The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	500161	553360	4649365	integrase,transposase	uncultured_marine_virus(20.0%)	53	497432:497448	548682:548698
497432:497448	attL	GGCTCATAACCTGAAGG	NA	NA	NA	NA
WP_193371730.1|500161_501104_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.3	3.1e-17
WP_148259231.1|501543_501846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651245.1|502089_502311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651246.1|502401_504426_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013651247.1|504959_505904_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.0	1.7e-60
WP_013651248.1|506183_507821_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_148259232.1|508014_508275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083812026.1|508463_508778_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_148259233.1|508910_509552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083812027.1|510044_511226_-	flagellin	NA	NA	NA	NA	NA
WP_083812028.1|511348_511882_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_148259234.1|512176_512446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259235.1|514127_514319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259236.1|514691_515762_-	hypothetical protein	NA	F2Y2D2	Organic_Lake_phycodnavirus	40.9	7.0e-10
WP_083812029.1|516190_517012_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083812030.1|516991_517138_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158306619.1|517134_517281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085997569.1|517317_517617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158306620.1|518215_518374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259237.1|518726_519230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651254.1|519668_519974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651255.1|519977_520208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259379.1|520207_520567_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	52.5	7.8e-22
WP_013651257.1|520623_522465_+	ParB/RepB/Spo0J family partition protein	NA	A0A0F7L836	uncultured_marine_virus	28.4	6.4e-19
WP_148259238.1|522543_522729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651259.1|523200_523494_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_013651260.1|523562_524069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651261.1|524105_524663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651262.1|524902_525268_+	hypothetical protein	NA	A0A0F7L9F6	uncultured_marine_virus	41.3	1.3e-19
WP_158306621.1|525542_525707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148259380.1|526928_527372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375331.1|527361_529059_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_013651266.1|529141_529756_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_041375332.1|529807_530146_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013651268.1|530133_530385_-	MazE family transcriptional regulator	NA	NA	NA	NA	NA
WP_013651269.1|530434_530824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083812031.1|530839_532435_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_083812152.1|532796_533531_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_193371731.1|533633_534245_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_013651272.1|534241_534460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375772.1|534504_535095_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	50.0	2.9e-37
WP_013651273.1|535069_537838_-	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.9	2.1e-45
WP_041375333.1|537840_538341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651274.1|538343_541541_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_013651275.1|541554_542544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375773.1|542543_545294_-	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_148259382.1|545306_546164_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_083812032.1|546422_546935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651278.1|547069_547291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013651279.1|547313_548525_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	32.3	1.4e-22
WP_013651280.1|549163_550243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
548682:548698	attR	GGCTCATAACCTGAAGG	NA	NA	NA	NA
WP_158306622.1|550503_552204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085997570.1|552230_553360_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	64.3	9.2e-93
>prophage 2
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	648896	755338	4649365	integrase,protease,transposase	Rhodobacter_phage(10.71%)	108	637393:637440	716913:716929
637393:637440	attL	GGCTCATAACCTGAAGGTCGTAGGTTCAAATCCTACCCCCGCAACCAA	NA	NA	NA	NA
WP_013651363.1|648896_649481_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
637393:637440	attL	GGCTCATAACCTGAAGGTCGTAGGTTCAAATCCTACCCCCGCAACCAA	NA	NA	NA	NA
