The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	580193	651210	4864217	capsid,tRNA,tail,head,terminase,transposase,plate,integrase,portal,lysis	Erwinia_phage(53.66%)	78	608030:608075	643005:643050
WP_013573870.1|580193_581198_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013573871.1|581693_582584_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_013573872.1|582597_584142_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_013573873.1|584213_585413_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_013573874.1|585779_586889_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	48.3	3.1e-16
WP_014411581.1|586915_588214_+	maltoporin	NA	NA	NA	NA	NA
WP_013573876.1|588444_589341_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_013573877.1|589578_590418_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013573878.1|590469_590907_+	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_013573879.1|590977_591676_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013573880.1|591739_592225_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	3.9e-24
WP_013573881.1|592337_593681_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014411583.1|593750_596021_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_121020141.1|596249_597590_+	enterochelin esterase	NA	NA	NA	NA	NA
WP_013573884.1|597563_598361_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.3	1.2e-14
WP_013573885.1|598357_599386_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_013573886.1|599388_600390_-	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_013573887.1|600389_601358_-	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041688942.1|601699_603223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148232202.1|603249_603528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573888.1|603537_604302_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.1	5.3e-68
WP_013573889.1|604748_605114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573890.1|605159_605714_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_013573891.1|605716_606358_+	type VI secretion system amidase effector protein Tae4	NA	R4JJZ3	Burkholderia_phage	55.4	1.0e-56
WP_013573892.1|606354_606684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573893.1|607264_607429_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_013573894.1|607560_607890_-	hypothetical protein	NA	NA	NA	NA	NA
608030:608075	attL	TGGTGGCCCTTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_013573895.1|608377_609217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573896.1|609298_610543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573897.1|610562_611561_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	79.9	4.7e-157
WP_013573898.1|611560_612151_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	52.7	1.0e-55
WP_013573899.1|612282_612543_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	66.2	2.3e-23
WP_013573900.1|612573_613080_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	51.2	8.1e-41
WP_013573901.1|613082_613253_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_013573902.1|613260_613563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689051.1|613693_613909_+	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	50.8	5.0e-08
WP_013573904.1|613908_614250_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_013573905.1|614242_614467_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	50.0	2.9e-14
WP_013573906.1|614546_616790_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	57.3	7.1e-238
WP_083812207.1|616946_617135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148232203.1|617833_618364_+	DUF4065 domain-containing protein	NA	A0A139ZPG5	Marinitoga_camini_virus	30.3	1.9e-08
WP_013573909.1|618363_618828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573910.1|619133_620051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573911.1|620280_621312_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	78.9	1.3e-157
WP_041689053.1|621313_623080_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	78.5	1.8e-273
WP_013573913.1|623224_624076_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	61.8	4.3e-87
WP_013573914.1|624122_625187_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.0	2.4e-143
WP_013573915.1|625200_625857_+|terminase	small terminase subunit	terminase	F1BUQ7	Erwinia_phage	56.5	1.6e-57
WP_013573916.1|625952_626423_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	52.0	8.6e-37
WP_013573917.1|626422_626626_+|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	62.7	5.9e-19
WP_013573918.1|626631_626841_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	51.7	1.5e-09
WP_013573919.1|626821_627331_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.5	2.0e-55
WP_013573920.1|627330_627756_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	46.7	8.9e-25
WP_013573921.1|627851_628319_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.8	5.5e-52
WP_013573922.1|628311_628761_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	67.6	3.7e-45
WP_013573923.1|628849_629797_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_013573924.1|629879_630524_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	59.4	4.3e-63
WP_013573926.1|630658_631009_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	66.4	9.9e-38
WP_013573927.1|631012_631921_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	75.8	2.4e-120
WP_013573928.1|631913_632441_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	77.1	2.4e-75
WP_013573930.1|635258_635714_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	3.3e-25
WP_013573931.1|635843_637013_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	78.1	1.7e-179
WP_013573932.1|637027_637537_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	70.3	2.4e-64
WP_013573933.1|637595_637877_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	57.8	5.0e-24
WP_013573934.1|637909_638029_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	74.4	1.7e-10
WP_013573935.1|638021_640496_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	64.6	1.4e-202
WP_013573936.1|640508_640979_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	61.7	6.0e-46
WP_013573937.1|640975_642139_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	66.5	2.0e-143
WP_013573938.1|642153_642489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573939.1|642594_642816_+	DNA-binding transcriptional regulator	NA	F1BUT0	Erwinia_phage	67.1	1.2e-20
WP_013573940.1|643222_643726_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
643005:643050	attR	TGGTGGCCCTTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_041672991.1|644004_644496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573943.1|644576_645179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573944.1|645212_645680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573945.1|645740_647579_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_013573946.1|647781_649530_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.5	3.5e-75
