The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	308969	317345	5486830		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|308969_310277_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|310365_311085_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|311077_311332_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666785.1|311328_312012_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055559.1|311995_314215_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879026.1|314199_315615_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262441.1|315720_316761_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088590.1|316757_317345_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 2
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	659341	667500	5486830		Bacillus_phage(66.67%)	8	NA	NA
WP_000030268.1|659341_660295_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.9	4.1e-17
WP_003273797.1|660482_660923_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822580.1|661088_662480_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.1e-34
WP_000565468.1|662491_663169_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	1.1e-32
WP_000738870.1|663344_664592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277054.1|664724_665255_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.5	2.5e-16
WP_000831286.1|665267_665612_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000487919.1|666048_667500_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.4	5.8e-140
>prophage 3
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	693048	719423	5486830	terminase,integrase,capsid	Bacillus_phage(68.0%)	38	688612:688627	712468:712483
688612:688627	attL	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000262043.1|693048_694149_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	96.7	1.4e-199
WP_000511081.1|696522_696867_-	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_000813894.1|697015_697252_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
WP_000277640.1|697284_697473_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	98.4	9.4e-27
WP_000187072.1|697493_698141_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	86.0	1.9e-98
WP_000788396.1|698200_698356_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	88.2	4.1e-20
WP_000167564.1|698418_698712_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	63.0	1.5e-26
WP_000102854.1|698733_698994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061882.1|699065_699494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000892407.1|699601_699796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148168.1|699874_700810_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	59.5	5.8e-101
WP_000224586.1|700831_701638_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	66.8	3.1e-95
WP_000040570.1|701809_702613_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	42.8	2.7e-38
WP_003269479.1|702710_703454_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	49.8	1.5e-59
WP_001045406.1|703477_703987_+	YpiB family protein	NA	NA	NA	NA	NA
WP_000049838.1|703999_704425_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	4.1e-30
WP_000323349.1|704440_705109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778925.1|705829_706252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973815.1|706235_706970_+	sigma-70 family RNA polymerase sigma factor	NA	C7DTL2	Bacillus_phage	51.2	2.1e-58
WP_000433162.1|707202_707367_+	hypothetical protein	NA	W8CYP0	Bacillus_phage	66.7	1.1e-12
WP_000520931.1|707545_707728_+	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	58.5	2.9e-09
WP_000164425.1|707762_708560_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.7	3.3e-73
WP_001072816.1|709229_709604_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	40.7	6.0e-17
WP_000876114.1|709965_710181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248554.1|710465_710621_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_003269487.1|710706_710889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576172.1|711041_711614_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	2.2e-42
WP_000515245.1|711656_712193_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	56.3	9.5e-40
WP_003311458.1|712158_713622_+|terminase	phage terminase large subunit	terminase	U5PVG8	Bacillus_phage	68.9	7.5e-196
712468:712483	attR	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000222862.1|713618_713849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124815.1|713862_714063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467413.1|714120_716244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366284.1|716244_716520_+	DUF2829 domain-containing protein	NA	A0A0A7AQX0	Bacillus_phage	59.0	1.4e-23
WP_003269488.1|716519_716771_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.2	3.3e-19
WP_000668389.1|716770_717031_+	DUF2829 domain-containing protein	NA	S5MAK7	Bacillus_phage	70.6	4.3e-30
WP_000791085.1|717030_717285_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	85.4	1.4e-38
WP_000917220.1|717368_718217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000501401.1|718232_719423_+|capsid	phage major capsid protein	capsid	A0A1B1IV93	uncultured_Mediterranean_phage	28.2	1.0e-33
>prophage 4
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	723830	734088	5486830	bacteriocin	Bacillus_phage(100.0%)	10	NA	NA
WP_001137510.1|723830_728099_+	hypothetical protein	NA	A0A0A0RPU4	Bacillus_phage	36.3	3.2e-138
WP_000392441.1|728150_728381_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
WP_003269494.1|728380_729085_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	84.0	3.8e-113
WP_000494384.1|729211_729610_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000264500.1|730407_730632_-	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_127057661.1|730955_731087_+	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000495115.1|731106_731427_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	98.1	2.1e-50
WP_000511372.1|731437_732604_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	98.5	1.4e-221
WP_000842170.1|732593_733202_+	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	98.5	2.4e-111
WP_000730126.1|733206_734088_-	helix-turn-helix domain-containing protein	NA	I7ILW0	Bacillus_phage	97.3	2.3e-155
>prophage 5
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	1837229	1894653	5486830	transposase,portal,terminase,tail,integrase,holin	Bacillus_phage(69.44%)	76	1832755:1832773	1899540:1899558
1832755:1832773	attL	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
WP_000499525.1|1837229_1838426_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_001190219.1|1838722_1838884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015055111.1|1838867_1840424_+	AAA family ATPase	NA	A7KV18	Bacillus_phage	31.8	2.4e-22
WP_000567354.1|1840437_1840740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000421152.1|1840739_1840973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273133.1|1840986_1841622_+	hypothetical protein	NA	A7KV15	Bacillus_phage	34.8	3.2e-26
WP_000334956.1|1841638_1842004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000546453.1|1842003_1843062_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000636793.1|1843058_1843361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137796.1|1843353_1843905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371314.1|1843914_1844433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271401.1|1844516_1846094_+	DEAD/DEAH box helicase family protein	NA	A0A1B0Z0P8	Vibrio_phage	24.2	1.7e-15
WP_000523223.1|1846183_1846426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000191310.1|1846425_1847169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001074794.1|1847188_1850275_+	hypothetical protein	NA	A0A1L4BKL0	Thermus_phage	28.6	8.0e-14
WP_000147936.1|1850298_1852725_+	bifunctional 3'-5' exonuclease/DNA polymerase	NA	F8WQ35	Bacillus_phage	23.9	5.1e-32
