The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	331487	339860	5355490		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625677.1|331487_332795_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	4.9e-21
WP_001170542.1|332883_333603_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278826.1|333595_333850_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666779.1|333846_334530_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055576.1|334513_336733_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879024.1|336717_338133_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262432.1|338235_339276_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	7.2e-68
WP_000088582.1|339272_339860_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	5.9e-27
>prophage 2
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	360231	468055	5355490	tRNA,tail,terminase,protease,transposase,portal,integrase,head,capsid	Bacillus_phage(59.65%)	112	394067:394083	444897:444913
WP_001133494.1|360231_361422_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	37.9	1.1e-30
WP_001254394.1|362137_362374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086999.1|362515_362806_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051445.1|362821_364279_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047674.1|364293_365721_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977677.1|366342_367248_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.1	2.8e-28
WP_103557176.1|367505_367769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991108.1|367790_369089_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	7.9e-40
WP_000416643.1|369357_370104_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000890595.1|370183_371623_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_000225165.1|371739_373107_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_000358102.1|373099_374551_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263255.1|374598_374922_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001020656.1|376010_377240_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014481551.1|377687_379067_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000695082.1|379063_380149_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_000243160.1|380162_381257_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_080559611.1|381219_382002_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_000923699.1|382002_383367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481552.1|383380_384361_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_000705618.1|384372_385662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000794852.1|385698_386964_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007360.1|388031_389261_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001233742.1|389377_390460_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001200502.1|390633_391830_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_142285828.1|392233_393634_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.5	1.7e-117
WP_000679461.1|393692_394817_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	97.9	3.7e-211
394067:394083	attL	AAATTAAGCGTTTAGAA	NA	NA	NA	NA
WP_001043967.1|395074_395536_+	DUF4429 domain-containing protein	NA	A0A1S5S992	Streptococcus_phage	46.4	1.1e-17
WP_014481553.1|395663_396008_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	45.5	5.4e-20
WP_000609384.1|396498_397698_+	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	38.0	1.6e-63
WP_000427703.1|398194_398557_-	helix-turn-helix domain-containing protein	NA	A0A0A7AR52	Bacillus_phage	43.9	1.0e-21
WP_000163953.1|398725_398929_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	61.2	6.8e-15
WP_001072906.1|398995_399727_+	Rha family transcriptional regulator	NA	A0A1B1P7T7	Bacillus_phage	91.8	2.6e-125
WP_000798612.1|399771_400122_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	80.2	3.0e-50
WP_001151929.1|400496_401381_+	hypothetical protein	NA	A0A0U3TZZ4	Bacillus_phage	96.3	1.9e-146
WP_001171105.1|401395_402310_+	AAA family ATPase	NA	A0A0U3U1U1	Bacillus_phage	98.4	8.3e-169
WP_000332460.1|402322_402517_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	85.9	6.9e-25
WP_000799084.1|402532_402811_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.2	1.1e-12
WP_001125951.1|402803_403163_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	3.7e-32
WP_000717826.1|403182_403350_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_000109485.1|403375_403627_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	51.3	1.2e-16
WP_001024287.1|403646_404129_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	2.0e-20
WP_049800266.1|405037_405265_+	hypothetical protein	NA	A0A2H4J3B9	uncultured_Caudovirales_phage	57.1	5.8e-15
WP_000060527.1|405307_405607_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	97.0	9.9e-47
WP_000275021.1|405655_405841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481556.1|405861_406056_+	hypothetical protein	NA	B0YL92	Streptococcus_virus	43.4	9.4e-06
WP_000234109.1|406092_406275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937293.1|406564_406894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645582.1|406911_407034_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000579651.1|407061_407253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166202.1|407560_408043_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	3.4e-73