WP_148259242.1|649477_649861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651364.1|649820_650294_-	universal stress protein	NA	NA	NA	NA	NA
WP_013651365.1|650440_650935_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_041375341.1|650919_652110_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_013651367.1|652102_653734_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_193371721.1|653747_654125_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013651369.1|654293_655154_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013651371.1|656395_656788_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	54.8	2.7e-23
WP_013651372.1|656803_657118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651373.1|657182_658982_+	ParB/RepB/Spo0J family partition protein	NA	A0A0F7L836	uncultured_marine_virus	28.7	1.4e-21
WP_013651375.1|659364_660543_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_013651376.1|660539_661946_-	bifunctional enoyl-CoA hydratase/phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013651377.1|661953_663735_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_013651378.1|663731_664322_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013651379.1|664466_664811_+	phasin family protein	NA	NA	NA	NA	NA
WP_013651380.1|665170_665428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148259243.1|665814_666000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651382.1|666373_666625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375792.1|667535_667832_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_013651384.1|667898_668408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651385.1|668689_669055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259384.1|669491_669794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085997572.1|670099_671288_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	4.3e-48
WP_013651389.1|671304_671664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651390.1|671684_672371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375345.1|672854_673049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083812154.1|673625_674105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651392.1|674094_675786_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_041375347.1|675792_676164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049792542.1|676179_677775_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013651394.1|678053_678281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049792543.1|678282_678936_-	ParA family protein	NA	A0A0K1Y6H3	Rhodobacter_phage	44.7	7.3e-42
WP_013650723.1|679812_680583_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	43.0	1.9e-41
WP_013651399.1|682122_682332_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049792544.1|682428_683049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169313689.1|683279_683864_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013651402.1|684997_685570_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	55.2	8.9e-44
WP_148259244.1|685561_685816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651403.1|686032_686977_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_013651404.1|686986_688105_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	7.1e-21
WP_013651405.1|688101_688593_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_013651406.1|688707_689199_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_013651407.1|689219_689618_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_013651408.1|689632_690058_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_013651409.1|690260_690692_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013651410.1|690706_692539_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	43.6	4.0e-106
WP_013651411.1|692602_695509_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	35.7	1.5e-123
WP_013651412.1|695586_696726_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_193371732.1|696776_697301_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_013651414.1|697334_698087_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013651415.1|698077_698920_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1V0SAV4	Catovirus	28.9	3.5e-12
WP_041375351.1|698972_699395_+	thioredoxin TrxC	NA	V5L6J2	Insectomime_virus	33.3	7.3e-11
WP_013651417.1|699443_700622_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_013651418.1|700863_701085_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013651419.1|701138_702269_-|integrase	site-specific integrase	integrase	G8C7K6	Escherichia_phage	35.9	4.3e-26
WP_083812156.1|702837_703770_+	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	31.0	8.8e-25
702451:702498	attR	GGCTCATAACCTGAAGGTCGTAGGTTCAAATCCTACCCCCGCAACCAA	NA	NA	NA	NA
WP_013651421.1|704234_704465_-	hypothetical protein	NA	NA	NA	NA	NA
702451:702498	attR	GGCTCATAACCTGAAGGTCGTAGGTTCAAATCCTACCCCCGCAACCAA	NA	NA	NA	NA
WP_013651422.1|704555_706571_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013651423.1|707111_708053_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	44.7	1.1e-62