WP_001144069.1|649665_649881_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013573947.1|650196_651210_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	60.1	3.3e-110
>prophage 2
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	708933	795680	4864217	tRNA,tail,transposase,plate,lysis	Erwinia_phage(30.56%)	80	NA	NA
WP_013573996.1|708933_710256_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_173362080.1|710323_711124_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013573998.1|711328_712882_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_173362081.1|712890_713577_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_013574000.1|713678_714350_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	35.8	1.2e-12
WP_013574001.1|714363_714723_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_013574002.1|714892_715897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574003.1|716242_718045_+	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_013574004.1|718072_719809_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_013574005.1|719833_720571_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_013574006.1|720730_721768_-	aminopeptidase	NA	NA	NA	NA	NA
WP_013574007.1|722019_723444_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_013574008.1|723454_724363_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_013574009.1|724376_725804_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	4.6e-33
WP_013574010.1|725805_726429_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	39.1	1.1e-07
WP_173362082.1|726563_726869_+	DUF3561 family protein	NA	NA	NA	NA	NA
WP_013574012.1|727036_727357_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_013574013.1|727359_728079_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013574014.1|728078_728552_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_041673186.1|728574_729621_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_013574016.1|729601_730366_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	4.8e-69
WP_013574017.1|730355_730982_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	5.2e-37
WP_013574018.1|731224_732247_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
WP_013574019.1|732298_733285_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
WP_013574020.1|733383_735939_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	2.9e-25
WP_013574021.1|736361_739022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574022.1|739175_740279_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_013574023.1|740440_740935_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
WP_013574024.1|741042_742107_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.2e-111
WP_173362083.1|742350_742917_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_013574026.1|743055_745683_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.5	2.1e-79
WP_013574027.1|745939_746125_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_013574028.1|747156_747723_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_013574029.1|747719_748148_+	DedA family protein	NA	NA	NA	NA	NA
WP_013574030.1|748233_749805_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_013574031.1|749962_750478_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013574032.1|750547_751837_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013574033.1|751853_752645_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_013574034.1|752809_754171_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015689395.1|754349_754598_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013574036.1|754616_755165_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_013574037.1|755232_756006_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013574038.1|756054_756402_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013574039.1|756494_756674_-	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	75.5	6.4e-17
WP_013574040.1|756738_757839_-|tail	tail protein	tail	Q6K1G4	Salmonella_virus	43.6	1.7e-83
WP_013574041.1|757841_758312_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.0	1.3e-37
WP_013574042.1|758308_759940_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	28.9	1.5e-16
WP_013574043.1|759932_760067_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	78.9	6.7e-11
WP_013574044.1|760087_760375_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	4.3e-23
WP_013574045.1|760434_760944_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.4	3.1e-64
WP_013574046.1|760958_762128_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	8.4e-182
WP_013574047.1|762298_763258_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	68.5	1.7e-119
WP_013574048.1|763247_763862_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	70.9	1.7e-80
WP_013574049.1|763854_764763_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	73.5	1.5e-117
WP_013574050.1|764768_765119_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	63.8	9.9e-38
WP_013574051.1|765115_765757_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	60.4	6.4e-67
WP_013574052.1|765838_766300_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.3	1.1e-23
WP_013574053.1|766392_766821_-|lysis	lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	48.3	1.9e-06
WP_013574054.1|766821_767331_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.1	1.5e-55
WP_013574055.1|767311_767533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013574056.1|767523_767727_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	56.7	8.6e-18
WP_013574057.1|767938_768133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013574058.1|768281_770174_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	50.5	4.8e-179
WP_013574059.1|770267_770489_-	TraR/DksA C4-type zinc finger protein	NA	A0A1S6L007	Salmonella_phage	44.3	4.6e-09
WP_013574060.1|770488_770764_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_013574061.1|770896_771487_+	helix-turn-helix domain-containing protein	NA	Q6K1G0	Salmonella_virus	51.3	1.8e-52
WP_013574062.1|771775_772852_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	3.9e-85
WP_013574063.1|772858_773980_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_013574064.1|774057_775212_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_013574065.1|775522_775867_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_013574066.1|776148_776883_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_013574067.1|777013_777991_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_013574068.1|777990_778728_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_013574069.1|778858_781432_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.3e-126
WP_013574070.1|787398_788697_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.9e-42
WP_013574071.1|788886_790242_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013574072.1|790326_793047_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013574073.1|793078_793783_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_013574074.1|793912_794332_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	34.4	4.5e-13