WP_001012162.1|408042_408585_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	2.9e-89
WP_000778981.1|409321_409540_+	hypothetical protein	NA	D2XR60	Bacillus_phage	94.4	3.3e-31
WP_001014577.1|409546_409819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041184167.1|409814_410150_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	92.8	9.4e-54
WP_000301141.1|410273_410585_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	98.1	1.2e-47
WP_000621033.1|410581_412249_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	93.3	3.7e-311
WP_041184063.1|412257_413403_+|portal	phage portal protein	portal	D2XR16	Bacillus_phage	85.9	8.5e-179
WP_014481558.1|413402_414146_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	91.1	6.2e-122
WP_000234876.1|414149_415304_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	91.9	1.2e-201
WP_000361979.1|415309_415603_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	86.6	1.6e-41
WP_001247281.1|415604_415958_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	97.4	7.9e-59
WP_014481559.1|415959_416289_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	87.9	4.9e-47
WP_000172096.1|416288_416618_+	hypothetical protein	NA	D2XR22	Bacillus_phage	93.6	1.3e-52
WP_001114732.1|416618_417212_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	86.7	1.4e-95
WP_000415934.1|417218_417575_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	2.0e-41
WP_000918780.1|417805_421441_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.1	2.2e-188
WP_000094110.1|421482_422964_+|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	81.9	1.3e-251
WP_001260147.1|422960_426971_+	hypothetical protein	NA	A0A0U3SD62	Bacillus_phage	81.7	0.0e+00
WP_001051333.1|426993_427443_+	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	98.7	7.1e-81
WP_000398745.1|427537_427774_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	1.5e-18
WP_000253959.1|427773_428013_+	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	100.0	1.0e-33
WP_000750675.1|428009_429074_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	95.2	1.2e-198
WP_000599666.1|429341_429587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383883.1|429588_430437_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	38.6	1.6e-20
WP_000277081.1|430563_431055_-	hypothetical protein	NA	Q3HL01	Bacillus_phage	82.2	1.2e-65
WP_001237238.1|431047_431260_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	100.0	2.7e-30
WP_001267628.1|431443_431746_+	hypothetical protein	NA	Q2I8E3	Bacillus_phage	97.0	9.7e-50
WP_000170773.1|431748_431931_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	91.7	2.7e-23
WP_000891518.1|432046_433228_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.7	7.1e-189
WP_001025809.1|433169_433793_+	hypothetical protein	NA	H0USY2	Bacillus_phage	84.4	9.5e-100
WP_000566717.1|434104_435094_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_000910759.1|435610_438391_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000642322.1|438423_440064_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_000890307.1|440118_440748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426649.1|441218_442478_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_000146519.1|443917_444934_+	hypothetical protein	NA	NA	NA	NA	NA
444897:444913	attR	AAATTAAGCGTTTAGAA	NA	NA	NA	NA
WP_103557153.1|445183_445369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251709.1|445423_445942_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	37.7	1.7e-22
WP_000233730.1|446037_446745_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_130983690.1|446822_447062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217525.1|446946_447642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704466.1|447656_448766_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.3	1.1e-18
WP_000972829.1|448858_450130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000711543.1|450118_451540_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_000853515.1|451833_452949_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001005640.1|453122_453731_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000501505.1|453734_454481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000599492.1|454521_456048_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	9.1e-19
WP_000924422.1|456062_456626_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_000033262.1|457214_458444_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_000392483.1|458456_459500_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000926547.1|459554_460196_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000613094.1|460236_461244_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000823049.1|461240_462281_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000732578.1|462329_463247_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142285829.1|463348_463555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078280.1|463579_464629_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	28.1	1.2e-17
WP_000834377.1|464872_465187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482304.1|465578_466028_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_000235479.1|466218_466587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608412.1|466936_468055_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.1	8.9e-173
>prophage 3