WP_013651424.1|708232_709432_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013651425.1|709435_711970_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_013651426.1|712178_712721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375353.1|712724_713180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651427.1|713389_713974_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148259245.1|714117_714549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651429.1|714655_715702_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	37.2	1.9e-55
WP_041375355.1|716329_719614_+	inverse autotransporter beta-barrel domain-containing protein	NA	A0A2D1GMQ7	Marinobacter_phage	26.7	5.3e-08
WP_148259246.1|719668_720419_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	3.2e-25
WP_013651433.1|721047_721440_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	49.6	1.0e-19
WP_041375358.1|723413_723599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651435.1|724080_724377_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_013651436.1|724444_724924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651437.1|725242_725809_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_013651438.1|726145_726511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375359.1|727026_727245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085997565.1|728096_729045_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.1	2.0e-08
WP_148259247.1|730227_730437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259387.1|731068_731545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259386.1|731627_733232_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_013651444.1|733315_733933_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_148259248.1|733974_734307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013651446.1|734385_734772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375362.1|734794_735133_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013651448.1|735120_735372_-	MazE family transcriptional regulator	NA	NA	NA	NA	NA
WP_013651449.1|735451_735811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148259388.1|735826_737293_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_041375363.1|737696_737924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375803.1|737925_738498_-	ParA family protein	NA	A0A219YB79	Aeromonas_phage	33.7	3.0e-15
WP_085997565.1|738555_739504_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.1	2.0e-08
WP_193371722.1|739476_739635_-	hypothetical protein	NA	A0A0K1Y6H3	Rhodobacter_phage	60.5	4.5e-06
WP_013651454.1|739810_740503_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148259389.1|740608_741220_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_148259249.1|741216_741402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651456.1|741516_742083_+	recombinase family protein	NA	Q1MVM2	Enterobacteria_phage	53.6	1.3e-42
WP_013651429.1|742102_743149_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	37.2	1.9e-55
WP_193371723.1|743201_744473_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013651458.1|744450_745485_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	68.9	5.0e-138
WP_013651459.1|745550_746435_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013651460.1|746454_746697_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013651461.1|746798_747677_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_013651462.1|747732_749271_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	32.9	1.5e-32
WP_013651463.1|749267_750440_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	30.8	2.7e-10
WP_158306625.1|750445_750607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013651464.1|750674_751754_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_083812039.1|751898_753026_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_013650723.1|753074_753845_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	43.0	1.9e-41
WP_013650724.1|753841_755338_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	1757249	1804435	4649365	capsid,tRNA,transposase,portal,protease,integrase,head,tail	Rhodobacter_phage(36.84%)	57	1779302:1779317	1807518:1807533
WP_013652391.1|1757249_1759214_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.8	3.3e-122
WP_049792567.1|1759529_1760570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013652393.1|1760791_1761385_+	nitroreductase	NA	NA	NA	NA	NA
WP_013652394.1|1761389_1761992_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_013652395.1|1762143_1763133_+	lytic transglycosylase	NA	A0A1Y0T0A2	Pseudomonas_phage	35.4	4.1e-20
WP_013652396.1|1763246_1764389_+	DUF2336 domain-containing protein	NA	NA	NA	NA	NA
WP_013652397.1|1764421_1764958_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_013652398.1|1765136_1765919_-	NAD kinase	NA	NA	NA	NA	NA
WP_148259427.1|1766353_1766938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193371725.1|1767091_1767706_-	hypothetical protein	NA	G8GWB1	Rhodobacter_phage	64.6	1.3e-16
WP_013652401.1|1767908_1768202_+	helix-turn-helix domain-containing protein	NA	A0A219VHB8	Ochrobactrum_phage	57.1	2.9e-22
