6.5e-159
WP_013700085.1|114667_116068_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013700086.1|116125_116623_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_013700087.1|116837_117824_+	response regulator	NA	NA	NA	NA	NA
WP_080562466.1|117820_118012_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.4	2.9e-07
WP_013700088.1|118008_118146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148270762.1|118142_118352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052307366.1|118351_118537_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013700089.1|118687_119059_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013700090.1|119091_119436_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013700091.1|119499_121032_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	45.5	8.8e-123
WP_080562467.1|121041_121419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270764.1|121400_121652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700092.1|122007_123021_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013700093.1|123025_123442_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_013700094.1|123464_125207_-	fatty acyl-AMP ligase	NA	A0A2K9KZV5	Tupanvirus	21.9	1.1e-09
WP_013700095.1|125203_126178_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_013700096.1|126190_127183_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_044275945.1|127199_128114_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	29.0	3.0e-25
WP_013700098.1|128195_128471_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013700099.1|128500_129469_-	fatty acid desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	29.6	7.0e-17
WP_013700100.1|130296_130998_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.5	2.2e-36
WP_013700101.1|131755_132352_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.2	2.7e-27
WP_013700102.1|132682_132940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700103.1|133370_134630_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_013700104.1|135197_137051_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013700105.1|137219_137639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700106.1|137767_138994_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_013700107.1|139053_141327_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_148270807.1|141362_142661_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_013700109.1|142747_143980_+	acyltransferase	NA	NA	NA	NA	NA
WP_044275998.1|143984_145064_-	glycosyltransferase family 4 protein	NA	E5ERC7	Bathycoccus_sp._RCC1105_virus	28.4	6.2e-06
WP_013700111.1|145091_146240_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013700112.1|146555_147596_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013700113.1|147890_149180_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_013700114.1|149283_150858_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	26.2	2.6e-37
WP_044275999.1|150854_151433_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_160167570.1|152343_152637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700116.1|152611_154003_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013700118.1|156535_157591_-	DUF1839 family protein	NA	NA	NA	NA	NA
WP_013700119.1|157587_158559_-	amino acid--[acyl-carrier-protein] ligase	NA	NA	NA	NA	NA
WP_013700120.1|158555_159752_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_044275947.1|159748_160000_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013700122.1|160151_160934_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_044276001.1|162648_164055_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_013700124.1|164815_165163_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	63.8	1.9e-33
WP_013700126.1|166107_166830_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	30.3	3.3e-19
WP_148270809.1|167008_167467_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_013700128.1|167516_167942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700129.1|168059_168665_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044275949.1|170310_170598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700130.1|171060_171318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013691784.1|171729_172749_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_015383	Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence	403586	184412	272400	403586	plate,transposase	Bacillus_phage(14.29%)	47	NA	NA
WP_013700139.1|184412_185546_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013700140.1|187469_188426_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013700141.1|188670_190812_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013700142.1|190990_191389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700143.1|191477_193379_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	1.7e-27
WP_013700144.1|193375_195148_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	4.1e-23
WP_013700145.1|195241_196975_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080562470.1|196971_198231_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013700147.1|198118_205636_-	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	35.2	3.6e-44
WP_044275954.1|205715_218690_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9L3I8	Tupanvirus	26.9	2.1e-31
WP_193373228.1|219669_225546_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.3	3.5e-34
WP_013700150.1|225955_226219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700151.1|226227_226557_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_044275955.1|226563_226917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044275956.1|227059_227305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044275957.1|227325_227811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700152.1|227881_228187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700153.1|228379_228622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700154.1|229035_229833_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.2	4.4e-33
WP_013700155.1|231210_231741_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013700156.1|231716_232070_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.6	1.7e-16
WP_013700157.1|232100_233711_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	31.8	1.0e-36
WP_013700158.1|233713_234151_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013700159.1|234396_235254_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_160167571.1|235534_235693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160167572.1|237175_237583_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_044275958.1|237807_238371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700162.1|238651_239671_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013700163.1|239795_244460_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	50.9	2.2e-55
WP_013700164.1|244507_247243_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.7	3.7e-39
WP_044276014.1|247262_247514_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	45.9	7.6e-08
WP_013700166.1|247555_248821_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_013700167.1|248837_252908_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_013700168.1|252933_254196_-	type VI secretion system protein TssL	NA	G3M9Z0	Bacillus_virus	39.0	3.6e-05
WP_013700169.1|254247_255594_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044275960.1|255625_256126_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_013700171.1|256211_256697_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013700172.1|256785_258279_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013700173.1|258306_258849_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013700174.1|258888_261570_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	34.6	2.2e-92
WP_044275961.1|262117_262780_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_013700176.1|262776_263628_+	virulence protein SciE type	NA	NA	NA	NA	NA
WP_013700177.1|263620_264181_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_013700178.1|264219_266109_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013700179.1|266108_267176_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013700180.1|267178_268297_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013700181.1|269463_272400_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	23.2	1.0e-55
>prophage 4
NC_015383	Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence	403586	304656	353248	403586	transposase	Leptospira_phage(42.86%)	52	NA	NA
WP_013700206.1|304656_305394_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_148270774.1|305557_306445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700208.1|307176_308307_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085963704.1|309465_310272_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148270776.1|310268_310499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700209.1|310495_311362_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013700210.1|311481_311811_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_013700211.1|311996_312419_-	hypothetical protein	NA	A0A1P8DJD6	Virus_Rctr71	40.9	1.0e-20
WP_013700212.1|312704_312980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700213.1|312988_313231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162471373.1|313247_313427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052307375.1|314302_314518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148270778.1|314516_314876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270780.1|314860_315097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044275966.1|315107_315482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296511.1|315964_316132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700217.1|316216_316699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052307376.1|317211_317400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044275968.1|318195_318759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700222.1|318765_323004_-	AHH domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.7	3.9e-27
WP_013700223.1|323025_323496_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_013700224.1|323548_323983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700225.1|323982_324852_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013700226.1|324851_327842_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_160167574.1|328351_329296_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_124094759.1|329336_329660_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013700229.1|330806_331604_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013700230.1|331710_333228_+	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.5e-29
WP_013700231.1|333279_334050_+	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_013700232.1|334053_335181_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_013700233.1|335234_336107_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044275970.1|336219_336687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270784.1|337062_337917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044275971.1|338264_338672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160167575.1|338784_339171_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013700235.1|339374_339893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006405224.1|339916_340270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700236.1|340296_341010_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_044275972.1|342100_342352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013700238.1|342371_342671_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044276027.1|342660_342906_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_013700159.1|344088_344946_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_148270788.1|345257_345446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013700242.1|345481_347035_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.7	2.4e-123
WP_013700243.1|347098_347434_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_044276029.1|347430_347823_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013700245.1|348052_348490_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013700246.1|348492_350103_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	32.0	6.6e-36
WP_013700247.1|350133_350487_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.6	4.8e-16
WP_013700248.1|350462_350993_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013700249.1|351431_351926_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_085963582.1|352112_353248_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	25.4	1.4e-11