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	1118968	1157384	5355490	tail,terminase,portal,integrase,head	Bacillus_phage(97.83%)	47	1118900:1118921	1157563:1157584
1118900:1118921	attL	ATAATCGTTCGTTCTATAAACC	NA	NA	NA	NA
WP_000135928.1|1118968_1120126_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	100.0	2.2e-222
WP_000253952.1|1120203_1120629_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	100.0	2.4e-78
WP_000206355.1|1120644_1121067_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	100.0	4.8e-71
WP_000432047.1|1121340_1121526_+	transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	100.0	7.0e-27
WP_000741687.1|1121525_1121798_+	DUF771 domain-containing protein	NA	A0A0M3ULF5	Bacillus_phage	100.0	7.7e-46
WP_000132029.1|1121811_1122648_+	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	100.0	1.4e-151
WP_001030777.1|1122678_1122969_+	hypothetical protein	NA	A0A0M4R5H4	Bacillus_phage	100.0	5.1e-48
WP_000128055.1|1122961_1123234_-	hypothetical protein	NA	M9Q2L4	Clostridium_phage	56.8	3.5e-22
WP_000394585.1|1123691_1123916_-	hypothetical protein	NA	A0A0M4QX50	Bacillus_phage	100.0	1.3e-35
WP_001140299.1|1124298_1124523_+	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	98.6	2.1e-33
WP_001082031.1|1124947_1125637_+	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	100.0	3.5e-111
WP_001103731.1|1125636_1125816_+	hypothetical protein	NA	A0A0M4R389	Bacillus_phage	100.0	4.4e-26
WP_000849735.1|1125812_1126082_+	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	100.0	1.3e-45
WP_103557158.1|1126740_1127670_+	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	100.0	3.7e-132
WP_000654817.1|1127712_1127895_+	hypothetical protein	NA	A0A0M4RD83	Bacillus_phage	100.0	3.4e-26
WP_001214029.1|1128674_1129139_+	hypothetical protein	NA	A0A0M3ULE9	Bacillus_phage	100.0	1.3e-90
WP_000841930.1|1129175_1129688_+	hypothetical protein	NA	A0A0M4R373	Bacillus_phage	100.0	3.4e-95
WP_000980003.1|1129761_1129941_+	hypothetical protein	NA	A0A0M5M1S4	Bacillus_phage	100.0	1.4e-27
WP_041184080.1|1130056_1130263_-	hypothetical protein	NA	Q3HKS8	Bacillus_phage	91.0	6.7e-26
WP_000065133.1|1130326_1130833_+	hypothetical protein	NA	A0A0M4RU27	Bacillus_phage	100.0	1.5e-95
WP_000060544.1|1131180_1131480_+	hypothetical protein	NA	A0A0M4REQ3	Bacillus_phage	100.0	3.3e-50
WP_000254430.1|1132516_1132843_+	hypothetical protein	NA	A0A0M5M1L2	Bacillus_phage	100.0	4.0e-57
WP_000884300.1|1132869_1133253_+	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	100.0	1.1e-66
WP_000687862.1|1133313_1133646_+	hypothetical protein	NA	A0A0M3ULL9	Bacillus_phage	100.0	4.6e-53
WP_000779244.1|1134348_1134789_+|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	100.0	3.6e-77
WP_041184176.1|1134781_1136080_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	100.0	5.0e-260
WP_000122855.1|1136091_1136283_+	hypothetical protein	NA	A0A0M4R5E6	Bacillus_phage	100.0	5.0e-28
WP_000888995.1|1136308_1137652_+|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	100.0	4.1e-257
WP_000207427.1|1137638_1138664_+|head	head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	99.4	1.0e-183
WP_000445856.1|1138909_1139104_+	hypothetical protein	NA	A0A0M4QX57	Bacillus_phage	100.0	9.0e-25
WP_000777389.1|1139090_1139327_+	hypothetical protein	NA	A0A0M5M1L7	Bacillus_phage	100.0	4.8e-36
WP_080559637.1|1139375_1140161_-	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	99.5	2.0e-102
WP_000846754.1|1140466_1141042_+	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	100.0	1.2e-56
WP_001121184.1|1141054_1141876_+	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	100.0	8.3e-152
WP_000633425.1|1141912_1142251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001257746.1|1142232_1142586_+	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	100.0	7.9e-59
WP_000010071.1|1142575_1142992_+	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	100.0	2.5e-72
WP_000566227.1|1142988_1143369_+	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	100.0	8.4e-67
WP_000741680.1|1143389_1144022_+	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	99.4	1.0e-96
WP_001018902.1|1144085_1144478_+	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	100.0	4.8e-65
WP_041184081.1|1144513_1144774_+	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	100.0	8.4e-42
WP_000128191.1|1148041_1149556_+|tail	phage tail protein	tail	A0A0M5M1L8	Bacillus_phage	100.0	1.2e-302
WP_001181676.1|1149559_1154215_+	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	100.0	0.0e+00
WP_001027046.1|1154232_1154697_+	hypothetical protein	NA	A0A0M4R5G6	Bacillus_phage	100.0	1.5e-81
WP_000868797.1|1156037_1156604_+	GNAT family N-acetyltransferase	NA	A0A0M3ULL7	Bacillus_phage	100.0	2.9e-103
WP_000650688.1|1156708_1157005_-	hypothetical protein	NA	A0A0M4R382	Bacillus_phage	100.0	4.4e-47
WP_000018833.1|1157165_1157384_+	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	62.5	8.6e-16
1157563:1157584	attR	ATAATCGTTCGTTCTATAAACC	NA	NA	NA	NA
>prophage 4
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	2007625	2018827	5355490		Bacillus_phage(57.14%)	11	NA	NA
WP_000755517.1|2007625_2008906_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	31.5	4.5e-11
WP_001194311.1|2009003_2009768_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453860.1|2010007_2011768_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.3	3.6e-269
WP_000937022.1|2011856_2012534_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	94.2	1.5e-119