WP_013652402.1|1768201_1768513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375444.1|1768512_1768722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652403.1|1768847_1769687_+	ParB N-terminal domain-containing protein	NA	R9U496	Rhizobium_phage	41.5	2.0e-44
WP_013652404.1|1769679_1770138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652405.1|1770134_1770353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375445.1|1770349_1772515_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	42.8	3.0e-140
WP_013652407.1|1772586_1773351_+	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	41.6	5.7e-46
WP_013652408.1|1773350_1773992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652409.1|1773988_1774369_+	hypothetical protein	NA	M4STC0	Rhodobacter_phage	42.6	2.9e-19
WP_013652410.1|1774355_1774628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652411.1|1774624_1775017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083812165.1|1775082_1775673_+	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	67.7	9.4e-73
WP_013652413.1|1775672_1775975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652414.1|1775971_1776262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652416.1|1776818_1777451_+	regulatory protein GemA	NA	A0A219VHC6	Ochrobactrum_phage	43.3	1.2e-36
WP_148259429.1|1777459_1777822_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148259430.1|1778554_1779487_+	TraR/DksA C4-type zinc finger protein	NA	B5TA71	Burkholderia_phage	46.0	3.7e-07
1779302:1779317	attL	GCCGAGGCGCGGGTCG	NA	NA	NA	NA
WP_013652421.1|1779486_1779813_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_013652422.1|1779809_1780115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652423.1|1780125_1780689_+	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	34.3	4.4e-11
WP_013652424.1|1780689_1782102_+	hypothetical protein	NA	Q5ZQY5	Pseudomonas_phage	75.5	5.9e-198
WP_148259273.1|1782094_1784179_+|portal	phage portal protein	portal	A0A1B1IWP5	uncultured_Mediterranean_phage	45.5	1.1e-96
WP_041375970.1|1784300_1785062_+|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_013652427.1|1785425_1786721_+|capsid	phage major capsid protein	capsid	A0A222ZEN6	Arthrobacter_phage	34.4	3.6e-32
WP_013652428.1|1786944_1787493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652429.1|1787504_1788008_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041375448.1|1788124_1788382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652431.1|1788391_1788958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652432.1|1789084_1789429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652433.1|1789459_1789726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652434.1|1789730_1790864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652435.1|1790860_1791301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652436.1|1791391_1791700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652437.1|1792066_1792474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652438.1|1792635_1793061_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013652439.1|1793107_1793713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652440.1|1793722_1793953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652441.1|1793919_1794396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652442.1|1794392_1794695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652443.1|1794687_1796610_+	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	31.9	1.3e-30
WP_013652444.1|1796606_1797029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652445.1|1797056_1797590_+	hypothetical protein	NA	M4ST87	Rhodobacter_phage	53.4	1.1e-43
WP_013652446.1|1797586_1798021_+	C40 family peptidase	NA	G8GWF9	Rhodobacter_phage	47.3	4.1e-25
WP_013652447.1|1798017_1800996_+|tail	tail fiber protein	tail	A0A1B0T6I4	Pelagibaca_phage	43.8	8.1e-197
WP_013652448.1|1801006_1802806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652449.1|1803265_1804435_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
1807518:1807533	attR	GCCGAGGCGCGGGTCG	NA	NA	NA	NA
>prophage 4
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	2309748	2323787	4649365	tRNA	uncultured_Mediterranean_phage(70.0%)	15	NA	NA
WP_013652931.1|2309748_2311377_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	2.8e-151
WP_013652932.1|2311532_2312375_+	VOC family protein	NA	NA	NA	NA	NA
WP_148259290.1|2312405_2312867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013652933.1|2313117_2314125_-	enterochelin esterase	NA	NA	NA	NA	NA
WP_013652934.1|2314269_2315295_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	46.5	4.5e-22
WP_013652935.1|2315297_2316101_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	32.2	1.4e-31
WP_013652936.1|2316090_2316798_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	50.9	2.6e-45
WP_013652937.1|2316794_2317928_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	26.6	1.9e-13
WP_013652938.1|2318039_2318279_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	67.3	5.4e-11
