The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	162933	233530	2145899	protease,tRNA,transposase	Enterococcus_phage(10.53%)	60	NA	NA
WP_041809297.1|162933_164211_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	6.9e-12
WP_014562892.1|164381_164954_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_023061589.1|165108_165594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061590.1|165647_167045_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_023061592.1|167160_169110_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	31.0	4.0e-27
WP_014562896.1|169132_170416_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003625480.1|170690_170852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061595.1|171066_173286_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.1	1.4e-249
WP_003625482.1|173278_173992_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	55.8	7.9e-50
WP_014562898.1|174043_174613_+	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_014562899.1|174605_175799_+	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_023061596.1|175898_177116_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	32.8	1.9e-51
WP_172981046.1|177206_179138_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.4	1.0e-67
WP_041809298.1|179359_181381_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.2	2.0e-61
WP_041809299.1|181683_182121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080668570.1|182400_182481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809300.1|182638_183040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562904.1|183276_183492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809301.1|183535_183805_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_041809302.1|184325_185654_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014918132.1|185800_185962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809303.1|186738_187599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809304.1|187725_188949_+	SLAP domain-containing protein	NA	S5M9Y4	Brevibacillus_phage	36.3	4.6e-13
WP_014562910.1|188967_190059_+	SLAP domain-containing protein	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	26.6	1.0e-19
WP_014918137.1|190162_191998_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_014562912.1|193168_194575_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_155244303.1|194770_194938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809305.1|194918_195884_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_080553147.1|196336_197566_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	3.1e-118
WP_014562917.1|198128_198884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809307.1|199046_199739_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014562919.1|199962_200565_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003625545.1|200627_201188_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_014562921.1|201289_202399_+	LCP family protein	NA	NA	NA	NA	NA
WP_014562922.1|202398_203016_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014562923.1|203051_206042_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_041809308.1|206127_207522_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_014562925.1|207775_209038_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	6.7e-84
WP_041809309.1|210123_211437_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.0	5.7e-62
WP_023061523.1|211436_212093_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_041809310.1|212208_213351_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.3	1.2e-63
WP_041809311.1|213403_214720_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	36.1	8.0e-64
WP_014562930.1|214860_215286_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_014562931.1|215518_215980_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_012211324.1|216068_216731_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014562933.1|216891_217491_-	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_014562934.1|217615_218638_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014562935.1|218662_219142_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	59.0	3.9e-37
WP_023061528.1|219131_219740_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_041809312.1|220038_222702_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.6	6.8e-38
WP_014562938.1|222794_224771_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	1.0e-99
WP_014562939.1|224770_225538_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014562940.1|225524_226091_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_014562941.1|226080_226965_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_014562942.1|227103_228510_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014562943.1|228633_228891_+	Veg family protein	NA	NA	NA	NA	NA
WP_014562944.1|228993_229824_+	pur operon repressor	NA	NA	NA	NA	NA
WP_014562945.1|229870_231256_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	33.0	5.1e-29
WP_193363591.1|231487_232474_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_193363592.1|232528_233530_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	48.1	8.1e-93
>prophage 3
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	558472	567241	2145899		Prochlorococcus_phage(33.33%)	9	NA	NA
WP_014563196.1|558472_558958_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.4	2.8e-22
WP_041809371.1|558923_560099_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_041809374.1|560304_561021_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	39.6	9.7e-40
WP_041809376.1|561021_561276_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014563199.1|561272_561944_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014563200.1|561940_564169_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	2.9e-143
WP_035515999.1|564144_565611_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	4.1e-61
WP_041809380.1|565597_566635_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.5	5.0e-61
WP_014563203.1|566644_567241_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	3.3e-25
>prophage 4
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	589319	644237	2145899	bacteriocin,transposase,protease,tRNA,integrase	Tupanvirus(30.0%)	49	583301:583317	616702:616718
583301:583317	attL	ATGAAAAGATCAAGAAG	NA	NA	NA	NA
WP_023061995.1|589319_591254_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.1	1.8e-96
