The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014831	Thermaerobacter marianensis DSM 12885, complete sequence	2844696	12696	54390	2844696	tRNA,protease,head,holin,portal,integrase,tail,capsid	Bacillus_phage(16.67%)	48	14801:14846	59294:59339
WP_013494440.1|12696_13974_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.5	1.1e-86
WP_013494441.1|14219_14489_-	YqhV family protein	NA	NA	NA	NA	NA
14801:14846	attL	GACTACGGATCAGCAGGTCGGGGGTTCAAATCCTCCACGGCGCACC	NA	NA	NA	NA
WP_013494442.1|14937_16047_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	28.1	1.1e-26
WP_013494443.1|16321_16984_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_052299146.1|17319_17784_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013494445.1|17770_18166_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	44.4	2.6e-10
WP_013494446.1|18323_18545_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013494447.1|18861_19359_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013494448.1|19355_19580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494449.1|19594_19948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052299149.1|20063_20453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494451.1|20449_20881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494452.1|20916_21873_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	43.5	9.6e-67
WP_083816675.1|21802_22801_+	recombinase RecT	NA	S6AVW6	Thermus_phage	50.6	9.0e-68
WP_083816789.1|22876_23362_+	septal ring lytic transglycosylase RlpA family protein	NA	I3ULW5	Synechococcus_phage	65.5	8.6e-24
WP_013494455.1|23367_23919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494457.1|24456_24810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494458.1|24811_25123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494459.1|25119_25392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083816790.1|25697_26714_+	HNH endonuclease	NA	A0A1C9EI32	Gordonia_phage	40.5	6.9e-15
WP_013494461.1|26710_27454_+	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	30.2	4.6e-08
WP_013494462.1|27553_27994_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_013494463.1|27990_28221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494464.1|28204_28393_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_013494465.1|28480_29089_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_013494466.1|29051_29510_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013494467.1|29526_30759_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	47.5	4.1e-102
WP_013494468.1|30777_33027_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.9	7.8e-59
WP_013494469.1|33040_34471_+|head,protease	HK97 family phage prohead protease	head,protease	H9YSG6	environmental_Halophage	50.0	1.3e-27
WP_042499933.1|34467_35748_+|capsid	phage major capsid protein	capsid	A0A0K1LLG2	Bacillus_phage	43.7	7.7e-80
WP_013494471.1|36031_36577_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013494472.1|36577_36811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494473.1|36791_37112_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_013494474.1|37104_37596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494475.1|37610_38033_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013494476.1|38036_38459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494477.1|38458_38791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494478.1|38805_39123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494479.1|39123_42270_+|tail	phage tail tape measure protein	tail	A0A166XZ24	Gordonia_phage	42.4	1.1e-55
WP_169312818.1|42317_43706_+|tail	phage tail family protein	tail	A0A2H4JH21	uncultured_Caudovirales_phage	33.8	8.1e-67
WP_013494481.1|43706_45125_+|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	40.8	2.8e-83
WP_013494482.1|45138_45552_+	hypothetical protein	NA	A7KUQ2	Bacillus_phage	38.8	8.4e-20
WP_013494483.1|45564_46818_+	hypothetical protein	NA	A7KUQ3	Bacillus_phage	45.4	4.8e-26
WP_013494484.1|46833_49959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494485.1|49974_51081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494486.1|51094_52453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494487.1|52470_53862_+	DUF1565 domain-containing protein	NA	NA	NA	NA	NA
WP_013494488.1|53934_54390_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	40.0	8.1e-16
59294:59339	attR	GACTACGGATCAGCAGGTCGGGGGTTCAAATCCTCCACGGCGCACC	NA	NA	NA	NA
>prophage 2
NC_014831	Thermaerobacter marianensis DSM 12885, complete sequence	2844696	1939459	1948496	2844696		Bacillus_phage(28.57%)	8	NA	NA
WP_148235729.1|1939459_1940992_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	5.5e-24
WP_013496021.1|1940988_1941258_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_013496022.1|1941355_1942132_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.8	1.1e-44
WP_148235896.1|1942165_1943911_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	8.1e-48
WP_013496024.1|1944423_1945380_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	29.5	9.3e-30
WP_013496025.1|1945502_1946381_+	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	29.9	4.6e-07
WP_042500398.1|1946419_1947385_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.0	7.8e-08
WP_013496027.1|1947539_1948496_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.6	3.2e-38
>prophage 3
NC_014831	Thermaerobacter marianensis DSM 12885, complete sequence	2844696	2204715	2280512	2844696	protease,transposase	Escherichia_phage(28.57%)	57	NA	NA
WP_174266706.1|2204715_2205282_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_013496240.1|2205578_2205779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013496242.1|2206111_2207290_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_013496243.1|2207320_2208253_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_042502053.1|2208298_2209003_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.6	1.1e-19
WP_083816814.1|2209056_2210241_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_013496246.1|2210327_2211401_-	SIS domain-containing protein	NA	A0A2K9KZ81	Tupanvirus	25.0	3.7e-19
WP_013496247.1|2211413_2212163_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_013496249.1|2212472_2213756_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_013496250.1|2213818_2214118_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_013496251.1|2214123_2214591_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_148235745.1|2215056_2215317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013496252.1|2215391_2217041_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_013496253.1|2217160_2218861_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013496254.1|2218872_2219736_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013496255.1|2219961_2220882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013496256.1|2221467_2222166_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_013496257.1|2222242_2223388_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_013496258.1|2223387_2224587_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013496259.1|2224732_2225884_-	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_013496260.1|2225909_2227481_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_013496261.1|2227458_2228562_-	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_013496262.1|2228607_2229951_-	cytosine permease	NA	NA	NA	NA	NA
WP_013496263.1|2230400_2232230_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013496264.1|2232548_2233577_-	NAD(P)-dependent alcohol dehydrogenase	NA	K7Z7U2	Megavirus	26.2	5.3e-23
WP_052299191.1|2233836_2234781_-	iron-sulfur cluster assembly protein	NA	NA	NA	NA	NA
WP_042500488.1|2236582_2237407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013496267.1|2239156_2240599_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_013496268.1|2240644_2242381_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_013496269.1|2242917_2243154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013496270.1|2243297_2244104_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_148235746.1|2244106_2244727_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_169312839.1|2244947_2245313_-	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_042500494.1|2245558_2247622_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_013496274.1|2247593_2248124_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_148235915.1|2248125_2249724_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_013496276.1|2250183_2250558_-	response regulator	NA	NA	NA	NA	NA
WP_013496277.1|2250644_2251127_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_169312840.1|2252616_2252784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148235747.1|2253256_2254501_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_042502062.1|2254401_2255778_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.6	2.1e-54
WP_013496280.1|2256135_2257245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013496281.1|2257231_2258392_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013496282.1|2258397_2259441_-	NDP-sugar synthase	NA	I7I009	Enterobacteria_phage	25.4	1.0e-13
WP_013496283.1|2259887_2261075_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.5e-21
WP_013496284.1|2261088_2261925_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013496285.1|2261914_2262790_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_148235748.1|2262805_2263813_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_013496287.1|2263860_2265201_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169312841.1|2266516_2266696_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013496288.1|2266919_2268716_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_013496289.1|2269532_2270780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013496290.1|2271951_2273088_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169312842.1|2274549_2276355_+	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	31.2	1.2e-09
WP_042500504.1|2276546_2276741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013496292.1|2278084_2278834_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013496293.1|2278895_2280512_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