WP_041184204.1|2012548_2013601_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.5	6.8e-167
WP_000398541.1|2013718_2015131_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.6	7.9e-09
WP_000793097.1|2015131_2015845_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.5	2.2e-36
WP_000722263.1|2016043_2016394_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000830527.1|2016416_2017148_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_000590584.1|2017160_2017913_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000116407.1|2017909_2018827_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.5	1.1e-43
>prophage 5
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	2725377	2732616	5355490		Geobacillus_phage(33.33%)	10	NA	NA
WP_000124898.1|2725377_2726571_-	glycosyl transferase family 1	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	26.2	5.3e-06
WP_000373590.1|2726626_2727304_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	41.0	5.8e-34
WP_000720549.1|2727336_2727855_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.9	1.4e-43
WP_001204722.1|2727851_2728781_-	phosphotransferase	NA	NA	NA	NA	NA
WP_001093436.1|2728806_2729193_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655487.1|2729258_2729966_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	26.2	5.1e-17
WP_000648514.1|2729987_2730341_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288942.1|2730354_2730762_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714652.1|2731015_2732401_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.9	1.0e-77
WP_000820164.1|2732403_2732616_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	1.9e-12
>prophage 6
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	4245213	4311213	5355490	tRNA,coat,transposase,protease	Klosneuvirus(20.0%)	58	NA	NA
WP_000690779.1|4245213_4248096_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_000025313.1|4248321_4249428_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092219.1|4249458_4250292_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138512.1|4250311_4251841_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973786.1|4251993_4253136_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.2	7.7e-31
WP_000812272.1|4253135_4253678_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510690.1|4253763_4254411_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621702.1|4254474_4255326_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026326.1|4255423_4257337_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001011375.1|4257386_4259309_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114530.1|4259283_4260060_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.6e-19
WP_000864966.1|4260153_4261236_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276721.1|4261225_4261933_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497125.1|4262072_4263359_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|4263358_4263907_-	sporulation protein	NA	NA	NA	NA	NA
WP_000270908.1|4264620_4264929_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855420.1|4265098_4266487_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599051.1|4266554_4267415_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797468.1|4267407_4268154_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503311.1|4268287_4269085_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|4269087_4269774_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975746.1|4269809_4270355_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135481.1|4270369_4271221_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|4271262_4272282_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001013383.1|4272439_4273117_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000720488.1|4273163_4273739_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360981.1|4273960_4274923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582083.1|4275084_4276389_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072255.1|4276482_4279128_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.6	1.0e-163
WP_000367002.1|4279521_4280547_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_000179737.1|4280609_4281587_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712926.1|4281695_4282985_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087057.1|4282984_4283974_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000992367.1|4283994_4284747_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226412.1|4284749_4285679_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000008996.1|4285694_4286528_-	cytochrome c assembly protein	NA	NA	NA	NA	NA
WP_000547873.1|4286545_4287880_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133919.1|4288296_4288752_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001236357.1|4288854_4290114_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.7	1.7e-84
WP_000359782.1|4290481_4290898_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869113.1|4290930_4291527_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097297.1|4291523_4293854_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	1.7e-178
WP_014481760.1|4294036_4295707_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	7.4e-14
WP_000472282.1|4295813_4297073_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.1	1.3e-148
WP_000729258.1|4297337_4298615_-	trigger factor	NA	NA	NA	NA	NA