WP_014563224.1|591411_591933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061994.1|592083_592614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563226.1|593076_594327_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_080553153.1|596181_596715_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.2	4.0e-14
WP_014563229.1|596736_596937_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003627118.1|596980_597337_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_014563231.1|597481_598006_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_014563232.1|597998_599108_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_023061987.1|599118_599775_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003627112.1|599755_600349_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_003627111.1|600370_600718_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_014563235.1|600723_601875_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023061985.1|601876_602431_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003627105.1|602593_603310_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
WP_014563237.1|603287_604856_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041809389.1|604907_606179_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	1.3e-10
WP_014563240.1|607403_608465_+|bacteriocin	class III bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014563241.1|608484_609849_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014563242.1|609942_610320_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	42.2	2.9e-11
WP_014563245.1|611916_612405_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_041809393.1|612454_613417_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_014563247.1|613463_613736_-	acylphosphatase	NA	NA	NA	NA	NA
WP_014563248.1|613833_614601_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014918464.1|614712_615063_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014563250.1|615347_616397_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	1.2e-33
WP_014563251.1|616400_618815_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
616702:616718	attR	ATGAAAAGATCAAGAAG	NA	NA	NA	NA
WP_014563252.1|618891_619368_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_014563253.1|619430_620345_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_014563255.1|620844_621141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023061714.1|621253_622177_-	ATPase	NA	NA	NA	NA	NA
WP_014563257.1|622284_624876_-	YfhO family protein	NA	NA	NA	NA	NA
WP_014563258.1|624966_627075_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003548272.1|627151_627301_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003627079.1|627349_627910_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_014563259.1|627930_628611_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003627075.1|628611_628839_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_012212102.1|628897_629299_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014563261.1|629377_630298_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_014563263.1|631667_633005_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_041809886.1|633257_633977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563265.1|634118_635024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060884.1|635124_636114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080553189.1|636180_637449_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.7	1.8e-44
WP_003627059.1|637701_638694_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
WP_014563268.1|638798_639755_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_014563269.1|639738_641625_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.6	3.6e-94
WP_014563270.1|641867_642875_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041809397.1|642959_644237_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.9	1.8e-12
>prophage 5
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	659037	719646	2145899	transposase	Lysinibacillus_phage(33.33%)	53	NA	NA
WP_014562775.1|659037_660444_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_041809403.1|660874_662500_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014563278.1|662512_663718_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_023062209.1|663773_664181_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_014563280.1|664934_666101_+	galactokinase	NA	NA	NA	NA	NA
WP_014563281.1|666122_667586_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_041809406.1|667700_668696_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_041809407.1|671585_672758_+	MFS transporter	NA	NA	NA	NA	NA
WP_014563286.1|672776_673184_+	OsmC family protein	NA	NA	NA	NA	NA
WP_041809409.1|673203_673908_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014563288.1|673971_674718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809283.1|674795_676073_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	8.1e-13
WP_014563289.1|677893_679390_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_014563290.1|679459_679936_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014563291.1|679994_681095_-	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	42.9	1.2e-76
WP_041809419.1|681655_682054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563293.1|682100_682607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563294.1|682768_683947_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041809421.1|684590_685169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627907.1|685241_685400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099046776.1|685462_686113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061982.1|686131_686260_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041809424.1|686304_686664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061679.1|687499_687646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563300.1|689060_690239_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041809426.1|692051_695264_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	28.9	7.3e-10
WP_014563302.1|695284_696739_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	26.5	6.8e-24
