The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020547	Acinetobacter baumannii D1279779, complete sequence	3704284	1107185	1150958	3704284	transposase,capsid,terminase	Acinetobacter_phage(88.24%)	62	NA	NA
WP_000015930.1|1107185_1107443_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	85.7	2.0e-40
WP_000048747.1|1107446_1107731_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	96.8	3.4e-44
WP_000147323.1|1107727_1108135_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654846.1|1108135_1108387_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000183245.1|1108388_1109351_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	83.4	6.1e-146
WP_000206155.1|1109365_1110133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043961180.1|1110144_1110468_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	98.1	9.7e-56
WP_043960897.1|1110470_1110911_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	8.5e-71
WP_000862386.1|1111131_1111413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000212394.1|1111414_1112071_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	63.8	3.1e-69
WP_001077691.1|1112183_1112384_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	68.2	3.1e-20
WP_000041062.1|1112392_1112749_+	hypothetical protein	NA	J7I452	Acinetobacter_phage	98.3	3.9e-58
WP_001095609.1|1112802_1113093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003658.1|1113089_1113824_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	52.9	5.3e-65
WP_001110397.1|1113820_1114771_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.9	1.2e-101
WP_000544507.1|1114763_1115513_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	96.8	1.4e-134
WP_000647822.1|1115509_1115863_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	55.6	1.0e-29
WP_000462876.1|1115855_1116248_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000100165.1|1116247_1116649_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.0e-66
WP_001277128.1|1116645_1117122_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000861102.1|1117093_1117348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001039305.1|1117810_1118155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152665.1|1118363_1118600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136775.1|1119261_1119717_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.7	3.5e-83
WP_002070164.1|1119778_1120213_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	98.6	3.8e-79
WP_015451440.1|1120181_1120823_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	97.2	1.1e-124
WP_015451441.1|1120881_1121352_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	98.7	1.5e-81
WP_015451442.1|1121341_1122769_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	1.6e-251
WP_001286346.1|1122765_1124208_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	89.6	8.3e-256
WP_001030090.1|1124218_1125322_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	88.6	2.1e-187
WP_000965233.1|1125331_1125760_+	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	98.6	1.3e-71
WP_000004359.1|1125858_1126089_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	62.0	3.7e-17
WP_001290161.1|1126110_1126326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589043.1|1126378_1126693_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	51.5	1.1e-14
WP_000770061.1|1126808_1127576_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	96.1	3.6e-117
WP_000214189.1|1127603_1128560_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_000692542.1|1128625_1129291_+	hypothetical protein	NA	J7I4P7	Acinetobacter_phage	95.0	1.8e-109
WP_005135101.1|1129295_1129685_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	94.6	2.6e-63
WP_000524222.1|1129686_1130055_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	99.2	5.9e-65
WP_001276385.1|1130033_1130471_+	hypothetical protein	NA	J7I0W8	Acinetobacter_phage	91.7	2.7e-69
WP_002037239.1|1130442_1130811_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	83.6	5.5e-55
WP_000178914.1|1130812_1131211_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	95.5	4.2e-69
WP_015451444.1|1131279_1131633_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	100.0	9.3e-60
WP_015451445.1|1131632_1132775_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	79.2	3.5e-148
WP_000094263.1|1132827_1133745_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.4	1.1e-165
WP_031959991.1|1133815_1134325_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	83.1	1.9e-61
WP_000335868.1|1134824_1135124_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|1135132_1135591_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_001983384.1|1135695_1135872_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
WP_000523933.1|1135880_1136204_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_015451446.1|1136235_1136916_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	44.7	4.9e-41
WP_001275793.1|1136917_1137181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046579.1|1137311_1142309_+	tape measure protein	NA	A0A220VZA0	Acinetobacter_phage	90.6	0.0e+00
WP_031951484.1|1142859_1143792_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000554193.1|1144070_1144547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005138788.1|1144607_1145006_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368364.1|1145005_1145512_+	DUF1833 family protein	NA	A0A0P0IKN4	Acinetobacter_phage	97.6	1.0e-91
WP_000835169.1|1145508_1145871_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	99.2	9.8e-65
WP_000590472.1|1145863_1149310_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	96.7	0.0e+00
WP_000433918.1|1149378_1149768_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_001076396.1|1150131_1150314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019744.1|1150412_1150958_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	92.8	2.5e-96
>prophage 2
NC_020547	Acinetobacter baumannii D1279779, complete sequence	3704284	1220462	1277306	3704284	tRNA,capsid,integrase,terminase	Acinetobacter_phage(80.0%)	76	1226586:1226606	1274585:1274605