WP_000358267.1|4298924_4299923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001983650.1|4300120_4300369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937860.1|4300564_4300747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124461.1|4300840_4301041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645509.1|4302132_4302636_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000815935.1|4302649_4303258_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.4	2.0e-14
WP_001261765.1|4303269_4304007_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_001126737.1|4304135_4305185_-	spore germination protein GerM	NA	NA	NA	NA	NA
WP_000773996.1|4305316_4306126_-	glutamate racemase	NA	NA	NA	NA	NA
WP_000513870.1|4306337_4307663_-	MFS transporter	NA	NA	NA	NA	NA
WP_000728512.1|4308023_4308707_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001233020.1|4308756_4309395_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000101450.1|4309857_4311213_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	32.6	5.9e-46
>prophage 7
NC_017200	Bacillus thuringiensis serovar finitimus YBT-020, complete sequence	5355490	4698669	4789667	5355490	tRNA,tail,terminase,protease,transposase,portal,holin,integrase,coat,head,capsid	Bacillus_phage(64.81%)	102	4693246:4693269	4780777:4780800
4693246:4693269	attL	TTTTGTCGGTAAGTCGATATATTT	NA	NA	NA	NA
WP_000287154.1|4698669_4700046_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140611.1|4700086_4700470_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810315.1|4700565_4701309_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252165.1|4701359_4701953_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_041184259.1|4701994_4702882_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.4	2.2e-78
WP_001104182.1|4702989_4704714_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	5.7e-179
WP_001158738.1|4704857_4705463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469183.1|4705544_4707029_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	8.7e-59
WP_014481775.1|4707155_4707782_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	44.9	7.3e-15
WP_000027014.1|4707868_4708186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415311.1|4708182_4708689_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014481776.1|4708812_4710021_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829779.1|4710483_4711473_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000749093.1|4711591_4722295_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000662576.1|4722740_4723217_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391922.1|4723548_4724796_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535268.1|4724806_4725694_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635472.1|4725773_4726235_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710530.1|4726557_4727385_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|4727394_4728015_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891535.1|4727956_4729138_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000170777.1|4729253_4729436_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|4729432_4729750_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|4729932_4730130_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|4730133_4730313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043398.1|4730318_4730897_+	hypothetical protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_000119482.1|4730950_4731289_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	93.8	2.7e-48
WP_000542505.1|4731679_4732498_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	88.6	4.7e-147
WP_000439565.1|4732497_4732923_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	9.1e-70
WP_001243322.1|4732972_4734241_-	DUF2479 domain-containing protein	NA	A0A1B0T696	Bacillus_phage	91.5	3.5e-218
WP_000631946.1|4734255_4736598_-	endopeptidase	NA	A0A1B0T695	Bacillus_phage	96.2	0.0e+00
WP_000884120.1|4736594_4737278_-	hypothetical protein	NA	A0A1B0T6A0	Bacillus_phage	96.5	1.3e-126
WP_001119326.1|4737278_4740803_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	92.8	0.0e+00
WP_000789911.1|4740819_4741050_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	96.8	1.7e-30
WP_000113340.1|4741046_4741433_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_000215488.1|4741444_4742080_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	98.1	6.3e-115
WP_000157915.1|4742091_4742469_-	hypothetical protein	NA	A0A1B1P7P3	Bacillus_phage	98.4	8.7e-64
WP_001167234.1|4742468_4742798_-	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	96.3	7.6e-56
WP_000824249.1|4742787_4743117_-	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	97.2	1.6e-53
WP_000342230.1|4743097_4743358_-	hypothetical protein	NA	A0A1B1P7M9	Bacillus_phage	97.7	9.3e-41
WP_001041462.1|4743359_4744727_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	71.7	2.7e-147
WP_001140504.1|4744727_4745306_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	80.2	8.0e-85
WP_000524251.1|4745274_4746480_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	91.5	4.0e-211
WP_000587520.1|4746495_4748220_-|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	93.0	0.0e+00
WP_000113450.1|4748216_4748642_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	96.5	8.3e-71
WP_000872562.1|4748724_4749117_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	87.7	2.4e-64
WP_000627439.1|4749113_4749428_-	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	5.2e-46