WP_000532406.1|1852728_1853001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993003.1|1852963_1853221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509446.1|1853246_1853612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015055112.1|1853608_1853755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001249533.1|1853754_1854078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021290.1|1854074_1854614_+	dUTP diphosphatase	NA	A0A288WGA4	Bacillus_phage	34.2	5.8e-21
WP_000521061.1|1854628_1855405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693593.1|1855574_1855946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391475.1|1855993_1856302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422433.1|1856339_1857320_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.2	5.5e-118
WP_000404006.1|1857561_1858059_+	hypothetical protein	NA	A0A288WFR1	Bacillus_phage	67.4	1.7e-27
WP_000539655.1|1858110_1858278_+	hypothetical protein	NA	A0A0M4RER6	Bacillus_phage	87.3	2.0e-20
WP_000053745.1|1859405_1859816_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	54.2	2.2e-12
WP_001043868.1|1859812_1860466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805617.1|1860587_1860905_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	34.7	1.0e-04
WP_000154978.1|1860921_1861839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790088.1|1861841_1861988_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_001202995.1|1862113_1862335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843025.1|1862331_1862613_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_001294615.1|1862614_1862812_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	44.8	9.5e-06
WP_080546110.1|1862838_1863006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410292.1|1863008_1863533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106358.1|1863529_1863712_+	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	68.0	3.3e-13
WP_000200015.1|1863701_1864028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196741.1|1864288_1864669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873650.1|1865075_1865639_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.3	9.0e-41
WP_001086032.1|1865836_1866265_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_000323341.1|1866281_1867997_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.1	8.0e-149
WP_001265883.1|1868013_1869531_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.5	1.1e-67
WP_003271428.1|1869589_1870369_+	phage scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.0	9.7e-09
WP_001145075.1|1870429_1871554_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_000027969.1|1871603_1871828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868477.1|1871857_1872199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285263.1|1872203_1873010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954643.1|1873013_1873388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222696.1|1873387_1873747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000930921.1|1873749_1874157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852562.1|1874170_1874677_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000443956.1|1874700_1875060_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	82.9	5.4e-39
WP_000762691.1|1875046_1875262_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	2.3e-29
WP_000818630.1|1875329_1875707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931847.1|1875796_1876051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271441.1|1876087_1879984_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	4.2e-12
WP_000959919.1|1879998_1881495_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	80.4	4.0e-221
WP_001260209.1|1881491_1886471_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	65.6	0.0e+00
WP_000342975.1|1886482_1886863_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	79.2	2.3e-48
WP_000822841.1|1886962_1887922_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.3	2.1e-175
WP_000373895.1|1887937_1888363_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.0	7.0e-70
WP_001216050.1|1888362_1889196_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	88.1	1.9e-148
WP_000370580.1|1889250_1889517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000727572.1|1889626_1889770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230989.1|1889796_1890399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578036.1|1890497_1890734_-	helix-turn-helix transcriptional regulator	NA	Q2I8D9	Bacillus_phage	57.9	9.0e-19
WP_000854597.1|1890890_1891013_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	62.2	4.8e-08
WP_000669093.1|1891654_1891855_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	1.1e-12
WP_001247349.1|1892040_1892307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001267622.1|1892306_1892609_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	58.2	8.0e-28
WP_000176361.1|1892605_1892788_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	81.7	1.1e-19
WP_000891521.1|1892903_1894088_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	62.9	2.1e-140
WP_001025807.1|1894029_1894653_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	80.1	2.3e-93
1899540:1899558	attR	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
>prophage 6
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	1933171	1942470	5486830		Bacillus_phage(71.43%)	8	NA	NA
WP_000755523.1|1933171_1934464_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	5.0e-10
WP_000453879.1|1935568_1937329_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	1.8e-273
WP_015055113.1|1937369_1938047_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.5e-122
WP_001231619.1|1938043_1939117_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	8.8e-186
WP_003270270.1|1939141_1939735_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1939925_1940645_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000014165.1|1940792_1941464_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	1.8e-64
WP_001258527.1|1941597_1942470_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	4.0e-64
>prophage 7
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	2574448	2667850	5486830	transposase,protease,capsid,portal,terminase,tRNA,tail,integrase,bacteriocin	Bacillus_phage(64.29%)	102	2614148:2614183	2673205:2673240
WP_000558614.1|2574448_2576002_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001128402.1|2576061_2576490_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000285662.1|2576640_2577555_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238996.1|2577681_2578389_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015055137.1|2578385_2579369_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000376270.1|2579687_2580314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482037.1|2581023_2582652_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	33.3	3.5e-53
WP_000503549.1|2582672_2583260_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003270612.1|2583814_2584309_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000404443.1|2584624_2585395_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.6e-32
WP_000144179.1|2585369_2587301_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000831683.1|2587368_2588037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165517.1|2588113_2588455_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000517061.1|2588734_2589976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701755.1|2590063_2591089_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000471611.1|2591178_2592627_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003270605.1|2592631_2593546_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000144507.1|2593852_2594542_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2594991_2595255_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_001071355.1|2595803_2596133_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003270601.1|2596616_2597102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736205.1|2597413_2598115_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675858.1|2598153_2599263_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.4	1.1e-146