WP_000729980.1|1220462_1221782_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_001077405.1|1221893_1222892_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111768.1|1222935_1223493_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|1223732_1224122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495834.1|1224187_1224754_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	2.4e-25
WP_000906487.1|1224823_1225078_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|1225324_1226605_-	aspartate kinase	NA	NA	NA	NA	NA
1226586:1226606	attL	TTTTGAACGATTAATGCCATA	NA	NA	NA	NA
WP_000362184.1|1226814_1227030_-	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_000609971.1|1227031_1227376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028957.1|1227372_1227582_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
WP_000566310.1|1227578_1227986_-	DUF551 domain-containing protein	NA	A0A0P0I8H3	Acinetobacter_phage	79.0	5.0e-33
WP_000654853.1|1227989_1228235_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	7.4e-40
WP_001061224.1|1228236_1229199_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	85.0	1.3e-148
WP_000215606.1|1229195_1230266_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	51.0	1.0e-48
WP_000064476.1|1230277_1230601_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	99.1	2.6e-56
WP_000656408.1|1230593_1230884_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	97.9	4.6e-49
WP_001101445.1|1230883_1231324_-	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	95.2	1.8e-73
WP_001129676.1|1231531_1232035_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|1232036_1233044_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370481.1|1233095_1233311_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	100.0	8.5e-32
WP_001093654.1|1233325_1234090_-	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	100.0	2.8e-146
WP_000996063.1|1234198_1234450_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	100.0	8.9e-41
WP_000049328.1|1234460_1234781_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	99.1	1.3e-49
WP_001095598.1|1234836_1235112_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
WP_079378776.1|1235183_1235408_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	2.5e-34
WP_000064624.1|1235400_1236282_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.6	3.0e-139
WP_001003676.1|1236284_1237085_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	97.4	4.6e-147
WP_000017854.1|1237081_1237489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778994.1|1237485_1237893_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.8	3.8e-25
WP_043961186.1|1237988_1238207_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	92.6	3.4e-20
WP_000203142.1|1238203_1238608_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.9	5.2e-22
WP_000992308.1|1238610_1239024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958579.1|1239171_1239384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000898317.1|1239892_1240138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000134355.1|1240194_1240386_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	87.3	8.9e-25
WP_015451458.1|1240398_1240833_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	95.1	5.1e-76
WP_015451440.1|1240801_1241443_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	97.2	1.1e-124
WP_000212566.1|1241501_1241972_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_015451459.1|1241961_1243389_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	92.8	2.0e-262
WP_001286344.1|1243385_1244828_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	82.5	8.6e-237
WP_000179747.1|1244834_1245938_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	95.4	2.1e-198
WP_000004549.1|1245934_1246159_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	60.6	5.7e-15
WP_001290164.1|1246180_1246396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589036.1|1246449_1246764_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	4.0e-14
WP_000770063.1|1246872_1247628_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	56.0	1.7e-66
WP_001115624.1|1247645_1248602_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	66.0	1.7e-119
WP_015451460.1|1248645_1249293_+	hypothetical protein	NA	A0A0D4DBW4	Acinetobacter_phage	94.2	6.7e-72
WP_000008499.1|1249297_1249687_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	97.7	6.2e-65
WP_000524229.1|1249688_1250057_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	90.2	2.2e-59
WP_001284679.1|1250095_1250758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539751.1|1251196_1251565_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.0	1.5e-52
WP_001251837.1|1251566_1251965_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	86.4	1.6e-63
WP_001277696.1|1251966_1252185_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749905.1|1252293_1252815_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_015451462.1|1252911_1253265_+	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	93.2	1.9e-57
WP_015451463.1|1253264_1254407_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	79.4	1.6e-148
WP_000094263.1|1254502_1255420_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.4	1.1e-165
WP_031959991.1|1255490_1256000_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	83.1	1.9e-61
WP_000838146.1|1256573_1256756_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_000966688.1|1256848_1257253_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000720074.1|1257334_1257712_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	94.4	2.1e-62
WP_000046540.1|1257813_1262712_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	97.6	0.0e+00
WP_000721054.1|1262803_1263391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000554194.1|1263425_1263902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005138788.1|1263962_1264361_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368364.1|1264360_1264867_+	DUF1833 family protein	NA	A0A0P0IKN4	Acinetobacter_phage	97.6	1.0e-91
WP_000835167.1|1264863_1265226_+	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	98.3	4.4e-65
WP_000590491.1|1265218_1268665_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	97.1	0.0e+00
WP_000433907.1|1268733_1269123_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019394.1|1269165_1269708_+	N-acetylmuramidase	NA	J7I0Y1	Acinetobacter_phage	93.3	1.1e-96