WP_013652939.1|2318317_2318755_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_013652940.1|2318751_2319549_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	49.8	1.4e-55
WP_013652941.1|2319631_2320912_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.9	2.2e-95
WP_013652942.1|2320915_2321674_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_013652943.1|2321714_2322395_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	44.9	1.9e-24
WP_013652944.1|2322506_2323787_+	M23 family metallopeptidase	NA	S6B1Q4	Bacillus_phage	34.4	1.6e-08
>prophage 5
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	3145500	3161452	4649365	capsid,portal,protease,head,tail	Dinoroseobacter_phage(25.0%)	19	NA	NA
WP_013653653.1|3145500_3146376_-	peptidoglycan-binding protein	NA	A0A1B1UZH2	Plesiomonas_phage	38.5	7.8e-07
WP_041375559.1|3146420_3147143_-	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	42.4	4.7e-42
WP_013653655.1|3147135_3151005_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0K1LLC1	Rhodobacter_phage	41.5	4.2e-246
WP_013653656.1|3150992_3151454_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	48.5	1.4e-28
WP_013653657.1|3151443_3152337_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	37.3	7.1e-48
WP_013653658.1|3152355_3152991_-	DUF2460 domain-containing protein	NA	A0A1V0DYB0	Dinoroseobacter_phage	41.8	8.1e-30
WP_013653659.1|3153087_3153342_+	YdcH family protein	NA	NA	NA	NA	NA
WP_013653660.1|3153364_3153952_-|tail	phage tail tape measure protein	tail	A0A1B2AP03	Escherichia_phage	41.9	2.9e-05
WP_148259461.1|3153955_3154177_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_049792596.1|3154173_3154557_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_013653662.1|3154713_3155127_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013653663.1|3155150_3155567_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_083812100.1|3155563_3155995_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_013653664.1|3155885_3156443_-|head,tail	phage head-tail connector protein	head,tail	A0A141GEW4	Brucella_phage	32.1	1.2e-13
WP_013653665.1|3156531_3157830_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	43.0	4.2e-81
WP_013653666.1|3157826_3158279_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	49.2	4.3e-25
WP_041375560.1|3158555_3158750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375561.1|3158746_3159943_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.5	3.2e-72
WP_013653668.1|3160210_3161452_-	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	44.0	1.2e-80
>prophage 6
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	4060454	4070103	4649365		Acidithiobacillus_phage(50.0%)	8	NA	NA
WP_013654478.1|4060454_4063670_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	27.4	3.8e-67
WP_013654479.1|4063812_4064544_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	42.6	1.0e-52
WP_083812128.1|4064536_4065760_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013654481.1|4065752_4067270_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.7	3.5e-79
WP_013654482.1|4067269_4067860_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041375641.1|4067942_4068329_-	bacteriophage-like protein	NA	K4HZX2	Acidithiobacillus_phage	36.0	4.6e-12
WP_013654484.1|4068325_4069651_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	52.7	1.4e-121
WP_013654485.1|4069647_4070103_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	45.0	4.4e-22
>prophage 7
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	4077244	4085342	4649365	transposase,terminase	uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_013654494.1|4077244_4078609_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	39.1	1.6e-75
WP_083812129.1|4078610_4079708_+	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	49.4	1.2e-33
WP_013654496.1|4079717_4079933_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	69.6	7.0e-18
WP_013654497.1|4079977_4080175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654498.1|4080223_4080796_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	37.2	1.9e-14
WP_013654499.1|4080886_4081111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654500.1|4081570_4082608_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013654501.1|4082797_4083394_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	43.0	1.3e-26
WP_049792617.1|4083341_4085342_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	61.2	1.0e-219
>prophage 8
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	4092001	4107918	4649365		Paracoccus_phage(30.0%)	14	NA	NA
WP_013654511.1|4092001_4092421_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	55.0	1.2e-34
WP_013654512.1|4092560_4093499_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	56.7	2.1e-98
WP_013654513.1|4093501_4093939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654514.1|4093947_4094166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654515.1|4094158_4096594_+	hypothetical protein	NA	A0A1J0GUY9	Halomonas_phage	36.6	1.8e-21
WP_013654516.1|4096597_4097224_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	57.8	1.5e-60