WP_000074276.1|4749424_4749643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052394.1|4749689_4749887_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	86.2	2.7e-24
WP_000930966.1|4749944_4750169_-	hypothetical protein	NA	H0USV5	Bacillus_phage	93.2	6.1e-33
WP_000895342.1|4750453_4750843_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	60.5	2.9e-38
WP_001284975.1|4750860_4750983_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847112.1|4751126_4751312_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	51.6	5.1e-09
WP_000826294.1|4751347_4751557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159774.1|4751773_4752520_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFZ8	Bacillus_phage	72.2	6.5e-95
WP_000002744.1|4752516_4752741_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	74.0	2.3e-24
WP_000532220.1|4752740_4753622_-	DNA replication protein	NA	A0A0S2SXI8	Bacillus_phage	33.6	5.2e-27
WP_000040039.1|4753633_4754407_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	46.6	1.4e-52
WP_000425248.1|4754540_4755422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372559.1|4755445_4756117_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	65.6	9.6e-82
WP_000277641.1|4756326_4756515_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	5.9e-21
WP_000379206.1|4756659_4756905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004989.1|4757152_4757482_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_080559766.1|4757884_4759051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896931.1|4759182_4759413_-	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_000237487.1|4760375_4761437_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000833158.1|4761524_4761878_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.7	3.8e-13
WP_000573827.1|4762105_4762459_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.2	1.3e-16
WP_000077379.1|4762500_4763367_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4763611_4763851_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682081.1|4764202_4765273_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001103328.1|4765503_4765677_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470284.1|4765731_4766391_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.7e-22
WP_000679263.1|4766374_4767172_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|4767270_4767612_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_000101446.1|4767963_4769319_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	32.7	7.7e-46
WP_142285831.1|4769750_4770548_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000714503.1|4770846_4772505_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_002028779.1|4772591_4773062_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_041184260.1|4773048_4773687_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_001046063.1|4773736_4774405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379274.1|4774518_4775196_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014481777.1|4775294_4776089_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248594.1|4776140_4776449_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4776655_4776892_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001137787.1|4777086_4777302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581272.1|4777363_4778365_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4778485_4778977_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351159.1|4779000_4779480_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000683455.1|4780090_4780672_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000276467.1|4780895_4781660_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
4780777:4780800	attR	AAATATATCGACTTACCGACAAAA	NA	NA	NA	NA
WP_000503352.1|4781769_4782402_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274015.1|4782473_4782914_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|4783061_4784033_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392606.1|4784050_4784317_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_041184153.1|4784345_4784558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469431.1|4784707_4786264_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	35.5	1.0e-81
WP_001174578.1|4786466_4786964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435941.1|4787000_4787303_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744209.1|4787421_4787997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241004.1|4788034_4788766_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002163480.1|4788851_4789667_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	0	56995	187880	transposase	Streptococcus_phage(27.27%)	51	NA	NA
WP_001123513.1|1080_1386_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000648301.1|1509_1791_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.4	2.0e-09
WP_000448512.1|1812_2046_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000283268.1|2297_2495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118548.1|2621_3215_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000448095.1|3505_3838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001011748.1|7828_8344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156170.1|8464_9196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142392476.1|13086_13986_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	27.6	8.0e-23