WP_013574075.1|794576_795680_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	1265617	1274330	4864217	integrase	Enterobacteria_phage(42.86%)	9	1260714:1260729	1272365:1272380
1260714:1260729	attL	CCCTACAGGAATCGAA	NA	NA	NA	NA
WP_013574514.1|1265617_1268293_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	33.4	2.6e-109
WP_013574515.1|1268383_1269370_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	67.4	3.0e-132
WP_013574516.1|1269408_1269675_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	50.7	1.7e-13
WP_013574517.1|1269667_1269871_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_071882950.1|1270069_1270276_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	33.8	1.0e-05
WP_013574519.1|1270325_1270544_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013574520.1|1270944_1272180_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.3	2.0e-72
WP_013574521.1|1272522_1273440_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	66.0	1.8e-102
1272365:1272380	attR	CCCTACAGGAATCGAA	NA	NA	NA	NA
WP_013574522.1|1273688_1274330_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	25.1	1.7e-06
>prophage 4
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	1576201	1676202	4864217	capsid,tRNA,tail,head,terminase,plate,integrase,protease,portal,lysis	Erwinia_phage(32.14%)	88	1568821:1568838	1672609:1672626
1568821:1568838	attL	GTGCTGTTCCATGGCTGC	NA	NA	NA	NA
WP_013574769.1|1576201_1576522_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.1	1.1e-14
WP_013574770.1|1576549_1578832_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	6.7e-167
WP_002211347.1|1579053_1579272_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_013574771.1|1579365_1580100_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_041689066.1|1580151_1581873_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-18
WP_013574773.1|1581875_1583642_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	4.4e-25
WP_013574774.1|1583790_1584759_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.8	3.8e-63
WP_013574775.1|1585491_1585986_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_013574776.1|1586106_1589553_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	9.3e-88
WP_013574777.1|1589747_1590359_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013574778.1|1590366_1591710_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.7	5.8e-78
WP_013574779.1|1591816_1593109_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	6.2e-93
WP_013574780.1|1593308_1595765_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.1e-214
WP_013574781.1|1595841_1598289_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	5.4e-215
WP_013574782.1|1598300_1598918_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.3e-77
WP_013574783.1|1598919_1599777_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_013574784.1|1599846_1600455_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.8	4.4e-25
WP_013574785.1|1600454_1601027_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_013574786.1|1601160_1602306_+	MFS transporter	NA	NA	NA	NA	NA
WP_015689580.1|1602411_1603152_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.8	9.5e-22
WP_013574788.1|1603249_1604236_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	76.5	5.1e-148
WP_013574789.1|1604338_1604638_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	3.9e-35
WP_013574790.1|1604744_1605119_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	66.4	3.8e-35
WP_013574791.1|1605297_1605798_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	63.9	7.7e-60
WP_013574792.1|1605857_1606100_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	55.0	2.3e-09
WP_013574793.1|1606099_1606318_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	54.9	3.0e-16
WP_013574794.1|1606320_1606599_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	53.6	2.5e-20
WP_013574795.1|1606606_1608889_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	58.4	8.8e-252
WP_013574796.1|1609201_1610293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574797.1|1610289_1611528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574798.1|1611524_1612163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574800.1|1613297_1615835_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013574801.1|1615910_1616942_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.4	8.8e-159
WP_013574802.1|1616944_1618711_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	76.7	1.2e-269
WP_013574803.1|1618855_1619707_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	61.5	2.2e-86
WP_013574804.1|1619755_1620820_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	73.7	1.8e-143
WP_013574805.1|1620831_1621488_+|terminase	small terminase subunit	terminase	F1BUQ7	Erwinia_phage	54.5	3.4e-55
WP_013574806.1|1621583_1622054_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	52.0	8.6e-37
WP_013574807.1|1622053_1622257_+|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	64.2	1.0e-18
WP_013574808.1|1622262_1622472_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	50.0	1.1e-07
WP_013574809.1|1622452_1622962_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	63.3	3.4e-55
WP_013574810.1|1622961_1623405_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	46.7	1.4e-25
WP_013573921.1|1623482_1623950_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.8	5.5e-52
WP_013574811.1|1623942_1624389_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	68.0	2.1e-45
WP_013574812.1|1624469_1625342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574813.1|1625458_1626100_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	58.1	3.5e-65
WP_013574814.1|1626096_1626447_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	66.4	9.9e-38
WP_013574815.1|1626450_1627359_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.8	7.1e-120
WP_013574816.1|1627351_1627879_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	77.1	1.4e-75
WP_013574817.1|1627888_1630405_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	40.5	1.9e-74
WP_013574818.1|1630414_1630870_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	2.5e-25
WP_013574819.1|1631032_1632202_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	77.9	3.9e-179
WP_013574820.1|1632215_1632725_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	70.9	2.8e-65
WP_013574821.1|1632783_1633065_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	66.7	6.5e-24
WP_013574822.1|1633097_1633217_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	64.1	3.6e-08
WP_148232213.1|1633233_1635801_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	35.3	2.0e-79
WP_013574824.1|1635811_1636297_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	66.2	3.2e-50
WP_013574825.1|1636293_1637457_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	66.4	1.4e-141
WP_013574826.1|1637486_1637735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573939.1|1637897_1638119_+	DNA-binding transcriptional regulator	NA	F1BUT0	Erwinia_phage	67.1	1.2e-20
WP_013574828.1|1638634_1640917_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.9	1.1e-156