WP_013654517.1|4097220_4097571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654518.1|4097700_4098345_+	lysozyme	NA	F8TV87	EBPR_siphovirus	50.6	1.4e-37
WP_041375644.1|4098341_4098551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654519.1|4098547_4099432_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.9	4.8e-65
WP_013654520.1|4099428_4099863_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	45.2	1.0e-28
WP_013654521.1|4099872_4103916_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	40.7	3.5e-259
WP_013654522.1|4103927_4105850_+	DUF2793 domain-containing protein	NA	A0A0K1LM04	Rhodobacter_phage	29.7	3.8e-30
WP_148259347.1|4106367_4107918_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	46.1	7.6e-13
>prophage 9
NC_015259	Polymorphum gilvum SL003B-26A1, complete sequence	4649365	4284705	4432299	4649365	capsid,plate,tRNA,transposase,portal,terminase,integrase,head,tail	Ochrobactrum_phage(23.38%)	156	4301025:4301043	4345801:4345819
WP_148259354.1|4284705_4285713_-	late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.9	1.1e-94
WP_013654700.1|4285709_4285970_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_013654701.1|4285966_4286398_-|tail	phage tail protein	tail	A0A219VHA8	Ochrobactrum_phage	58.7	3.3e-43
WP_013654702.1|4286398_4288882_-|tail	phage tail tape measure protein	tail	H8YJ81	Vibrio_phage	29.2	1.4e-32
WP_148259355.1|4288894_4289020_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_013654703.1|4289016_4289469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654704.1|4289494_4290013_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	59.9	2.0e-55
WP_013654705.1|4290051_4291314_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A219VHA7	Ochrobactrum_phage	69.2	2.6e-168
WP_013654706.1|4291489_4291999_-	hypothetical protein	NA	A0A1Y0SVH3	Sinorhizobium_phage	44.2	8.0e-12
WP_013654707.1|4291995_4293069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654708.1|4293080_4296293_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	39.5	9.6e-196
WP_013654709.1|4296300_4297455_-	phage protein gp27	NA	K4I1F8	Acidithiobacillus_phage	37.9	3.4e-26
WP_013654710.1|4297451_4298300_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	38.9	1.2e-39
WP_013654711.1|4298296_4298704_-|plate	baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	60.3	1.6e-39
WP_041375658.1|4298708_4298900_-	hypothetical protein	NA	A0A219VHA0	Ochrobactrum_phage	63.4	4.2e-06
WP_013654712.1|4298913_4299480_-	hypothetical protein	NA	A0A219VHA3	Ochrobactrum_phage	51.4	8.0e-37
WP_013654713.1|4299476_4300946_-	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	45.1	2.4e-32
WP_013654714.1|4300942_4301422_-	phage virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	59.7	5.5e-47
4301025:4301043	attL	CGGGCCGGGATCGTCACCG	NA	NA	NA	NA
WP_013654715.1|4301418_4301835_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_013654716.1|4301856_4302126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654717.1|4302203_4303103_-|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	47.5	1.3e-73
WP_013654718.1|4303139_4303541_-	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	51.1	9.0e-27
WP_013654719.1|4303590_4304604_-	Mu-like prophage I protein	NA	A0A219VH76	Ochrobactrum_phage	47.2	1.0e-66
WP_013654720.1|4304956_4306219_-	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	63.9	7.8e-109
WP_013654721.1|4306208_4307771_-	DUF935 domain-containing protein	NA	A0A219VH73	Ochrobactrum_phage	53.6	2.1e-151
WP_013654722.1|4307767_4309438_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	65.6	3.1e-198
WP_013654723.1|4309434_4310019_-	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	60.8	4.2e-57
WP_013654724.1|4310021_4310318_-	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	62.8	1.3e-25
WP_013654725.1|4310321_4310663_-	DUF2730 family protein	NA	A0A219VHD8	Ochrobactrum_phage	38.3	1.4e-12
WP_158306647.1|4310659_4310797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654726.1|4310801_4311194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375660.1|4311190_4311391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654727.1|4311387_4312329_-	peptidoglycan-binding protein	NA	A0A0M5M782	Salmonella_phage	35.3	5.4e-06
WP_013654728.1|4312419_4312812_-	hypothetical protein	NA	A0A219VHE2	Ochrobactrum_phage	51.2	1.8e-24
WP_013654729.1|4312816_4313464_-	regulatory protein GemA	NA	M4STB3	Rhodobacter_phage	43.9	1.4e-32
WP_013654731.1|4313759_4314110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654732.1|4314109_4314763_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	64.7	1.2e-73
WP_013654733.1|4314764_4315166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654734.1|4315162_4315423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654735.1|4315412_4315799_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013654736.1|4315795_4316428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654737.1|4316427_4317192_-	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	42.9	5.9e-43
WP_013654738.1|4317271_4319464_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	40.0	9.1e-121