WP_158304583.1|696725_697124_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014563303.1|697116_697974_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080553156.1|698094_698442_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_049773685.1|698462_699110_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014563305.1|699197_699812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563306.1|699894_701139_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014563307.1|701260_702442_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014563309.1|702798_703011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563310.1|703209_703713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563311.1|704107_704728_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_014563312.1|704667_705072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809429.1|706526_706853_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_041809432.1|706857_707739_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_041809435.1|707753_708416_-	serine dehydratase	NA	NA	NA	NA	NA
WP_041809437.1|708519_708810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627894.1|709665_710325_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014563318.1|710305_710980_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014563319.1|710989_711730_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-24
WP_007126420.1|711742_712603_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003631275.1|712649_712964_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_014563321.1|714627_714921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563322.1|715193_716069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563323.1|716212_716512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563324.1|716660_717893_+	MFS transporter	NA	NA	NA	NA	NA
WP_007126411.1|718025_718319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809439.1|718368_719646_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.2	1.7e-10
>prophage 7
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	1377016	1438713	2145899	tRNA,transposase	Streptococcus_phage(23.08%)	57	NA	NA
WP_014563838.1|1377016_1379656_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.5	9.8e-162
WP_148224897.1|1379922_1380495_-	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
WP_041809572.1|1380738_1381269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563840.1|1381268_1382369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809575.1|1382392_1383319_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.0	1.7e-76
WP_012211687.1|1383315_1383732_-	GtrA family protein	NA	NA	NA	NA	NA
WP_014563842.1|1383900_1384998_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_014563843.1|1385738_1386917_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014563844.1|1386956_1387175_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014563845.1|1387478_1387982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809576.1|1388231_1390013_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	59.7	8.5e-202
WP_014563847.1|1390211_1391426_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.3	1.1e-86
WP_014563849.1|1391846_1392668_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014563851.1|1392824_1393034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563852.1|1393093_1393414_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014563853.1|1393410_1394217_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014563854.1|1394354_1394933_-	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_041809582.1|1395054_1398012_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_041809584.1|1398199_1398931_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003626201.1|1398936_1399443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158304584.1|1399448_1399682_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003626193.1|1400695_1401406_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014563859.1|1401395_1402274_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003626189.1|1402331_1403549_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_014563860.1|1403548_1404709_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.8	2.3e-38
WP_014563861.1|1404799_1406509_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_014563862.1|1406791_1407403_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_003626181.1|1407492_1407960_+	YueI family protein	NA	NA	NA	NA	NA
WP_014563863.1|1407959_1409273_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.3	6.2e-101
WP_014563865.1|1409926_1410391_+	universal stress protein	NA	NA	NA	NA	NA
WP_014563866.1|1410456_1411650_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003626171.1|1411671_1411899_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003628023.1|1411907_1412201_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_014563867.1|1412214_1413204_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_014563868.1|1413287_1413518_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_014563869.1|1413581_1414043_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_014563870.1|1414054_1415494_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_014563871.1|1415516_1416479_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_012211671.1|1416489_1418001_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_014563872.1|1418015_1418564_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_023060971.1|1418563_1419073_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_005718768.1|1419124_1419349_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_014563875.1|1419368_1420082_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_014563876.1|1420205_1420835_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014919072.1|1420918_1421920_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.4	2.5e-49
WP_014563878.1|1421925_1422768_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014563879.1|1422760_1423849_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
WP_014919074.1|1423865_1424465_-	thymidine kinase	NA	A0A1W6JKV9	Lactococcus_phage	48.5	5.3e-47
WP_041809588.1|1424615_1425968_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_014563881.1|1426285_1427299_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.0	1.8e-07
WP_014563882.1|1427550_1428729_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014563883.1|1430347_1431607_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.1	5.7e-11