WP_000732892.1|2599494_2599968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734558.1|2600201_2600663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197708.1|2601323_2602532_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.2	2.3e-81
WP_000791664.1|2602558_2602714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425257.1|2602974_2603325_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	9.6e-17
WP_001180927.1|2603508_2603805_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	8.2e-09
WP_000522023.1|2604020_2604287_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	2.0e-35
WP_000390298.1|2604286_2604451_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	90.7	1.5e-20
WP_001241129.1|2604480_2604657_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	93.1	6.3e-25
WP_000190250.1|2604661_2605396_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	83.9	1.1e-89
WP_014482038.1|2605364_2606168_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	7.3e-145
WP_000332458.1|2606182_2606377_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	87.5	2.2e-26
WP_000792379.1|2606393_2606804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312979.1|2606836_2607091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482039.1|2607178_2607322_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.3	9.6e-08
WP_001053955.1|2607433_2608870_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_001125966.1|2609116_2609476_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	1.6e-30
WP_000717823.1|2609493_2609661_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.1e-13
WP_000109538.1|2609686_2609938_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	36.1	6.5e-07
WP_140340092.1|2610050_2610839_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	32.1	9.4e-20
WP_000185202.1|2611054_2611843_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	72.3	3.0e-106
WP_000527470.1|2612751_2613111_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_000506751.1|2613258_2613462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133487.1|2613555_2613720_-	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	51.9	2.2e-08
WP_000183173.1|2613822_2613945_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013579.1|2613965_2614154_+	hypothetical protein	NA	NA	NA	NA	NA
2614148:2614183	attL	AATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
WP_000677277.1|2614252_2614423_+	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	87.5	5.1e-08
WP_001041413.1|2614443_2614914_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	91.0	7.2e-76
WP_001028517.1|2614910_2615453_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	97.2	1.0e-94
WP_000351128.1|2615577_2616234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440224.1|2617809_2618739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453364.1|2619119_2619341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615852.1|2619337_2619667_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	50.0	6.1e-21
WP_000377853.1|2619669_2619978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988815.1|2620759_2622436_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	7.8e-181
WP_000512879.1|2622452_2623697_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	37.5	6.8e-73
WP_003272656.1|2623713_2624346_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	45.5	1.9e-34
WP_000588590.1|2624359_2625484_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.0	7.2e-98
WP_001282872.1|2625497_2625821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963758.1|2625810_2626167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174092.1|2626153_2626534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111193.1|2626523_2626934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145608.1|2626935_2627505_+	hypothetical protein	NA	Q858W9	Listeria_phage	45.4	3.5e-40
WP_000159510.1|2627566_2627917_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	36.5	1.5e-09
WP_000235149.1|2628099_2631930_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	30.2	5.8e-46
WP_000227695.1|2631922_2632609_+	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	63.7	2.4e-80
WP_000631955.1|2632605_2635335_+|tail	phage tail protein	tail	A0A1B1P770	Bacillus_phage	50.2	3.6e-236
WP_000387824.1|2635372_2635606_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	95.9	2.7e-15
WP_000499523.1|2635700_2636894_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000461714.1|2637191_2637431_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	93.7	1.5e-32
WP_000753418.1|2637427_2638492_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	94.1	4.2e-196
WP_000459800.1|2638533_2639442_+	collagen-like protein	NA	NA	NA	NA	NA
WP_000998176.1|2639706_2640006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249915.1|2640024_2641434_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	45.8	6.2e-22
WP_000626125.1|2641739_2643422_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_000732186.1|2643628_2644393_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905570.1|2644537_2644954_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878371.1|2645074_2645278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362069.1|2645607_2645820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565693.1|2646029_2647037_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282689.1|2647179_2647584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062121.1|2647743_2648979_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000426103.1|2649390_2650533_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069254.1|2650522_2651155_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2651225_2651381_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289124.1|2651483_2651981_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168009.1|2652121_2653336_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954443.1|2653445_2654024_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_000766393.1|2654199_2655051_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088549.1|2655473_2657261_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000743772.1|2657495_2659622_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_000932141.1|2660486_2661665_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	28.3	6.8e-06
WP_000864376.1|2661764_2662445_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038210.1|2662855_2663404_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001182519.1|2663414_2665115_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	6.1e-16
WP_000556364.1|2665107_2665908_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2666044_2666152_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000348328.1|2666253_2667513_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_003270646.1|2667637_2667850_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	71.4	2.0e-17
2673205:2673240	attR	AATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
>prophage 8
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	3714645	3824128	5486830	transposase,capsid,protease,portal,holin,terminase,head,tRNA,tail,integrase,coat,bacteriocin	Bacillus_phage(53.57%)	108	3792712:3792729	3808715:3808732
WP_000878380.1|3714645_3715002_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000454956.1|3715035_3716469_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006458.1|3716655_3716847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274919.1|3717068_3717776_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671631.1|3717806_3719216_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.0	7.8e-57
WP_000066296.1|3719407_3720397_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000689202.1|3720576_3722418_-	peptidase	NA	NA	NA	NA	NA