WP_014481811.1|14078_14342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000075684.1|14669_15134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053961.1|15327_16764_+|transposase	IS4-like element IS231D family transposase	transposase	NA	NA	NA	NA
WP_080559829.1|16907_17213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142285818.1|17466_18765_+	pesticidial crystal protein cry4BA	NA	NA	NA	NA	NA
WP_000425850.1|18884_20705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540304.1|21444_22131_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	57.8	6.6e-70
WP_080559835.1|22207_22531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000959240.1|22708_22930_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_001267178.1|23112_23367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136649.1|23568_24648_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	39.1	1.4e-18
WP_014481814.1|24653_25055_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	72.0	1.8e-51
WP_000007313.1|25187_25400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613337.1|25451_26051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041184281.1|26666_27182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462739.1|27183_27657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000959160.1|27757_28114_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	56.8	1.5e-28
WP_000146616.1|28158_28689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000933614.1|28833_29094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024603.1|29217_29628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000702366.1|29624_29945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049800274.1|30113_30599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481815.1|30690_31212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000865080.1|31293_31776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713434.1|32107_32491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080559830.1|32642_32825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540344.1|32817_33057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000873731.1|33347_33593_-	helix-turn-helix domain-containing protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	44.6	4.2e-11
WP_000087398.1|34688_34883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961794.1|34976_35318_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001103070.1|35624_36113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041184283.1|36143_36416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000251917.1|36920_37892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615509.1|38272_39127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528971.1|39989_40697_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_001084998.1|41249_41933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103557188.1|44456_45734_+	pesticidial crystal protein cry4BA	NA	NA	NA	NA	NA
WP_000528971.1|49954_50662_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_000397533.1|50807_51284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287580.1|51544_53704_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.1	6.5e-79
WP_002042246.1|53807_55091_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_041184274.1|55369_56995_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.2	2.0e-48
>prophage 2
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	60400	64436	187880		Bacillus_phage(100.0%)	3	NA	NA
WP_000465312.1|60400_62692_-	DNA translocase FtsK	NA	A0A0A0RUH6	Bacillus_phage	30.8	2.4e-84
WP_002042241.1|62712_63795_-	hypothetical protein	NA	L0LAE4	Bacillus_phage	34.6	6.0e-41
WP_000889471.1|63809_64436_-	hypothetical protein	NA	A0A076GD93	Bacillus_phage	28.8	1.1e-07
>prophage 3
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	99272	100484	187880		Streptococcus_phage(100.0%)	1	NA	NA
WP_001271977.1|99272_100484_-	lytic transglycosylase	NA	A0A1S5SEZ8	Streptococcus_phage	43.2	1.3e-63
>prophage 4
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	103985	106526	187880		Streptococcus_phage(100.0%)	1	NA	NA
WP_001077387.1|103985_106526_-	DUF87 domain-containing protein	NA	A0A1S5SF64	Streptococcus_phage	36.6	3.1e-141
>prophage 5
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	123868	125167	187880		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000991108.1|123868_125167_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	7.9e-40
>prophage 6
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	128635	171025	187880	transposase,integrase,protease	Bacillus_phage(58.33%)	32	157176:157198	177747:177761
WP_000824161.1|128635_129070_+	sporulation protein	NA	F8WPS9	Bacillus_phage	51.8	1.1e-33
WP_000397989.1|129107_129755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000179055.1|130080_131682_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000849064.1|131791_132466_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000550858.1|132517_132865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140157814.1|133836_134769_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000323592.1|134833_135403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103557187.1|135392_136283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084248.1|136360_136630_-	hypothetical protein	NA	A0A1J0MFM9	Staphylococcus_phage	49.4	1.7e-13
WP_000721102.1|136959_137775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041184293.1|139126_139702_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.4	5.8e-43