WP_013854585.1|1431844_1433074_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_014563885.1|1433415_1434756_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003626132.1|1434831_1435446_-	VanZ family protein	NA	NA	NA	NA	NA
WP_014563886.1|1435570_1437760_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.8	1.5e-152
WP_041809589.1|1437855_1438713_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	1491717	1500056	2145899	transposase	Streptococcus_phage(33.33%)	7	NA	NA
WP_005718663.1|1491717_1492302_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.4	1.1e-52
WP_014563930.1|1492385_1493621_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.7	5.8e-56
WP_012211624.1|1493661_1494597_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	1.4e-46
WP_012211623.1|1494589_1495633_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	50.2	2.4e-87
WP_014563931.1|1495643_1496519_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-08
WP_014563932.1|1496608_1497151_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_041809609.1|1497215_1500056_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	6.5e-305
>prophage 9
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	1588900	1649928	2145899	bacteriocin,transposase	Bacillus_phage(14.29%)	50	NA	NA
WP_014564003.1|1588900_1589266_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014564004.1|1589352_1589676_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_014564005.1|1589675_1591079_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_014564006.1|1591071_1591533_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012211560.1|1591519_1592758_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
WP_014564007.1|1592732_1594010_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_014564008.1|1594021_1594816_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.5	4.3e-12
WP_080553172.1|1594885_1595719_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014564010.1|1595928_1596747_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023061241.1|1597812_1598370_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014564013.1|1598444_1599170_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211554.1|1599169_1600096_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014564014.1|1600213_1602229_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.2	1.0e-65
WP_014564015.1|1602289_1602982_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_023061243.1|1602981_1603908_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_023061244.1|1603991_1604795_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_014564018.1|1604948_1606250_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014564020.1|1606625_1607609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148224899.1|1607623_1608505_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014564022.1|1608684_1609479_+	putative transcriptional regulator	NA	NA	NA	NA	NA
WP_014564023.1|1609617_1610535_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_014564024.1|1610610_1611264_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014564025.1|1611278_1611920_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014564026.1|1611919_1612738_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014564027.1|1612748_1613489_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	3.6e-37
WP_041809649.1|1615670_1616135_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.4	7.0e-31
WP_014564030.1|1618392_1618971_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014564031.1|1619138_1620908_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.4e-55
WP_014564032.1|1620907_1622638_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	5.8e-30
WP_014564033.1|1622616_1623078_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564034.1|1623219_1624038_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211534.1|1624080_1624749_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_023060903.1|1624761_1625553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564036.1|1625708_1627331_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.8	8.4e-55
WP_003633113.1|1627434_1628517_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_041809652.1|1629859_1631329_-	MFS transporter	NA	NA	NA	NA	NA
WP_023060907.1|1631619_1632150_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_023060908.1|1632162_1633491_+	NCS family uracil:cation symporter	NA	Q9KX94	Enterobacteria_phage	35.9	3.4e-62
WP_014564041.1|1633545_1634382_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.4	5.1e-48
WP_041809976.1|1636375_1637191_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_014564044.1|1637230_1637707_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013854589.1|1640171_1640684_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013854590.1|1640691_1642158_-	MFS transporter	NA	NA	NA	NA	NA
WP_003633097.1|1642653_1643154_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014564047.1|1643758_1644136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563294.1|1645364_1646543_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_148224876.1|1646603_1646948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564049.1|1647282_1647483_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	6.3e-21
WP_014564050.1|1647577_1648909_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	9.3e-52
WP_023060767.1|1649004_1649928_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	3.9e-33
>prophage 10
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	1709585	1838552	2145899	capsid,holin,transposase,protease,tRNA	Lactobacillus_phage(18.52%)	107	NA	NA
WP_014564093.1|1709585_1710197_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	1.2e-33
WP_003626977.1|1710388_1710802_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003626979.1|1710963_1711191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564094.1|1711277_1712009_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_023061024.1|1712112_1713297_-	acetate kinase	NA	NA	NA	NA	NA
WP_014564096.1|1713628_1714099_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_041809675.1|1714130_1714763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283330.1|1714716_1715184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809983.1|1715165_1715768_+	amino acid permease	NA	NA	NA	NA	NA