WP_000771003.1|3722710_3723508_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	38.6	2.8e-35
WP_000272398.1|3723773_3725111_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791042.1|3725612_3727532_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.3	2.7e-97
WP_000798699.1|3728671_3729424_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|3729413_3730709_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000461138.1|3733058_3733244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516464.1|3733522_3735466_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.5e-63
WP_000195993.1|3735474_3738147_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.2	2.3e-33
WP_001288799.1|3738327_3738870_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870460.1|3738996_3739428_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_001005391.1|3739431_3740961_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190159.1|3741389_3742256_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3742242_3744000_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688049.1|3744227_3745151_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3745210_3745471_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3745620_3746415_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099769.1|3746577_3748143_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283854.1|3748625_3749657_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.8	1.9e-137
WP_000990687.1|3749801_3751040_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3751060_3751639_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137473.1|3751703_3752615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3752636_3753422_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114444.1|3753560_3753809_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759628.1|3753884_3754598_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411974.1|3754698_3755985_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.0e-10
WP_000772415.1|3755985_3757260_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.0	3.5e-56
WP_000008857.1|3757468_3758428_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3758428_3759487_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456926.1|3759479_3761012_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	6.3e-12
WP_000725769.1|3761130_3762216_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3762308_3763034_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118792.1|3763572_3765954_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3766166_3766370_-	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_000139807.1|3766366_3767116_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823071.1|3767219_3768890_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3769815_3770694_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692450.1|3770705_3771938_-	aspartate kinase	NA	NA	NA	NA	NA
WP_001238645.1|3773156_3773333_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_000459791.1|3773447_3774158_-	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_000249941.1|3774643_3775561_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	36.2	7.1e-19
WP_000069067.1|3775583_3776084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022083.1|3776349_3776739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540624.1|3776866_3777676_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	82.9	9.1e-135
WP_001261076.1|3777675_3777912_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_000499523.1|3778199_3779393_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000342979.1|3779525_3779894_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	61.5	1.7e-32
WP_001260192.1|3779905_3784291_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	53.6	0.0e+00
WP_000094125.1|3784287_3785745_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	59.9	2.3e-173
WP_000897025.1|3785786_3789413_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.5	1.9e-184
WP_001267171.1|3789430_3789685_-	hypothetical protein	NA	A0A2H4JHE4	uncultured_Caudovirales_phage	79.2	4.4e-19
WP_000415913.1|3789635_3790007_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.6	1.2e-41
WP_001004907.1|3790011_3790599_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3790599_3790935_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_001279008.1|3790931_3791276_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	78.8	7.0e-44
WP_001247272.1|3791277_3791628_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	1.3e-53
WP_001243203.1|3791629_3791926_-	hypothetical protein	NA	D2XR19	Bacillus_phage	87.5	9.5e-42
WP_000234856.1|3791938_3793102_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	5.5e-210
3792712:3792729	attL	AAATAAACTTCGTAACTG	NA	NA	NA	NA
WP_000216400.1|3793121_3793898_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	1.5e-57
WP_015406504.1|3793881_3794988_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	9.0e-186
WP_000615661.1|3795053_3796712_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.0	1.1e-256
WP_000124844.1|3796708_3797044_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	1.7e-07
WP_001258474.1|3797196_3797538_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.6	1.1e-54
WP_000049336.1|3797518_3797932_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	52.5	1.1e-30
WP_000196709.1|3797945_3798167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000333210.1|3798159_3798327_-	hypothetical protein	NA	A0A1B1P8J7	Bacillus_phage	67.3	8.1e-14
WP_003271368.1|3798783_3798975_-	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	77.8	2.9e-23
WP_000930972.1|3799429_3799648_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_001170299.1|3800070_3801021_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001012136.1|3801234_3801777_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	2.1e-87
WP_000166167.1|3801776_3802259_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.6	2.1e-70
WP_003271366.1|3802286_3802430_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	82.8	1.4e-06
WP_001061238.1|3802559_3802691_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	83.7	4.5e-12
WP_001141572.1|3802927_3803143_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.3	7.7e-25
WP_000032819.1|3803404_3804154_+	hypothetical protein	NA	A0A285PWR0	Cedratvirus	62.6	2.5e-38
WP_015406506.1|3804430_3804664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151791.1|3804910_3805132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000512858.1|3805167_3805359_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	65.1	8.3e-15
WP_001126000.1|3805432_3805795_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.0	2.4e-55
WP_000926801.1|3805769_3805958_-	hypothetical protein	NA	D2XR45	Bacillus_phage	80.0	5.3e-14
WP_000063842.1|3805960_3807283_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	94.8	1.9e-235
WP_000312138.1|3807279_3808227_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	59.9	1.2e-74
WP_000923256.1|3808228_3808405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998232.1|3808506_3808791_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	2.5e-23
3808715:3808732	attR	CAGTTACGAAGTTTATTT	NA	NA	NA	NA
WP_000215311.1|3808971_3809193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537278.1|3809206_3809794_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	8.4e-74
WP_001141264.1|3809884_3810133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001036233.1|3810165_3810357_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000900759.1|3810529_3810967_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.9	7.0e-33
WP_000403118.1|3810979_3811408_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	80.3	7.1e-62
WP_000202384.1|3811491_3812304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000661246.1|3812361_3813357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949469.1|3813340_3813508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844785.1|3813678_3815226_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	1.0e-142