WP_013574829.1|1640992_1641850_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_015689618.1|1642348_1644112_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_013574831.1|1644437_1645523_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_013574832.1|1645627_1646911_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013574833.1|1647107_1647806_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_015689619.1|1647962_1649636_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_013574835.1|1649696_1649981_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	7.1e-10
WP_013574836.1|1650252_1652499_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_013574837.1|1652537_1654286_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.4	1.3e-56
WP_013574838.1|1654282_1655272_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_013574839.1|1655621_1655831_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.8	4.7e-19
WP_013574840.1|1656092_1656305_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	42.6	3.0e-05
WP_013574841.1|1656400_1657624_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013574842.1|1658005_1658188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574843.1|1658184_1658943_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013574844.1|1659138_1660032_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_013574845.1|1660033_1660813_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_013574846.1|1660968_1661754_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_013574847.1|1661750_1663073_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_013574848.1|1663053_1663785_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_013574849.1|1663781_1668230_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_013574850.1|1668591_1670442_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013574851.1|1670621_1671173_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	4.9e-07
WP_013574852.1|1671224_1671872_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013574853.1|1671957_1673148_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
1672609:1672626	attR	GCAGCCATGGAACAGCAC	NA	NA	NA	NA
WP_121019630.1|1673389_1674499_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	5.3e-109
WP_013574855.1|1674801_1676202_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.9	1.4e-82
>prophage 5
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	1903509	1915075	4864217		Enterobacteria_phage(25.0%)	10	NA	NA
WP_013575064.1|1903509_1904151_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.2e-34
WP_013575065.1|1904188_1904770_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
WP_013575066.1|1904813_1906664_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_013575067.1|1906742_1908332_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.6	8.2e-39
WP_013575068.1|1908794_1909682_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.9	1.2e-60
WP_148232214.1|1910158_1911226_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	9.6e-100
WP_013575070.1|1911245_1912115_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	1.6e-108
WP_013575071.1|1912534_1913461_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L5H6	Tupanvirus	25.1	1.4e-14
WP_013575072.1|1913567_1914335_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013575073.1|1914334_1915075_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.4	3.0e-07
>prophage 6
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	1939444	2008619	4864217	capsid,tail,head,terminase,integrase,protease,portal,lysis	Enterobacteria_phage(30.95%)	75	1935844:1935861	2003393:2003410
1935844:1935861	attL	GTGACGCCATCAACCGTC	NA	NA	NA	NA
WP_013575096.1|1939444_1940590_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	45.9	1.9e-82
WP_013575097.1|1940570_1940828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575098.1|1941166_1941994_-	YfdQ family protein	NA	U5P439	Shigella_phage	60.0	9.4e-87
WP_013575099.1|1942029_1942401_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.9	6.3e-43
WP_013575100.1|1942470_1942626_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_013575101.1|1942622_1943048_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	79.4	3.4e-56
WP_013575102.1|1943518_1944187_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	76.5	1.9e-98
WP_041689070.1|1944275_1944491_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	71.4	1.8e-18
WP_013575104.1|1944519_1945053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575106.1|1945258_1946266_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	1.9e-33
WP_013575107.1|1946262_1947204_+	adenine methyltransferase	NA	A0A248SKY3	Klebsiella_phage	64.5	1.0e-73
WP_013575108.1|1947200_1949198_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.1	5.4e-229
WP_013575109.1|1949194_1949356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575110.1|1949346_1949721_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	56.9	2.7e-33
WP_013575111.1|1949735_1950431_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.6	1.7e-57
WP_013575112.1|1950427_1951441_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	40.1	2.3e-71
WP_013575113.1|1951457_1951856_+	antitermination protein Q	NA	B6SCY2	Bacteriophage	57.5	3.2e-32
WP_013575115.1|1952512_1952764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575116.1|1953367_1953637_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	68.2	2.5e-25
WP_173362090.1|1953671_1954169_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	83.0	1.3e-78
WP_013575118.1|1954161_1954668_+|lysis	lysis protein	lysis	H2DE61	Erwinia_phage	35.5	2.7e-12
WP_013575119.1|1954768_1954978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575120.1|1955049_1955547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575122.1|1955859_1956279_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	67.9	2.5e-35
WP_013575124.1|1956601_1956955_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	75.9	1.3e-48
WP_013575125.1|1957099_1957573_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	68.2	9.2e-55
WP_013575126.1|1957576_1959307_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	76.9	4.7e-274
WP_013575127.1|1959306_1960611_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	79.0	1.1e-201
WP_013575128.1|1960621_1961470_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	75.5	7.8e-113
WP_013575129.1|1961479_1962694_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	89.3	6.0e-199
WP_013575130.1|1962753_1963098_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	61.1	1.6e-35
WP_013575131.1|1963108_1963447_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	63.1	9.3e-33
WP_013575132.1|1963443_1963890_+	HK97 gp10 family phage protein	NA	K7P6I1	Enterobacteria_phage	67.8	9.3e-49
WP_013575133.1|1963886_1964234_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	50.0	1.1e-23
WP_013575134.1|1964289_1964760_+	hypothetical protein	NA	K7P6W3	Enterobacteria_phage	89.2	2.2e-69
WP_013575135.1|1964816_1965215_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	69.4	3.7e-41
WP_083812228.1|1965310_1965502_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	57.1	8.9e-17