WP_023061029.1|1715980_1716094_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003626988.1|1716277_1716571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564097.1|1716644_1718456_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.4	1.6e-91
WP_014564098.1|1718650_1721275_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023061031.1|1721587_1722961_+	amino acid permease	NA	NA	NA	NA	NA
WP_014564099.1|1722934_1723489_-	acetyltransferase	NA	NA	NA	NA	NA
WP_012211481.1|1724548_1724917_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_014564102.1|1724920_1725841_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003632508.1|1725869_1726682_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_014564103.1|1726700_1727711_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_014564106.1|1730953_1732207_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	26.1	9.1e-09
WP_023060922.1|1739000_1740308_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	2.8e-93
WP_014564108.1|1740531_1741083_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014564109.1|1741082_1741691_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.0	2.6e-33
WP_023060924.1|1741820_1742618_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014564111.1|1742773_1743475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564112.1|1743558_1744941_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014564113.1|1744986_1746021_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_014564114.1|1746179_1749620_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_014564115.1|1749624_1750197_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564116.1|1750332_1751283_-	serine hydrolase	NA	NA	NA	NA	NA
WP_023060927.1|1751295_1752213_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_014564118.1|1752351_1753653_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014564119.1|1753703_1754999_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014564120.1|1754982_1755807_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014564121.1|1755810_1756677_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041809683.1|1756676_1757762_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	4.9e-27
WP_014564123.1|1758015_1759443_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003627841.1|1759483_1760338_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_014564124.1|1760428_1761382_-	ribonuclease H-like domain-containing protein	NA	U5PXE0	Bacillus_virus	39.2	1.5e-11
WP_014564125.1|1761390_1762212_-	NAD-dependent protein deacetylase SIR2 family	NA	NA	NA	NA	NA
WP_014564126.1|1762481_1762679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809686.1|1762662_1763013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023062162.1|1765475_1766129_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	50.9	8.0e-57
WP_003606447.1|1766410_1766659_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014564130.1|1766788_1767505_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_041809689.1|1768415_1769660_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	2.7e-45
WP_041809692.1|1769761_1770766_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	32.1	4.5e-35
WP_014564135.1|1771486_1772329_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	3.0e-157
WP_014564136.1|1772382_1772634_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.7e-37
WP_014564139.1|1775416_1775698_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_080553177.1|1776789_1777812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080553178.1|1778118_1779132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080553179.1|1779106_1780168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061539.1|1780361_1781102_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	84.5	1.4e-121
WP_014564142.1|1781442_1781598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564143.1|1781698_1782940_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
WP_148224878.1|1783577_1784801_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.3	8.3e-124
WP_023061490.1|1784933_1786538_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	9.9e-16
WP_003627833.1|1786659_1787574_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_014564146.1|1787663_1788665_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_003627831.1|1788712_1789216_+	nucleoside 2-deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	5.4e-13
WP_041809699.1|1789366_1789993_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014564148.1|1790031_1790550_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014564149.1|1790549_1791005_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023061494.1|1791187_1791367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809701.1|1791363_1791768_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023061495.1|1791951_1793253_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014564152.1|1793305_1793878_-	elongation factor P	NA	NA	NA	NA	NA
WP_041809704.1|1793912_1794827_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	4.7e-31
WP_014564154.1|1794885_1795446_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_080553180.1|1795622_1796852_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.7	2.5e-120
WP_023060978.1|1796992_1799299_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023060979.1|1799448_1800135_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003627817.1|1800195_1800846_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_080553181.1|1800938_1802114_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.1	7.3e-117
WP_014564159.1|1802317_1803067_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_014564160.1|1803094_1804753_-	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_080553182.1|1804770_1805934_-	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_023061875.1|1807144_1807495_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	52.6	1.6e-24
WP_003625154.1|1807913_1808054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680323.1|1808065_1808317_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014564163.1|1808331_1808874_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_014564164.1|1808901_1809087_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_014564165.1|1809098_1809659_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_041809714.1|1809878_1810352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809716.1|1810538_1811816_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	4.0e-12