WP_000954735.1|3815680_3816583_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239759.1|3816752_3817004_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000593001.1|3817139_3818381_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868222.1|3818468_3819368_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076745.1|3819520_3821659_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3821819_3822089_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766703.1|3822189_3823161_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_000399362.1|3823204_3824128_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 9
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	4401118	4457853	5486830	protease,tRNA,coat	Klosneuvirus(22.22%)	54	NA	NA
WP_000125365.1|4401118_4402258_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354019.1|4402270_4403323_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000970410.1|4403342_4403543_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344451.1|4403539_4404541_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.7	1.8e-07
WP_000464511.1|4404546_4405164_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823606.1|4405352_4406297_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871172.1|4406308_4406839_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033794973.1|4407272_4407680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093537.1|4407713_4408358_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000690755.1|4408536_4410414_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025334.1|4410639_4411746_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092228.1|4411776_4412610_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138546.1|4412629_4414159_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973780.1|4414311_4415454_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	2.5e-29
WP_000812276.1|4415453_4415996_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510664.1|4416075_4416723_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621693.1|4416883_4417735_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026317.1|4417831_4419745_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001011417.1|4419794_4421717_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114529.1|4421691_4422468_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.1e-19
WP_000865403.1|4422561_4423644_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002082113.1|4423633_4424341_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497130.1|4424481_4425768_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003587.1|4425767_4426316_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|4426379_4426670_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002094147.1|4426673_4427018_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4427029_4427338_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855480.1|4427507_4428896_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599064.1|4428963_4429824_-|protease	stage IV sporulation intramembrane metalloprotease SpoIVFB	protease	NA	NA	NA	NA
WP_000797475.1|4429816_4430563_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4430696_4431494_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391521.1|4431496_4432183_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975765.1|4432218_4432764_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135472.1|4432778_4433630_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4433671_4434691_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001013391.1|4434848_4435526_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000720495.1|4435572_4436148_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000361017.1|4436381_4437332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582038.1|4437496_4438798_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072223.1|4438891_4441537_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	3.2e-165
WP_000350660.1|4442023_4443049_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003271973.1|4443115_4444126_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712946.1|4444207_4445494_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087064.1|4445493_4446483_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000992351.1|4446503_4447256_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226397.1|4447258_4448188_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000009005.1|4448203_4449037_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_000547870.1|4449054_4450389_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133921.1|4450804_4451257_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359774.1|4451259_4451676_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869118.1|4451710_4452307_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097288.1|4452303_4454634_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	9.5e-177
WP_000119173.1|4454816_4456487_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000472289.1|4456593_4457853_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
>prophage 10
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	4522498	4530181	5486830		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221100.1|4522498_4523422_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	6.9e-46
WP_000247669.1|4523548_4524484_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.9e-23
WP_000018060.1|4524485_4525178_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_001293585.1|4525346_4525520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4525520_4525715_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255968.1|4525755_4526955_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	5.6e-72
WP_000587824.1|4527249_4527573_+	heme oxygenase	NA	NA	NA	NA	NA
WP_000095598.1|4527641_4528406_-	class B sortase	NA	NA	NA	NA	NA
WP_000403738.1|4528437_4529208_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.3e-13
WP_001036824.1|4529197_4530181_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	7.1e-17
>prophage 11
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	4722920	4729964	5486830	transposase	Staphylococcus_phage(50.0%)	9	NA	NA
WP_000165837.1|4722920_4723682_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.0e-34
WP_000527699.1|4723947_4724970_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000817275.1|4725126_4726284_-|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	9.6e-122
WP_004412121.1|4726280_4726631_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	66.7	9.2e-44
WP_001129340.1|4726845_4726995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840869.1|4727010_4727274_-	YtzC family protein	NA	NA	NA	NA	NA
WP_000868033.1|4727385_4728345_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	72.0	1.7e-55
WP_000764492.1|4728341_4728914_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.4	4.1e-49
WP_000959717.1|4729130_4729964_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.8e-16
>prophage 12
NC_017208	Bacillus thuringiensis serovar chinensis CT-43, complete sequence	5486830	4876911	4965454	5486830	transposase,capsid,protease,portal,terminase,head,tRNA,tail,integrase,plate,coat,holin	Bacillus_phage(67.86%)	97	4871471:4871494	4967468:4967491
4871471:4871494	attL	TTTTGTCGGTAAGTCGATATATTT	NA	NA	NA	NA
WP_000287154.1|4876911_4878288_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140612.1|4878327_4878711_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810334.1|4878806_4879550_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001253379.1|4879600_4880194_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000757822.1|4880239_4881127_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	1.2e-79
WP_001104228.1|4881234_4882959_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	3.5e-176