WP_001227387.1|139748_140423_+	hypothetical protein	NA	A0A0S2MVD6	Bacillus_phage	54.8	4.5e-63
WP_000480927.1|140471_140873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000870874.1|141572_141809_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	73.7	6.5e-25
WP_014481828.1|141957_142290_+	hypothetical protein	NA	O48480	Bacillus_phage	44.7	2.3e-07
WP_001140313.1|142418_142772_+	hypothetical protein	NA	W8EK86	Geobacillus_phage	63.2	1.6e-35
WP_000668758.1|142785_143139_+	hypothetical protein	NA	I1TLH2	Bacillus_phage	60.3	1.5e-30
WP_000343751.1|143140_145684_+	hypothetical protein	NA	W8EEX6	Geobacillus_phage	60.2	5.3e-298
WP_000658308.1|145969_146227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041184294.1|146317_146557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041184295.1|146591_147095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627840.1|148261_149644_+	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_000925010.1|152262_152514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671232.1|153646_154603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410109.1|155665_156373_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.5	5.3e-46
WP_000079466.1|156441_157077_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
157176:157198	attL	GGTTCTGTTGCAAAGTTTGAAAA	NA	NA	NA	NA
WP_080559833.1|157697_158102_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
157176:157198	attL	GGTTCTGTTGCAAAGTTTGAAAA	NA	NA	NA	NA
WP_000189805.1|158745_159741_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000360928.1|160143_161316_+|integrase	site-specific integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.2	2.7e-07
WP_000357586.1|161843_165230_+	hypothetical protein	NA	NA	NA	NA	NA
161527:161549	attR	TTTTCAAACTTTGCAACAGAACC	NA	NA	NA	NA
WP_000813293.1|167221_170173_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
161527:161549	attR	TTTTCAAACTTTGCAACAGAACC	NA	NA	NA	NA
WP_000747907.1|170182_171025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	32.4	8.2e-38
177747:177761	attR	CTTCTTCTAAAACAG	NA	NA	NA	NA
>prophage 7
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	178441	180205	187880		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001214612.1|178441_180205_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	2.7e-38
>prophage 8
NC_017201	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence	187880	183266	186964	187880	transposase	Aeromonas_phage(50.0%)	2	NA	NA
WP_000668448.1|183266_183809_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	43.9	2.8e-31
WP_001093350.1|183889_186964_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.5	2.3e-45
>prophage 1
NC_017199	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB28, complete sequence	139013	61466	69992	139013		Bacillus_phage(42.86%)	12	NA	NA
WP_041184305.1|61466_61721_+	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	61.7	8.5e-23
WP_000425549.1|61889_62144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140301.1|62177_62717_+	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.5	5.9e-74
WP_001288244.1|62760_62976_+	hypothetical protein	NA	A0A0A7AQI6	Bacillus_phage	77.5	8.5e-24
WP_001092155.1|63605_63833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391263.1|63973_64423_+	hypothetical protein	NA	A0A0A7AQW7	Bacillus_phage	67.3	4.1e-52
WP_000729150.1|64648_65020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481524.1|65646_66519_+	DNA cytosine methyltransferase	NA	A0A141E1L1	Streptococcus_phage	58.8	1.2e-89
WP_014481525.1|66478_66838_+	DNA methyltransferase	NA	A0A1S5SFL7	Streptococcus_phage	62.0	9.8e-33
WP_000533756.1|66957_67848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103557176.1|68408_68672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991108.1|68693_69992_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	7.9e-40
>prophage 2
NC_017199	Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB28, complete sequence	139013	88186	104007	139013	integrase,transposase	Streptococcus_phage(33.33%)	12	102235:102294	105312:105505
WP_000528971.1|88186_88894_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_000583546.1|89254_89818_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	41.2	7.7e-32
WP_000254350.1|89899_92113_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_001106361.1|92172_93063_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	29.4	3.1e-19
WP_103557191.1|95882_96797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000982046.1|96913_97705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394382.1|98069_99512_+	spore germination protein	NA	NA	NA	NA	NA
WP_001081194.1|99504_100608_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_000623948.1|100604_101735_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_001268479.1|101833_102475_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.9	3.2e-66
102235:102294	attL	GGCTCCTGCCCTACTTTGTGCGTTCAAAAAATTGAAACATAACGATTTTTATGTCCATAC	NA	NA	NA	NA
WP_087963586.1|103308_103521_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.6	4.9e-08
WP_014481534.1|103524_104007_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	28.8	2.1e-06
105312:105505	attR	GTATGGACATAAAAATCGTTATGTTTCAATTTTTTGAACGCACAAAGTAGGGCAGGAGCCCATGCCCATCAACTTAAGAACGGGAATAAAATAAATTTTTTTCATATAAACTAAAAAGCTCTTAAAATATTTGATTTCCTTAAAAATAAGCATACTAAATAAACCCTAACGGGTTTCATTTTTTCACTATGCAG	NA	NA	NA	NA