WP_023061498.1|1811947_1812391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564167.1|1812767_1814567_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014564168.1|1814579_1815329_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.2e-33
WP_014564169.1|1815475_1816747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564170.1|1816835_1817507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627805.1|1819672_1819810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564173.1|1819900_1820905_-	asparaginase	NA	NA	NA	NA	NA
WP_014564174.1|1820916_1821690_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564175.1|1821814_1823152_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_148224879.1|1823772_1824132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095662341.1|1824197_1824473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192402.1|1824792_1825842_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_041809720.1|1826144_1826651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061721.1|1827217_1828168_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014564180.1|1828298_1829540_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	3.7e-119
WP_014564181.1|1829849_1830725_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.0	1.6e-76
WP_014564182.1|1830889_1832995_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_014564183.1|1833219_1834671_+	APC family permease	NA	NA	NA	NA	NA
WP_014564184.1|1834999_1836178_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158304585.1|1836609_1837449_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_014564187.1|1837502_1838552_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.9e-48
>prophage 11
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	1861356	2044042	2145899	bacteriocin,transposase,integrase	Bacillus_phage(14.58%)	152	2012588:2012620	2025490:2025522
WP_080553183.1|1861356_1862586_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.0	5.2e-126
WP_023192898.1|1862724_1863348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627304.1|1863473_1863920_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_041809738.1|1864055_1864247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627306.1|1864515_1865052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564213.1|1865252_1866533_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	2.9e-119
WP_014564214.1|1866895_1867381_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014564215.1|1867383_1868154_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014564216.1|1868164_1869706_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.7	1.6e-42
WP_003627310.1|1869714_1870092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627311.1|1870225_1870783_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014564219.1|1871539_1872781_-	LCP family protein	NA	NA	NA	NA	NA
WP_014564220.1|1872942_1874739_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003631064.1|1877057_1877330_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014564224.1|1879472_1880855_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_014564225.1|1881290_1882085_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014564226.1|1882084_1882732_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	5.7e-15
WP_172981382.1|1882763_1883666_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014564228.1|1883943_1884216_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041809741.1|1884445_1885723_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.1e-12
WP_014564230.1|1886269_1887661_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012212275.1|1887758_1888508_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_003627351.1|1888516_1890088_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_014564231.1|1890138_1891287_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	32.2	8.9e-19
WP_012212277.1|1891290_1891977_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
WP_014564232.1|1892153_1894013_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	6.2e-46
WP_023061301.1|1894022_1895747_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	9.9e-38
WP_014564234.1|1895861_1896644_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_014564235.1|1896652_1897753_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_014919472.1|1897811_1898075_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_014564237.1|1898067_1898952_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	29.7	6.0e-15
WP_014564238.1|1898929_1899709_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.0	3.3e-25
WP_014564239.1|1899724_1900564_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	42.5	2.1e-17
WP_014564240.1|1900578_1901301_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014564241.1|1901462_1901999_+	CvpA family protein	NA	NA	NA	NA	NA
WP_014564242.1|1902040_1902970_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_023061298.1|1902978_1903770_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_023061297.1|1903861_1904410_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	39.3	1.3e-28
WP_023061296.1|1904423_1904963_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014564246.1|1905105_1905729_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564247.1|1905855_1906098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564248.1|1906199_1907612_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_023061294.1|1907656_1908331_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
WP_023061293.1|1908332_1909394_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023061292.1|1909394_1909922_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041809744.1|1910032_1910632_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023061290.1|1910775_1911531_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014564254.1|1911527_1912289_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_014564255.1|1912347_1912992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564257.1|1913477_1914731_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.3	6.1e-122
WP_003631064.1|1914948_1915221_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013854585.1|1918165_1919395_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_014564258.1|1920277_1921192_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_041810005.1|1921191_1921947_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