WP_000545250.1|4883102_4883708_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_001028674.1|4884121_4885375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537660.1|4885390_4885813_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_001183889.1|4885824_4886169_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001206693.1|4886271_4887159_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000487953.1|4887333_4888818_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	1.9e-58
WP_002094181.1|4888963_4889590_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.1e-14
WP_000027016.1|4889675_4889993_-	YuiB family protein	NA	NA	NA	NA	NA
WP_000517993.1|4889989_4890496_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856603.1|4890814_4892023_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829790.1|4892485_4893475_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000606660.1|4904235_4904715_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391931.1|4904933_4906181_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535246.1|4906198_4907080_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000635489.1|4907160_4907622_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710531.1|4907944_4908772_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|4908781_4909402_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891536.1|4909343_4910525_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000170777.1|4910640_4910823_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|4910819_4911137_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|4911319_4911517_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|4911525_4911705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043397.1|4911710_4912289_+	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.0	5.0e-95
WP_000119483.1|4912342_4912681_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	2.1e-48
WP_000405778.1|4913226_4913928_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	90.3	1.7e-121
WP_000373913.1|4913927_4914353_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000390482.1|4914428_4914653_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_001243323.1|4914803_4915979_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	80.4	4.6e-172
WP_000631942.1|4915993_4918336_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	95.3	0.0e+00
WP_000884123.1|4918332_4919016_-|tail	phage tail family protein	tail	A0A1B0T6A0	Bacillus_phage	96.0	2.1e-124
WP_001119327.1|4919016_4922409_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	92.1	0.0e+00
WP_000113340.1|4922652_4923039_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_000151366.1|4923050_4923686_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000157921.1|4923697_4924075_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	87.2	2.5e-55
WP_001166633.1|4924074_4924404_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_001126092.1|4924393_4924726_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	96.4	1.6e-53
WP_000342229.1|4924703_4924964_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	96.5	1.4e-41
WP_001049344.1|4924965_4926270_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	91.1	5.5e-198
WP_000687903.1|4926271_4926853_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	1.4e-97
WP_000603760.1|4926923_4927181_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_000524246.1|4927349_4928522_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.2	2.7e-220
WP_000587611.1|4928537_4930262_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.3	0.0e+00
WP_000113444.1|4930258_4930684_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_000872554.1|4930766_4931159_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	6.9e-72
WP_000627440.1|4931155_4931470_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	1.4e-46
WP_000074276.1|4931466_4931685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052395.1|4931731_4931929_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.3e-23
WP_000930965.1|4931986_4932211_-	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000895343.1|4932495_4932885_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	61.2	9.9e-39
WP_102981940.1|4932902_4933001_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847100.1|4933168_4933354_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_001092478.1|4933401_4933689_-	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.6	8.9e-45
WP_000726820.1|4933914_4934313_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.0	1.0e-67
WP_000159772.1|4934397_4935144_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	8.2e-98
WP_000002743.1|4935140_4935365_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.6	4.0e-24
WP_000532218.1|4935364_4936246_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	32.6	5.2e-27
WP_000040038.1|4936257_4937031_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	4.9e-53
WP_000525424.1|4937163_4938045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372558.1|4938068_4938743_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.5	4.6e-84
WP_000277642.1|4938956_4939145_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	3.4e-21
WP_000368215.1|4939289_4939535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236353.1|4939916_4941146_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000004989.1|4941515_4941845_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_001233256.1|4942119_4942269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466634.1|4942265_4943519_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.1	1.7e-212
WP_000237488.1|4944860_4945922_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000833148.1|4946011_4946365_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_003272374.1|4946471_4946657_-	methyltransferase	NA	NA	NA	NA	NA
WP_000834607.1|4947060_4947831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068189.1|4948743_4949307_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573830.1|4949412_4949766_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077392.1|4949807_4950674_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4950920_4951160_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682065.1|4951512_4952583_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|4952816_4952990_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470295.1|4953045_4953705_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	2.9e-22
WP_000679257.1|4953688_4954486_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212735.1|4954727_4955069_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_024927875.1|4955228_4955510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272364.1|4955579_4956377_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_001019404.1|4956703_4957381_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003272363.1|4957479_4958274_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|4958326_4958635_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4958830_4959067_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4959386_4959602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614216.1|4959663_4960665_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4960785_4961277_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351152.1|4961300_4961780_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106075.1|4961941_4963045_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856291.1|4962989_4964336_+	phosphoribosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000241506.1|4964341_4965454_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
4967468:4967491	attR	AAATATATCGACTTACCGACAAAA	NA	NA	NA	NA
>prophage 1
NC_017202	Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT127, complete sequence	127885	1013	54647	127885	transposase,integrase	Bacillus_phage(33.33%)	40	42164:42179	59404:59419
WP_000538377.1|1013_3977_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