WP_013575137.1|1965533_1968818_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	73.6	0.0e+00
WP_013575138.1|1968821_1969160_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	75.9	1.1e-49
WP_083812244.1|1970065_1970812_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	85.6	1.0e-95
WP_013575140.1|1970814_1971534_+	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	83.5	1.7e-124
WP_013575141.1|1971536_1972142_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.1	7.4e-73
WP_013575142.1|1972201_1975381_+	host specificity protein J	NA	O64335	Escherichia_phage	80.5	0.0e+00
WP_013575143.1|1975380_1976391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575144.1|1976466_1977747_+|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	52.2	3.6e-45
WP_013575145.1|1977907_1978984_-	acyltransferase	NA	NA	NA	NA	NA
WP_013575146.1|1980027_1981041_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_013575147.1|1981155_1982631_+	MFS transporter	NA	NA	NA	NA	NA
WP_013575148.1|1982829_1983126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575149.1|1983134_1983728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575150.1|1983824_1985519_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	8.8e-15
WP_013575151.1|1985640_1987311_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.8	4.0e-12
WP_013575152.1|1987373_1988246_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_013575153.1|1988245_1989295_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	6.1e-06
WP_013575154.1|1989341_1989731_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.0e-06
WP_013575155.1|1989741_1990386_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_013575156.1|1990711_1991866_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_013575157.1|1991858_1993943_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_013575158.1|1993944_1994361_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_013575159.1|1994647_1995157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575160.1|1995623_1996076_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_013575161.1|1996125_1996428_-	anti-sigma-28 factor FlgM	NA	NA	NA	NA	NA
WP_013575162.1|1996587_1997370_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_013575163.1|1997483_1997894_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_013575164.1|1997900_1998305_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_013575165.1|1998316_1999021_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_013575166.1|1999098_2000343_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_013575167.1|2000377_2001133_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_013575168.1|2001154_2001937_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_071823641.1|2002064_2002769_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_013575170.1|2002779_2003886_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
2003393:2003410	attR	GTGACGCCATCAACCGTC	NA	NA	NA	NA
WP_013575171.1|2003885_2004836_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	37.2	4.5e-16
WP_013575172.1|2004976_2006629_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_013575173.1|2006656_2007619_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_013575174.1|2007923_2008619_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 7
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	2756390	2780188	4864217	capsid,tail,head,terminase,plate,holin,portal	Cronobacter_phage(82.61%)	30	NA	NA
WP_083812237.1|2756390_2756831_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.1	1.4e-20
WP_013575830.1|2759540_2760128_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	72.8	6.0e-80
WP_013575831.1|2760120_2761305_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	73.4	2.6e-162
WP_013575832.1|2761297_2761630_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.7	9.1e-33
WP_013575833.1|2761629_2763939_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	45.6	1.8e-167
WP_013575834.1|2764126_2764384_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	55.8	1.7e-18
WP_041688993.1|2764504_2764876_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.5	2.3e-21
WP_013575836.1|2764875_2765217_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	9.9e-43
WP_013575837.1|2765213_2765510_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	55.3	1.0e-19
WP_013575838.1|2765523_2765976_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	65.1	1.6e-51
WP_013575839.1|2765978_2767106_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	69.8	8.7e-144
WP_013575840.1|2767115_2767805_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	65.9	6.6e-78
WP_013575841.1|2767801_2768308_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	49.4	4.0e-40
WP_013575842.1|2768304_2768757_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	61.3	2.0e-46
WP_013575843.1|2768850_2769042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575844.1|2769038_2769752_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	60.3	1.8e-73
WP_013575845.1|2769754_2770789_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	75.4	1.1e-137
WP_013575846.1|2770855_2771695_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.2	1.3e-43
WP_013575847.1|2771835_2773623_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	71.5	6.2e-253
WP_013575848.1|2773619_2774651_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.2	6.1e-136
WP_013575849.1|2774647_2774962_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	54.9	4.3e-24
WP_013575850.1|2774944_2775151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575851.1|2775253_2777410_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	60.1	5.3e-222
WP_013575852.1|2777410_2777671_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_013575853.1|2777744_2778173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575854.1|2778180_2778507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575855.1|2778509_2778713_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_013575856.1|2778722_2779232_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	51.5	1.9e-42
WP_013575857.1|2779264_2779486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013575858.1|2779627_2780188_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.3	1.5e-32
>prophage 8
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	3066407	3074889	4864217		Tupanvirus(33.33%)	9	NA	NA
WP_013576123.1|3066407_3068390_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	2.8e-20
WP_013576124.1|3068389_3069370_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.1e-33
WP_013576125.1|3069369_3070512_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.9	5.0e-30
WP_013576127.1|3070859_3071609_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	7.1e-09
WP_013576128.1|3071628_3072180_-	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	41.6	9.2e-14
WP_013576129.1|3072252_3073260_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_013576130.1|3073413_3073812_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_013576131.1|3074083_3074242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089944.1|3074592_3074889_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