WP_013654739.1|4319460_4319925_-	hypothetical protein	NA	G8GWB9	Rhodobacter_phage	55.9	6.5e-37
WP_013654740.1|4319928_4320792_-	ParB N-terminal domain-containing protein	NA	G8GWB8	Rhodobacter_phage	32.4	6.9e-16
WP_148259356.1|4320968_4321304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654741.1|4321509_4321743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375662.1|4321841_4322141_-	helix-turn-helix domain-containing protein	NA	G8GWB2	Rhodobacter_phage	44.4	7.4e-10
WP_013654743.1|4322289_4322814_+	helix-turn-helix transcriptional regulator	NA	A0A219VHC1	Ochrobactrum_phage	43.7	1.8e-30
WP_013654744.1|4323714_4325712_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.3	9.9e-82
WP_013654745.1|4325713_4326676_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013654746.1|4326792_4327353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654747.1|4327595_4327829_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_013654748.1|4327907_4329857_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.8	1.4e-104
WP_041375664.1|4330716_4331661_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_013654750.1|4331641_4333849_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_013654751.1|4333860_4334331_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_013654752.1|4334369_4334744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083812136.1|4334924_4336274_-	ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_013654754.1|4336266_4336584_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_013654755.1|4336729_4337389_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013654756.1|4337385_4338744_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_013654757.1|4338922_4339180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654758.1|4339176_4339851_-	DUF882 domain-containing protein	NA	A0A0K1LLY2	Rhodobacter_phage	47.2	4.0e-43
WP_013654759.1|4339919_4340210_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	50.6	1.3e-14
WP_013654760.1|4340233_4341514_-	hypothetical protein	NA	V5XVY2	Staphylococcus_phage	33.1	6.0e-16
WP_013654761.1|4341513_4345026_-|tail	phage tail protein	tail	Q5DN19	Alphaproteobacteria_virus	41.0	5.0e-214
WP_013654762.1|4345032_4345482_-	C40 family peptidase	NA	Q5DN20	Alphaproteobacteria_virus	45.9	8.0e-24
WP_013654763.1|4345471_4347052_-	DUF2163 domain-containing protein	NA	Q5DN21	Alphaproteobacteria_virus	36.4	6.6e-89
4345801:4345819	attR	CGGTGACGATCCCGGCCCG	NA	NA	NA	NA
WP_013654764.1|4347048_4347651_-	DUF2460 domain-containing protein	NA	A0A1W6DWM9	Sphingobium_phage	47.7	6.2e-48
WP_041375665.1|4347662_4350167_-	potassium ABC transporter ATPase	NA	A0A1J0GUY9	Halomonas_phage	39.6	5.6e-26
WP_013654766.1|4350159_4350345_-	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	56.0	2.0e-05
WP_013654767.1|4350389_4350839_-	hypothetical protein	NA	G8DH52	Emiliania_huxleyi_virus	39.4	4.9e-13
WP_013654768.1|4350849_4352121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654769.1|4352143_4352578_-	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	43.4	8.3e-26
WP_013654770.1|4352672_4353320_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	45.0	5.9e-36
WP_013654771.1|4353316_4353631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654772.1|4353633_4354656_-|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	56.6	1.2e-104
WP_013654773.1|4354750_4355140_-|head	head decoration protein	head	NA	NA	NA	NA
WP_013654774.1|4355157_4356477_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.7	1.0e-66
WP_041375666.1|4356484_4357960_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	74.7	2.3e-197
WP_041375667.1|4357963_4358176_-	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	48.6	1.1e-07
WP_041375668.1|4358180_4360157_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	48.1	7.3e-154
WP_013654777.1|4360071_4360641_-|terminase	terminase small subunit, Nu1	terminase	A0A2K9V2Q9	Faecalibacterium_phage	34.0	4.4e-11
WP_013654778.1|4360788_4361010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013654779.1|4361112_4361658_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	39.5	4.4e-16
WP_013654780.1|4361662_4361908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041375669.1|4361960_4362182_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	63.8	1.5e-15
WP_041375670.1|4362178_4363501_-	ParB N-terminal domain-containing protein	NA	K4HZA5	Acidithiobacillus_phage	38.4	2.8e-72
WP_013654783.1|4363895_4364336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654784.1|4364328_4364529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654785.1|4364525_4364783_-	hypothetical protein	NA	Q1A063	Mycobacterium_phage	38.0	5.1e-07
WP_148259494.1|4364779_4365277_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	62.4	5.5e-50
WP_013654787.1|4365426_4368354_-	toprim domain-containing protein	NA	A0A1B0V000	Roseobacter_phage	33.8	4.7e-72
WP_013654788.1|4368346_4369627_-	AAA family ATPase	NA	A0A0F6SJ43	Sinorhizobium_phage	40.4	1.0e-71
WP_013654789.1|4369623_4370394_-|tRNA	isoleucyl-tRNA synthetase	tRNA	K4HZA0	Acidithiobacillus_phage	50.0	2.0e-59