WP_001155220.1|1269971_1270517_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_000767169.1|1270638_1271055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679986.1|1271219_1272518_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.6	1.1e-155
WP_001289323.1|1272521_1273016_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	58.3	4.5e-44
WP_001229161.1|1273177_1274383_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PDI8	Moraxella_phage	50.8	9.4e-104
WP_000199457.1|1274669_1277306_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
1274585:1274605	attR	TTTTGAACGATTAATGCCATA	NA	NA	NA	NA
>prophage 3
NC_020547	Acinetobacter baumannii D1279779, complete sequence	3704284	2194873	2257410	3704284	transposase,holin,coat	Enterobacteria_phage(30.0%)	54	NA	NA
WP_031951484.1|2194873_2195806_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000075447.1|2196421_2197762_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_000509753.1|2198181_2199600_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_001290023.1|2199641_2200670_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001127149.1|2200669_2201800_-	YdcF family protein	NA	NA	NA	NA	NA
WP_001166923.1|2201804_2202839_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000388070.1|2202858_2203362_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_086223191.1|2203659_2204901_-	lactonase family protein	NA	NA	NA	NA	NA
WP_000017880.1|2205132_2206290_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000165801.1|2206289_2206724_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000632992.1|2206772_2209001_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_002046836.1|2209028_2209181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285303.1|2209325_2211416_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.7	8.0e-42
WP_001170323.1|2211589_2213068_-	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	26.2	2.3e-27
WP_000323814.1|2213192_2213771_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000588771.1|2213818_2215078_-	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	23.3	4.0e-12
WP_001097359.1|2215149_2216004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132125.1|2216078_2217470_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_000047943.1|2217705_2219274_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002010078.1|2219339_2219774_-	chlorhexidine efflux PACE transporter AceI	NA	NA	NA	NA	NA
WP_001024734.1|2219864_2220758_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000149844.1|2220888_2221878_+	transaldolase	NA	NA	NA	NA	NA
WP_000467074.1|2221950_2222601_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001169535.1|2223298_2224471_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_000775740.1|2224544_2225264_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-12
WP_000675116.1|2225279_2228036_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.7	1.7e-39
WP_000221476.1|2228599_2229043_-	RDD family protein	NA	NA	NA	NA	NA
WP_001139332.1|2229315_2229489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774578.1|2229667_2229895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109443.1|2230183_2230627_+	universal stress protein	NA	NA	NA	NA	NA
WP_000193585.1|2230886_2232470_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	26.4	1.0e-20
WP_000161254.1|2233012_2233144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031951484.1|2233259_2234192_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000119297.1|2234750_2235806_-	OmpW family protein	NA	NA	NA	NA	NA
WP_001189897.1|2236169_2238326_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001019959.1|2238518_2239025_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000825563.1|2239057_2239441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650375.1|2239615_2239897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123841.1|2240085_2240556_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	1.4e-31
WP_000179474.1|2240968_2241220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000345328.1|2241518_2242754_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_000527030.1|2243206_2245474_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001133121.1|2245536_2246091_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001243509.1|2247031_2247370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000262548.1|2247966_2248464_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000932090.1|2248492_2249050_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000920711.1|2249127_2249811_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000135428.1|2249820_2250582_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001279982.1|2250589_2251276_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000055762.1|2251503_2252523_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_000873953.1|2252513_2254973_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000739314.1|2254982_2255687_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750672.1|2255761_2256292_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_031951484.1|2256477_2257410_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 4
NC_020547	Acinetobacter baumannii D1279779, complete sequence	3704284	2540608	2555405	3704284		Acinetobacter_phage(100.0%)	10	NA	NA
WP_000566784.1|2540608_2541184_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
WP_001189803.1|2541279_2544045_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.3	0.0e+00
WP_000281125.1|2544058_2546791_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.6	0.0e+00
WP_001982145.1|2547146_2548196_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608302.1|2548205_2549012_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	98.9	4.3e-145
WP_000066126.1|2549021_2549717_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164246.1|2549727_2550711_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	95.7	1.9e-182
WP_001076812.1|2550717_2553093_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	99.0	0.0e+00
WP_000893696.1|2553094_2554594_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.2	5.2e-277
WP_001187844.1|2554856_2555405_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