>prophage 9
NC_015061	Rahnella sp. Y9602, complete sequence	4864217	3881726	3951973	4864217	coat,protease,transposase	Acanthocystis_turfacea_chlorella_virus(11.11%)	58	NA	NA
WP_013576221.1|3881726_3882761_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013576869.1|3883819_3884908_-	GDP-mannose 4,6-dehydratase	NA	A7KA64	Acanthocystis_turfacea_chlorella_virus	43.8	3.1e-77
WP_013576870.1|3885059_3886499_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013576871.1|3886668_3887823_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013576872.1|3887908_3889288_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.7	6.9e-34
WP_013576873.1|3889302_3890724_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.2	9.0e-45
WP_013576874.1|3890874_3892098_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013576875.1|3892313_3893309_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013576876.1|3893323_3894481_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013576877.1|3894653_3896825_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_013576878.1|3896845_3897280_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_041689018.1|3897282_3898416_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_013576880.1|3898513_3899944_-	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_041689113.1|3900114_3902205_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_013576882.1|3902204_3902948_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_013576883.1|3902944_3903601_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_013576884.1|3903675_3903891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013576885.1|3904179_3904866_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013576886.1|3904940_3905537_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013576888.1|3906524_3909236_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.8	2.4e-70
WP_013576889.1|3909526_3910612_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013576890.1|3910611_3913677_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	21.1	1.0e-21
WP_013576891.1|3913673_3914639_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_013576892.1|3914702_3914957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013576894.1|3915306_3915963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013576895.1|3916093_3916642_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013576896.1|3916740_3917409_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_013576897.1|3917405_3917729_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_013576898.1|3917779_3919141_-	APC family permease	NA	NA	NA	NA	NA
WP_013576899.1|3919748_3920555_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013576900.1|3920541_3921180_-	LysE family transporter	NA	NA	NA	NA	NA
WP_013576901.1|3921176_3922469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013576902.1|3922624_3923284_+	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_013576903.1|3923438_3924257_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013576904.1|3924256_3925081_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013576905.1|3925125_3926268_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013576906.1|3926356_3928141_-	chitinase	NA	NA	NA	NA	NA
WP_158307034.1|3928430_3928676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013576908.1|3928962_3929904_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013576909.1|3930046_3930589_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	57.2	8.7e-57
WP_013576910.1|3930611_3931058_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013576911.1|3931504_3933586_+	chitinase	NA	Q4KT15	Chrysodeixis_chalcites_nucleopolyhedrovirus	27.8	2.9e-36
WP_013576912.1|3933647_3934544_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013576913.1|3934661_3936158_+	MFS transporter	NA	NA	NA	NA	NA
WP_013576914.1|3936572_3937118_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013576915.1|3937180_3937699_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_013576916.1|3937707_3938253_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013576917.1|3938272_3939070_+	molecular chaperone	NA	NA	NA	NA	NA
WP_013576918.1|3939088_3941536_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_013576919.1|3941532_3942501_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_013576920.1|3942557_3943037_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_013576921.1|3943146_3943800_-	DNA oxidative demethylase AlkB	NA	A0A0H3Y8P5	Apricot_vein_clearing_associated_virus	33.7	7.1e-05
WP_013576922.1|3943937_3944756_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_013576923.1|3944817_3946155_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_013576924.1|3946183_3947527_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_013576925.1|3947523_3948897_-	MFS transporter	NA	NA	NA	NA	NA
WP_013576926.1|3949123_3950284_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013576927.1|3950521_3951973_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.9e-27
>prophage 1
NC_015062	Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence	616549	70599	127977	616549	protease,terminase,holin,integrase,plate,portal,lysis,tail	Enterobacteria_phage(27.66%)	63	101832:101847	121999:122014
WP_071882957.1|70599_70893_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	39.0	1.1e-05
WP_013577767.1|70822_72112_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	60.9	1.6e-37
WP_013577768.1|72170_72407_-	hypothetical protein	NA	Q38624	Escherichia_phage	67.1	5.5e-24
WP_013577769.1|72531_73206_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	37.4	2.9e-25
WP_041689158.1|73207_73522_-	hypothetical protein	NA	E4WL40	Enterobacteria_phage	36.6	1.0e-09
WP_013577770.1|73522_76708_-	host specificity protein J	NA	O64335	Escherichia_phage	82.6	0.0e+00
WP_013577771.1|76768_77347_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.5	7.8e-72
WP_013577772.1|77399_77807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013577773.1|77867_78599_-	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	85.1	1.8e-126
WP_083812249.1|78601_79342_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	85.1	1.3e-95
WP_013577775.1|80259_80616_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	49.1	5.7e-25
WP_013577776.1|80634_82986_-|tail	phage tail tape measure protein	tail	A0A2D1GPC9	Escherichia_phage	41.0	2.8e-136
WP_013577777.1|82966_83281_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	56.3	3.5e-26
WP_013577778.1|83301_83718_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	43.2	5.3e-22
WP_013577779.1|83728_84466_-	Ig-like domain-containing protein	NA	M9NYX0	Enterobacteria_phage	68.5	2.0e-88
WP_013577780.1|84473_84878_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	61.4	3.7e-44
WP_013577781.1|84874_85429_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	59.4	1.2e-53
WP_013577782.1|85440_85716_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	46.2	1.3e-16
WP_013577783.1|85708_86035_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	59.8	2.5e-27