WP_001053955.1|4170_5607_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_000172519.1|5826_6495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221334.1|6561_6813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000030292.1|6820_7294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000179528.1|7611_7980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291045.1|8622_8877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058099.1|8912_9101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931944.1|9578_10619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003319293.1|11947_12124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126335.1|12538_12943_-	hypothetical protein	NA	A0A1X9I5S2	Streptococcus_phage	31.0	5.5e-08
WP_000900639.1|13270_14035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000345487.1|14164_14878_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000382147.1|15329_16184_+	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_000538377.1|16202_19166_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
WP_000169370.1|20205_21513_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.3e-26
WP_000240401.1|23322_23541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203376.1|25431_29118_-	pesticidal crystal protein cry1Ba	NA	NA	NA	NA	NA
WP_014481837.1|29687_30134_-	hypothetical protein	NA	A0A1B1P878	Bacillus_phage	42.2	1.6e-16
WP_000681129.1|30120_30501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272683.1|30497_32411_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000861877.1|32503_33622_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.0	3.2e-05
WP_001043946.1|34105_34378_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	1.8e-23
WP_015413263.1|34828_35227_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	3.1e-51
WP_000595411.1|35238_36345_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.5	1.3e-78
WP_001058764.1|36811_37021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167374445.1|37311_37665_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000021282.1|37689_37920_+	hypothetical protein	NA	A0A217ERD4	Bacillus_phage	51.8	2.2e-06
WP_000700965.1|38246_39017_-	coenzyme F420-0:L-glutamate ligase	NA	NA	NA	NA	NA
WP_000644939.1|39013_39874_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000660942.1|39870_40737_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000554005.1|40944_41967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028781.1|41950_43192_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
42164:42179	attL	AAATATGGTGGTGATA	NA	NA	NA	NA
WP_000412005.1|43172_44183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000560325.1|44179_45307_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_014481840.1|46877_49895_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.0	4.1e-39
WP_000704745.1|50177_51344_+	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	52.1	1.4e-107
WP_001021537.1|51726_52770_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.4	5.8e-09
WP_000149391.1|53001_53265_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000275580.1|53351_54647_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
59404:59419	attR	TATCACCACCATATTT	NA	NA	NA	NA
>prophage 1
NC_017203	Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence	281231	3317	52692	281231	transposase,integrase,holin,bacteriocin	Bacillus_phage(53.33%)	45	42907:42925	57531:57549
WP_000892197.1|3317_3740_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
WP_000495521.1|6233_6638_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_001243454.1|7833_8883_+	Fic family protein	NA	NA	NA	NA	NA
WP_001252813.1|9048_9396_-	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	49.5	3.2e-20
WP_000086972.1|10213_10468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762719.1|12319_12718_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.9	7.0e-48
WP_003319651.1|13444_13807_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	6.0e-14
WP_001255046.1|13999_14347_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	54.1	2.5e-25
WP_000954716.1|14636_15479_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016090368.1|16233_16395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481859.1|17011_17548_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_014481860.1|17507_17819_+	mono-ADP-ribosyltransferase C3 (Exoenzyme C3)	NA	NA	NA	NA	NA
WP_000116994.1|18194_19625_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000520933.1|20088_20961_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000066802.1|23110_24127_-	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_001032039.1|24693_24993_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000845491.1|25545_25755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844156.1|25891_26140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103226.1|26484_27579_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
WP_000737574.1|27575_27713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481861.1|27836_28001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000456645.1|28020_28914_-	SEC-C motif-containing protein	NA	NA	NA	NA	NA
WP_000065268.1|29093_29318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|30021_30774_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|30763_32059_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000790837.1|33139_33532_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000128275.1|33605_33824_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000532004.1|33846_35151_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_000346798.1|35616_35781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121085.1|36358_36871_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000149389.1|36892_37243_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001021539.1|37474_38518_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000019020.1|38731_39058_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	51.0	2.4e-22
WP_000734601.1|39390_39543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001001083.1|39539_40763_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.1	6.1e-151
WP_000475295.1|40969_42613_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
42907:42925	attL	AAAAAGAACCATAACCTTG	NA	NA	NA	NA
WP_000843046.1|43314_43593_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	2.3e-13
WP_014481865.1|43659_43800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031303430.1|44074_44269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043935.1|44515_44788_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	3.3e-25
WP_000914524.1|45277_45793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|45897_47334_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000272577.1|48142_49408_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_000477499.1|49588_50686_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_001028065.1|50682_52692_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
57531:57549	attR	CAAGGTTATGGTTCTTTTT	NA	NA	NA	NA
>prophage 2
NC_017203	Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence	281231	159879	232029	281231	transposase,integrase	Pseudomonas_phage(12.5%)	56	219803:219820	240620:240637
WP_000041871.1|159879_160827_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000217299.1|160967_161111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520262.1|162053_163763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372779.1|164449_165919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000372481.1|165954_167679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000459233.1|168060_168870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000724860.1|170667_171060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610947.1|171152_171935_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000373088.1|171949_172867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000335059.1|173276_175079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481878.1|176172_178542_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003319726.1|178747_179467_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_000118651.1|179467_181387_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_000853368.1|181389_182250_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_130055909.1|182540_182705_+	type I CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_071686409.1|182756_182990_+	type I CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_000710696.1|185449_185875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710813.1|185896_186034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219637.1|186138_187230_+	methyltransferase	NA	NA	NA	NA	NA