WP_003630190.1|1922298_1922466_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003630193.1|1922446_1922755_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_014564261.1|1923088_1925401_-	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_041810007.1|1925525_1925717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809748.1|1926016_1926238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919462.1|1926227_1926455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041809741.1|1926726_1928004_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.1e-12
WP_014564230.1|1928550_1929942_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012212275.1|1930039_1930789_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_003627351.1|1930797_1932369_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_014564231.1|1932419_1933568_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	32.2	8.9e-19
WP_012212277.1|1933571_1934258_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
WP_014564232.1|1934434_1936294_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	6.2e-46
WP_023061301.1|1936303_1938028_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	9.9e-38
WP_014564234.1|1938142_1938925_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_014564235.1|1938933_1940034_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_014919472.1|1940092_1940356_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_014564237.1|1940348_1941233_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	29.7	6.0e-15
WP_014564238.1|1941210_1941990_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.0	3.3e-25
WP_014564239.1|1942005_1942845_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	42.5	2.1e-17
WP_014564240.1|1942859_1943582_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014564241.1|1943743_1944280_+	CvpA family protein	NA	NA	NA	NA	NA
WP_014564242.1|1944321_1945251_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_023061298.1|1945259_1946051_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_023061297.1|1946142_1946691_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	39.3	1.3e-28
WP_023061296.1|1946704_1947244_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014564246.1|1947386_1948010_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564247.1|1948136_1948379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564248.1|1948480_1949893_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_023061294.1|1949937_1950612_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
WP_023061293.1|1950613_1951675_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023061292.1|1951675_1952203_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041809744.1|1952313_1952913_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023061290.1|1953056_1953812_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014564254.1|1953808_1954570_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_014564255.1|1954628_1955273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564265.1|1955758_1957018_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	3.9e-124
WP_014564266.1|1957369_1958578_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_014564267.1|1958666_1958861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564268.1|1958899_1960393_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.7	9.0e-72
WP_014564269.1|1960502_1963037_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	2.0e-71
WP_014919496.1|1963243_1963603_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_080553185.1|1963665_1964646_-	cytochrome C5	NA	NA	NA	NA	NA
WP_041810010.1|1964796_1966044_+	MFS transporter	NA	NA	NA	NA	NA
WP_014564276.1|1968109_1969384_+	MFS transporter	NA	NA	NA	NA	NA
WP_041809756.1|1969516_1970368_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148224883.1|1971004_1972228_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	3.3e-120
WP_014564280.1|1972781_1973495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809761.1|1973659_1974838_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014564282.1|1975239_1975509_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014919512.1|1975584_1977753_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.9e-171
WP_005720082.1|1977745_1978171_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_014919513.1|1978151_1979159_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	3.5e-96
WP_003618609.1|1982893_1983367_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014564286.1|1983520_1985806_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014919517.1|1985783_1986716_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_014564288.1|1986767_1988027_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.0e-124
WP_014564289.1|1988161_1989196_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.5e-36
WP_014564290.1|1989411_1990488_+	guanine permease	NA	NA	NA	NA	NA
WP_014564291.1|1990490_1991048_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041809766.1|1991239_1992517_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.1e-12
WP_014564294.1|1993277_1994267_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003630369.1|1994314_1995073_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_013855212.1|1995131_1995902_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_014564296.1|1995894_1996737_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_041809769.1|1996717_1998097_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_014919524.1|1998110_1998527_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_013855208.1|1998531_1999002_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_014564299.1|1999005_2000235_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014564300.1|2000256_2000988_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	1.8e-12
WP_014564301.1|2000987_2001905_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013855204.1|2001914_2002157_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_041809770.1|2002215_2003199_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014564303.1|2003195_2003663_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625233.1|2003692_2004139_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_023061724.1|2005842_2006091_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_148224900.1|2007841_2008231_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.4	9.4e-21