WP_041689178.1|86120_88079_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	74.2	1.2e-276
WP_013577785.1|88128_89607_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	67.5	4.7e-198
WP_013577786.1|89603_89822_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	68.6	8.3e-19
WP_013577787.1|89818_91921_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	72.1	2.2e-310
WP_013577788.1|91920_92409_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	80.2	4.1e-66
WP_013577789.1|92840_93134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577790.1|93130_93634_-|lysis	lysis protein	lysis	S4TP37	Salmonella_phage	38.3	3.8e-22
WP_013577791.1|93626_94166_-	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	69.6	1.7e-68
WP_041689160.1|94165_94372_-|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	76.6	1.2e-22
WP_013577793.1|94804_95860_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	65.1	1.3e-133
WP_013577796.1|96907_97249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577797.1|97968_98790_-	antitermination protein	NA	F1C595	Cronobacter_phage	44.1	2.4e-58
WP_013577798.1|98803_99817_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	43.7	2.4e-76
WP_013577799.1|99968_100724_-	adenine methyltransferase	NA	A0A248SKY3	Klebsiella_phage	66.0	1.5e-75
WP_041689182.1|100720_100903_-	hypothetical protein	NA	G9L685	Escherichia_phage	62.2	1.7e-12
WP_013577801.1|101565_102588_-	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	57.6	4.0e-39
101832:101847	attL	AAGCATTGGCACCTTC	NA	NA	NA	NA
WP_071882959.1|102584_102761_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	52.7	2.8e-09
WP_013577803.1|102944_103451_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	62.3	1.9e-45
WP_013577804.1|103492_103732_-	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	81.4	7.2e-24
WP_037033040.1|103840_104560_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	60.3	6.9e-78
WP_013577806.1|104663_104906_+	hexulose-6-phosphate synthase	NA	K7PH44	Enterobacterial_phage	77.5	5.8e-29
WP_013577807.1|104909_105368_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	56.6	5.3e-47
WP_013577808.1|105367_105763_+	hypothetical protein	NA	A4KWV6	Enterobacteria_phage	56.6	5.4e-40
WP_013577809.1|106274_106484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577810.1|106514_106673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132964301.1|106650_106887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013577811.1|107489_107981_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	44.7	2.0e-36
WP_013577812.1|107982_108279_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	58.9	1.7e-22
WP_013577813.1|108478_108721_+	excisionase	NA	NA	NA	NA	NA
WP_013577814.1|108704_109829_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	51.4	4.0e-104
WP_013577815.1|109903_110575_-	porin	NA	Q1MVN1	Enterobacteria_phage	58.2	1.1e-64
WP_013577816.1|111184_111373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014416542.1|111531_111945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013577817.1|112174_112954_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	1.5e-17
WP_013577818.1|113018_113885_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158307035.1|114305_115742_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013577820.1|116241_116409_+	YhfL family protein	NA	NA	NA	NA	NA
WP_013577821.1|116706_118848_-	5-histidylcysteine sulfoxide synthase	NA	NA	NA	NA	NA
WP_013577822.1|118994_120119_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	26.8	4.6e-28
WP_013577823.1|120525_122073_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	40.0	3.4e-37
121999:122014	attR	GAAGGTGCCAATGCTT	NA	NA	NA	NA
WP_013577824.1|122145_123693_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	3.0e-09
WP_013577825.1|124538_125033_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_014416544.1|125064_126612_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013577827.1|126627_127977_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NC_015062	Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence	616549	541814	584702	616549	capsid,holin,integrase,plate,tail	uncultured_Caudovirales_phage(36.36%)	65	535159:535176	579253:579270
535159:535176	attL	CGGCGTGGATATCAAAAC	NA	NA	NA	NA
WP_013578208.1|541814_542939_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	52.0	1.1e-103
WP_013578209.1|542922_543165_-	excisionase	NA	NA	NA	NA	NA
WP_013578210.1|543243_543747_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	45.2	1.4e-32
WP_148232221.1|543743_546005_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	53.7	5.2e-95
WP_013578212.1|546141_546441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578213.1|546663_546960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578214.1|547108_547264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578215.1|547580_547943_-	hypothetical protein	NA	I6RTG2	Croceibacter_phage	63.4	2.5e-07
WP_013578216.1|548148_548610_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	44.0	3.3e-25
WP_013578217.1|548713_548962_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	43.6	6.2e-10
WP_013578218.1|548972_549437_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	39.8	2.7e-14
WP_013578219.1|549453_549690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578220.1|549686_549854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578221.1|549856_550843_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	36.8	1.7e-42
WP_083812248.1|550751_551279_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	55.9	4.8e-44
WP_013578223.1|551406_551883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578224.1|551875_552298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578225.1|552294_552789_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	60.0	1.6e-17
WP_013578226.1|552785_552974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158307036.1|553078_553234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578228.1|553237_553921_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	48.9	2.0e-50
WP_013578229.1|553917_554121_+	flagellar FlbD family protein	NA	NA	NA	NA	NA
WP_013578230.1|554113_554623_+	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	71.0	3.4e-63
WP_013578231.1|554619_554853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578232.1|554849_555296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578233.1|555295_555478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578234.1|555474_555771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578235.1|555810_555993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578237.1|556511_557108_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	52.8	3.6e-56
WP_013578238.1|557104_557401_+	hypothetical protein	NA	A0A2I7QXN1	Vibrio_phage	55.3	8.1e-25
WP_013578239.1|557397_558072_+	antitermination protein	NA	A0A1W6JP37	Morganella_phage	37.6	8.6e-30
WP_013578240.1|558244_558463_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	54.5	5.2e-13
WP_013578241.1|558465_558996_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	82.2	1.2e-82