WP_000114815.1|187245_187473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654328.1|189199_191065_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	2.4e-37
WP_000494364.1|193760_194474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024816.1|194810_195440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000817905.1|195439_196075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078405438.1|196125_196704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916413.1|196723_197308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406623.1|197433_197817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866011.1|197833_198472_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.6	3.3e-23
WP_000312314.1|199057_199258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003319769.1|199603_199777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520732.1|200229_202893_+	type IA DNA topoisomerase	NA	A0A1V0SIB2	Klosneuvirus	20.9	4.5e-13
WP_000708139.1|203321_203966_+	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	34.0	3.7e-06
WP_001014119.1|203998_204199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081052.1|204274_204562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887510.1|204585_205044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420420.1|205034_205472_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000207869.1|205545_205839_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001017354.1|206028_207120_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.6	9.2e-90
WP_024927926.1|207427_207745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682816.1|207741_208119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763085.1|208202_208718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033679394.1|210235_210538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206763.1|211255_211669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954720.1|212065_212881_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_071686411.1|213061_213190_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_087942375.1|213473_215035_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
WP_000762722.1|215447_215852_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	6.5e-41
WP_000929144.1|217100_217397_+	hypothetical protein	NA	NA	NA	NA	NA
219803:219820	attL	TTGAGGAAGGAGTCTTCT	NA	NA	NA	NA
WP_000701098.1|220987_222061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369347.1|222172_223084_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000981146.1|223764_224883_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	80.4	5.4e-170
WP_000790998.1|225640_226960_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_000975321.1|227022_228252_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_001063469.1|228283_229417_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_003319867.1|231544_231811_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003319868.1|231873_232029_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
240620:240637	attR	AGAAGACTCCTTCCTCAA	NA	NA	NA	NA
>prophage 1
NC_017204	Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT51, complete sequence	51488	18107	30207	51488	holin,transposase	Bacillus_phage(60.0%)	16	NA	NA
WP_000013278.1|18107_20108_+	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	33.5	4.0e-14
WP_000537585.1|20120_20501_+	hypothetical protein	NA	G3MAB0	Bacillus_virus	33.3	5.9e-12
WP_000182359.1|20516_21467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152790.1|21480_21729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499525.1|21982_23179_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_000439587.1|23474_23972_+|holin	phage holin family protein	holin	A0A0M4R5G6	Bacillus_phage	42.8	1.2e-25
WP_000742982.1|24051_25110_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7Q1	Bacillus_phage	75.4	2.0e-150
WP_000383999.1|25259_25412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002175753.1|25438_25666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276342.1|25658_25871_+	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	94.3	4.3e-28
WP_003275239.1|25886_26609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558422.1|27116_28232_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.1	1.2e-105
WP_000734385.1|28231_28477_+	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	75.4	6.7e-17
WP_000072432.1|28530_28767_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	50.6	2.2e-17
WP_000664560.1|28861_29227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000365196.1|29223_30207_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	38.0	1.8e-52
>prophage 2
NC_017204	Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT51, complete sequence	51488	34253	48537	51488		Bacillus_phage(95.45%)	30	NA	NA
WP_000071639.1|34253_35312_-	hypothetical protein	NA	A0A0S2MVK1	Bacillus_phage	52.1	4.5e-09
WP_000377657.1|35821_35983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505894.1|36246_36843_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000586229.1|36967_37156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542658.1|37223_37682_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	47.8	5.8e-30
WP_000028578.1|37702_38140_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	56.2	9.8e-35
WP_000786982.1|38413_38599_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	59.0	1.0e-09
WP_000016917.1|38603_39299_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	43.8	4.8e-44
WP_001017952.1|39321_39750_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	47.1	3.2e-30
WP_000588731.1|39774_40482_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	67.7	1.1e-88
WP_000521758.1|40545_40893_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	33.3	6.2e-08
WP_000998881.1|41078_41579_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	68.7	2.0e-60
WP_000139419.1|41547_41964_+	hypothetical protein	NA	A0A0A7AQI1	Bacillus_phage	65.0	2.6e-45
WP_000706146.1|41966_42434_+	hypothetical protein	NA	A0A0A7AR00	Bacillus_phage	49.7	3.8e-37
WP_014481904.1|42640_42907_+	hypothetical protein	NA	A0A0A7AR58	Bacillus_phage	53.1	2.5e-17
WP_000843530.1|42903_43353_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	77.9	1.2e-67
WP_001216607.1|43349_43931_+	dUTP diphosphatase	NA	A0A0S2MVD0	Bacillus_phage	82.9	1.2e-93
WP_000287939.1|43932_44094_+	hypothetical protein	NA	A0A1B1P7B0	Bacillus_phage	56.2	4.1e-07
WP_000662331.1|44122_44461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993190.1|44457_44676_+	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	42.9	6.2e-06
WP_000283199.1|44711_44903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124018.1|44922_45291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000421737.1|45312_45540_+	hypothetical protein	NA	U5PVK0	Bacillus_phage	58.8	4.0e-16
WP_003275270.1|45606_45933_+	hypothetical protein	NA	A0A1B1P8B5	Bacillus_phage	70.8	2.3e-36
WP_001025589.1|45963_46170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857766.1|46252_46537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775717.1|46574_46985_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.2	1.6e-10
WP_000540408.1|47021_47552_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	81.8	1.8e-78
WP_000438377.1|47551_47890_+	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	47.2	1.3e-21
WP_000654046.1|48036_48537_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	80.6	3.3e-71