WP_041809689.1|2008473_2009718_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	2.7e-45
WP_041809773.1|2009911_2010799_+	EamA family transporter	NA	NA	NA	NA	NA
2012588:2012620	attL	GAAATACTTTCCAACACCAAAAATTCTAGACCC	NA	NA	NA	NA
WP_023062170.1|2012685_2014953_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.9	3.3e-126
WP_002331365.1|2015910_2016444_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014564311.1|2016714_2017971_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_014919539.1|2018088_2018328_-|integrase	integrase core domain-containing protein	integrase	NA	NA	NA	NA
WP_014564314.1|2020207_2021395_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	5.8e-05
WP_014564315.1|2021391_2022231_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_013854585.1|2023999_2025229_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_014564318.1|2025587_2026937_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.1	3.2e-124
2025490:2025522	attR	GAAATACTTTCCAACACCAAAAATTCTAGACCC	NA	NA	NA	NA
WP_049773756.1|2029532_2029862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630502.1|2030972_2031830_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003630504.1|2031832_2033191_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003630506.1|2033268_2034495_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003630507.1|2034581_2035688_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.5	9.8e-23
WP_003630508.1|2035713_2036385_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	28.5	1.2e-07
WP_014564321.1|2036377_2038642_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_014564322.1|2038815_2040537_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_041809783.1|2040540_2042202_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_014564324.1|2042327_2042660_-	acetate kinase	NA	NA	NA	NA	NA
WP_014564325.1|2042800_2044042_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
>prophage 12
NC_017467	Lactobacillus helveticus H10, complete sequence	2145899	2069366	2129551	2145899	protease,holin,transposase	Lactobacillus_virus(31.25%)	50	NA	NA
WP_023062082.1|2069366_2071490_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	3.8e-116
WP_148224902.1|2071853_2072681_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014564350.1|2072673_2073999_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_041809795.1|2074087_2074789_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-32
WP_041809797.1|2077346_2077583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564353.1|2077621_2079238_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014564354.1|2079511_2080474_+	SLAP domain-containing protein	NA	Q6SE63	Lactobacillus_prophage	54.7	6.9e-65
WP_014564355.1|2080539_2081214_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_014564356.1|2081720_2081879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564359.1|2082342_2082732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564360.1|2082746_2083454_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041809802.1|2083502_2083703_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014564361.1|2083914_2084859_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014564362.1|2084858_2086145_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003625019.1|2086137_2086377_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_014564363.1|2086435_2087674_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	9.0e-25
WP_014564364.1|2087673_2089188_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.6	1.5e-34
WP_003630630.1|2089203_2089356_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_041809804.1|2089558_2089855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564366.1|2089874_2091011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193363587.1|2091842_2093072_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.2e-117
WP_014564370.1|2093487_2095344_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.6	1.2e-68
WP_023060744.1|2095497_2096667_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003625002.1|2096795_2097104_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014564372.1|2097090_2097360_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_023060745.1|2097397_2098966_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	4.5e-13
WP_014564374.1|2098970_2099600_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_023060747.1|2099691_2100549_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014919635.1|2100545_2100827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101871943.1|2100980_2101076_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_193363588.1|2101180_2102446_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.7e-124
WP_148224885.1|2103217_2103373_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_014564379.1|2103567_2104224_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014919640.1|2104313_2105417_+	YdcF family protein	NA	NA	NA	NA	NA
WP_014564381.1|2105441_2107778_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	39.8	7.1e-31
WP_041809810.1|2107812_2108418_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014564383.1|2108524_2109352_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.8	2.8e-22
WP_014564384.1|2109469_2110189_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_014564385.1|2110335_2111187_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564386.1|2111200_2112238_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_049773758.1|2112306_2114289_-	penicillin binding protein PBP4B	NA	NA	NA	NA	NA
WP_041809812.1|2114342_2115233_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_172981370.1|2115254_2117237_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014564390.1|2117664_2118312_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	48.4	1.4e-48
WP_041809814.1|2118336_2119023_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	50.0	5.4e-56
WP_041809816.1|2120552_2121353_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014564394.1|2121589_2122897_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	6.3e-37
WP_193363589.1|2124156_2125386_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.3e-124
WP_041809821.1|2126594_2127905_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.2	9.1e-44
WP_014564397.1|2128144_2129551_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