WP_013578242.1|558988_559522_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	51.8	2.7e-34
WP_013578244.1|559757_560315_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013578245.1|560383_560566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578246.1|560580_561366_+	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	38.1	1.5e-12
WP_013578247.1|561572_563192_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	82.0	5.8e-274
WP_013578248.1|563191_564643_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	66.6	2.7e-190
WP_148232222.1|564602_565253_+|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	61.1	4.6e-73
WP_013578250.1|565302_566508_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	56.1	1.7e-113
WP_013578251.1|566514_566994_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	59.8	1.9e-47
WP_013578252.1|567006_567951_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	73.1	8.4e-132
WP_013578253.1|568014_568374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578254.1|568339_568756_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	64.4	1.7e-44
WP_013578255.1|568755_569385_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	41.2	3.7e-27
WP_013578256.1|569371_569758_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	72.6	3.2e-45
WP_013578257.1|569750_570296_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.3	1.5e-45
WP_013578258.1|570301_571444_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	73.7	2.2e-155
WP_013578259.1|571453_571894_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	8.9e-60
WP_013578260.1|571897_572326_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	67.2	3.1e-41
WP_013578261.1|572503_574438_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	61.4	5.9e-225
WP_013578262.1|574437_575037_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	65.3	2.3e-58
WP_013578263.1|575037_575346_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.7	5.8e-26
WP_013578264.1|575345_576371_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	50.1	2.0e-94
WP_013578265.1|576370_576712_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	3.9e-23
WP_013578266.1|576739_577126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578267.1|577198_577951_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	68.8	7.2e-94
WP_013578268.1|577952_578306_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	2.9e-45
WP_013578269.1|578305_579505_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	71.4	1.0e-150
579253:579270	attR	CGGCGTGGATATCAAAAC	NA	NA	NA	NA
WP_013578270.1|579501_580272_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	59.4	2.6e-83
WP_013578271.1|580318_582697_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	43.2	7.3e-92
WP_071882962.1|582840_583461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148232223.1|583599_584271_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	52.4	1.7e-14
WP_148232227.1|584324_584702_+|tail	tail fiber assembly protein	tail	A0A0A0YSY3	Erwinia_phage	46.5	3.8e-11
>prophage 1
NC_015063	Rahnella sp. Y9602 plasmid pRAHAQ02, complete sequence	133486	18635	78431	133486	protease,transposase,integrase	Escherichia_phage(26.67%)	47	31323:31337	79938:79952
WP_013573449.1|18635_19640_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013578325.1|19748_19982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578326.1|20019_20415_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_013578327.1|21380_22346_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	48.3	9.3e-70
WP_013578328.1|22354_23554_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	75.0	2.5e-173
WP_013578329.1|23883_24144_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_013578330.1|24140_24386_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_013578331.1|24800_25808_-	replication initiation protein	NA	NA	NA	NA	NA
WP_013578332.1|26736_27372_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	67.3	1.3e-75
WP_013578333.1|27365_27626_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	56.3	1.2e-11
WP_013578334.1|27840_28632_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	62.3	1.6e-30
WP_013578335.1|29182_29968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689225.1|30168_30351_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013578336.1|30773_31391_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
31323:31337	attL	ACCAGTGAAGATGCC	NA	NA	NA	NA
WP_013578337.1|31471_32173_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_013578338.1|32221_34879_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_148232234.1|34918_35500_+	fimbrial protein	NA	NA	NA	NA	NA
WP_013578340.1|35525_36080_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_013578341.1|36177_36963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578342.1|38056_40657_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	46.4	1.8e-91
WP_013578343.1|40769_41150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578345.1|41812_42217_+	DUF4354 family protein	NA	NA	NA	NA	NA
WP_148232240.1|42530_43295_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013578347.1|43287_43773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578348.1|44699_44936_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_013578349.1|45124_45427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578350.1|45646_46027_+	DUF4354 family protein	NA	NA	NA	NA	NA
WP_013578351.1|47511_50913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689228.1|51054_52542_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	37.4	6.7e-67
WP_052300796.1|52499_54746_+	RHS repeat protein	NA	A0A1W5K0N1	Bacteriophage	47.7	3.5e-168
WP_052300797.1|55043_56384_+	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	69.3	1.3e-69
WP_013578353.1|56517_57738_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	61.9	6.9e-70
WP_101377519.1|58302_59476_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.8	2.7e-135
WP_083812251.1|59560_60811_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013578356.1|60795_61833_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013578358.1|62295_63072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578359.1|63382_64336_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041689265.1|64418_65147_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.5	1.3e-20
WP_013578361.1|65689_67180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578362.1|67304_68018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578363.1|68470_69226_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	56.3	1.3e-79
WP_013578364.1|69652_71239_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_013578365.1|71596_73696_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.4	8.6e-36
WP_013578366.1|73688_74963_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_013578367.1|75812_76151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578368.1|76260_76893_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_162470193.1|77687_78431_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	86.1	4.4e-51
79938:79952	attR	ACCAGTGAAGATGCC	NA	NA	NA	NA