WP_013654790.1|4370402_4370666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654791.1|4370758_4370986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654792.1|4370991_4371735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654793.1|4371741_4372575_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	49.6	1.3e-67
WP_013654794.1|4372574_4372874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654795.1|4372870_4373365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654796.1|4373364_4373706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041375671.1|4373740_4374322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654798.1|4374445_4375381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654799.1|4375340_4375940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650723.1|4376092_4376863_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	43.0	1.9e-41
WP_013650724.1|4376859_4378356_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013654800.1|4378870_4380133_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_041375673.1|4380129_4380900_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.1	4.7e-48
WP_013654802.1|4381189_4382098_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013654803.1|4382370_4383027_-	OmpW family protein	NA	NA	NA	NA	NA
WP_013654804.1|4383125_4384331_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013654805.1|4384431_4385337_-	VOC family protein	NA	NA	NA	NA	NA
WP_013654806.1|4385373_4385970_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_013654807.1|4385966_4386962_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_013654809.1|4388150_4388474_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_013654810.1|4388668_4389874_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	3.3e-96
WP_013654812.1|4392077_4392977_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_013654813.1|4392973_4394206_-	CoA transferase	NA	NA	NA	NA	NA
WP_013654814.1|4394261_4396616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041376357.1|4396637_4397297_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_013654816.1|4397305_4398001_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013654817.1|4398030_4399977_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_041375674.1|4400067_4401054_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_041375675.1|4401262_4402624_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	S4S2K9	Puniceispirillum_phage	40.7	1.8e-05
WP_013654821.1|4402709_4403267_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_083812138.1|4403278_4403584_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_013654823.1|4403616_4404450_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.1	5.0e-11
WP_041375676.1|4404605_4406057_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013654825.1|4406238_4407483_+	cytochrome P450	NA	NA	NA	NA	NA
WP_013654826.1|4407597_4408455_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013654827.1|4408507_4409032_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013654828.1|4409392_4409716_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_013654829.1|4409766_4410825_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_013654830.1|4410896_4411892_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_013654831.1|4411888_4412485_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_013654832.1|4412518_4413424_+	VOC family protein	NA	NA	NA	NA	NA
WP_013654833.1|4413493_4414699_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041375678.1|4414761_4415418_+	OmpW family protein	NA	NA	NA	NA	NA
WP_013654835.1|4415476_4416076_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_013650727.1|4416723_4417140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013650726.1|4417139_4417493_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	37.3	8.2e-08
WP_013654839.1|4417562_4419128_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.8	2.8e-84
WP_013654841.1|4419783_4419999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083812139.1|4420002_4423095_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	53.9	8.7e-178
WP_013654843.1|4423042_4423654_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	40.5	1.7e-24
WP_049792625.1|4423739_4424069_+	hypothetical protein	NA	A0A0K0PVN5	Roseobacter_phage	51.5	1.4e-12
WP_013654845.1|4424164_4424752_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	33.0	6.4e-13
WP_013654846.1|4424761_4425031_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	64.4	3.1e-15
WP_013654847.1|4425027_4426017_-	DNA cytosine methyltransferase	NA	D2XJU8	Escherichia_phage	49.7	1.5e-75
WP_013654848.1|4426016_4427336_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	39.1	2.7e-75
WP_041376315.1|4427652_4427853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654492.1|4427858_4428287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654491.1|4428283_4428811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013654490.1|4428807_4432299_-	toprim domain-containing protein	NA	A0A1B0VML8	Pseudomonas_phage	48.8	4.8e-31
