The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014830	Intrasporangium calvum DSM 43043, complete sequence	4024382	338194	374885	4024382	integrase,transposase	Bacillus_virus(33.33%)	31	337612:337632	379145:379165
337612:337632	attL	GCCAGCCCAGCGGCATACGGC	NA	NA	NA	NA
WP_013491189.1|338194_339394_+|integrase	site-specific integrase	integrase	A0A059VKS6	Mycobacterium_phage	31.1	3.6e-39
WP_013491190.1|339455_340529_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	32.1	9.6e-07
WP_041307131.1|340525_341461_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041308176.1|341631_341868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491191.1|342186_343491_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_148236449.1|343610_344192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041307134.1|344347_344728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491195.1|346692_346878_-	YegP family protein	NA	NA	NA	NA	NA
WP_148236450.1|346971_347889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491197.1|348316_348871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491198.1|349134_350451_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_013491200.1|352204_353956_+	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_148236704.1|354355_355909_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	40.2	2.7e-95
WP_169312899.1|356186_356345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491203.1|356357_356603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491204.1|356599_357121_-	C-type lectin domain protein	NA	NA	NA	NA	NA
WP_013491205.1|357681_358581_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_013491206.1|358921_359554_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013491207.1|359550_359928_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_013491208.1|360849_361059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491209.1|361064_362834_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013491210.1|363032_364058_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013491211.1|364084_365692_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013491212.1|365780_366656_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013491213.1|366657_367500_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013491214.1|367496_368576_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.6	1.8e-21
WP_013491215.1|368580_369663_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	9.3e-18
WP_041308191.1|370078_370543_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	37.4	5.7e-17
WP_052337944.1|370917_371568_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013491217.1|371621_373232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148236706.1|373490_374885_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
379145:379165	attR	GCCGTATGCCGCTGGGCTGGC	NA	NA	NA	NA
>prophage 2
NC_014830	Intrasporangium calvum DSM 43043, complete sequence	4024382	851479	865174	4024382	integrase,transposase	Mycobacterium_phage(100.0%)	11	842827:842843	870209:870225
842827:842843	attL	GATCGCGAGGACGAGGT	NA	NA	NA	NA
WP_083807852.1|851479_852145_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148236732.1|852220_853981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491643.1|853992_854316_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013491644.1|854320_855421_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041307248.1|855510_855834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148236467.1|856180_857476_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_114609403.1|858514_860317_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_052337967.1|860602_860923_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.8	7.9e-26
WP_169312902.1|861038_861197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491425.1|862396_863659_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_148236734.1|863923_865174_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
870209:870225	attR	ACCTCGTCCTCGCGATC	NA	NA	NA	NA
>prophage 3
NC_014830	Intrasporangium calvum DSM 43043, complete sequence	4024382	937919	990035	4024382	integrase,protease,transposase	Acidithiobacillus_phage(16.67%)	43	933158:933178	1000755:1000775
933158:933178	attL	CGTATGCCGCTGGGCCGGCTC	NA	NA	NA	NA
WP_013491709.1|937919_939683_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	26.4	8.0e-27
WP_013491710.1|939679_940516_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.3	6.9e-21
WP_013491711.1|940895_941486_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013491712.1|941485_941887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491713.1|943315_943927_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013491714.1|943923_944916_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041307261.1|945141_945549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491716.1|945619_945865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491717.1|945875_946112_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_052337969.1|946215_947154_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013491719.1|947371_948025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083807853.1|948338_948545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491720.1|948666_949656_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059T688	Listeria_phage	25.2	1.8e-07
WP_013491721.1|949652_950579_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083807854.1|950575_952237_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1SGM4	Mycobacterium_phage	26.8	6.6e-07
WP_013491425.1|953004_954267_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_013491723.1|954544_956038_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.9	4.1e-48
WP_174411510.1|956409_957240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013491724.1|957547_958879_-	UDP-glucuronosyl/UDP-glucosyltransferase	NA	NA	NA	NA	NA
WP_013491725.1|958963_959635_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148236740.1|959833_962899_+	zinc carboxypeptidase	NA	NA	NA	NA	NA
WP_013491727.1|963043_967231_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_013491728.1|967312_967726_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013491729.1|967835_968201_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_013491730.1|968350_969163_-	flagella basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_013491731.1|969162_970014_-	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_013491732.1|970188_970668_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_169312945.1|970676_972218_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_148236741.1|972399_974955_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_013491735.1|974983_975649_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013491736.1|975706_978364_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A1V0SLA1	Klosneuvirus	36.9	3.5e-50
WP_013491737.1|978528_979041_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_114609459.1|979033_979588_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_013491739.1|979633_980269_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041307263.1|980339_981470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114610978.1|981480_982488_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013491742.1|982682_983513_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_041308396.1|983626_985003_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_013491744.1|985073_986120_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_013491745.1|986116_986284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013491746.1|986358_987090_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013491747.1|987464_989069_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_013491748.1|989198_990035_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1000755:1000775	attR	GAGCCGGCCCAGCGGCATACG	NA	NA	NA	NA
>prophage 4
NC_014830	Intrasporangium calvum DSM 43043, complete sequence	4024382	3870249	3918097	4024382	holin,integrase,transposase	Gordonia_phage(14.29%)	51	3869343:3869361	3880734:3880752
3869343:3869361	attL	GCTCGCGGCGATGTGACGC	NA	NA	NA	NA
WP_013494287.1|3870249_3871545_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052338053.1|3871614_3872079_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013494289.1|3872216_3872495_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013494290.1|3872491_3872758_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_148236667.1|3872928_3873615_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	39.6	1.3e-30
WP_148236513.1|3875039_3876301_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	60.6	7.3e-99
WP_013491643.1|3876793_3877117_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013491644.1|3877121_3878222_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041307934.1|3878311_3878635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013494293.1|3878839_3879244_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_148236669.1|3879345_3880056_-	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_013494295.1|3880422_3880647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013494296.1|3880822_3881446_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3880734:3880752	attR	GCTCGCGGCGATGTGACGC	NA	NA	NA	NA
WP_169312936.1|3881605_3881779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013494298.1|3882068_3883088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494299.1|3883252_3883789_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013491425.1|3883908_3885171_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_013494300.1|3885302_3885545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041307937.1|3885541_3885790_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041309029.1|3886806_3887430_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_013494303.1|3887441_3888527_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013494304.1|3888523_3889057_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_013494305.1|3889067_3890144_-	stilbene synthase	NA	NA	NA	NA	NA
WP_169312964.1|3890231_3891017_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_052338142.1|3892239_3893364_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_041309034.1|3893562_3894339_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_013494310.1|3894561_3895194_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013494311.1|3895294_3896473_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_083808001.1|3896564_3896900_+	antitoxin	NA	NA	NA	NA	NA
WP_148236671.1|3897109_3898039_+	protein kinase	NA	H2ECD5	Megavirus	26.4	8.2e-15
WP_013494314.1|3898043_3899309_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013494315.1|3899672_3901058_-	GTPase	NA	NA	NA	NA	NA
WP_013494316.1|3901247_3902462_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	6.5e-20
WP_013494317.1|3902511_3902859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013494318.1|3903088_3904168_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_013494319.1|3904202_3907052_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.0	5.6e-70
WP_013494320.1|3907048_3907735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013494321.1|3907801_3908119_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_013494322.1|3908306_3908981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013494323.1|3909134_3909398_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_013494324.1|3909424_3909796_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013494325.1|3909916_3910135_+	DUF2510 domain-containing protein	NA	NA	NA	NA	NA
WP_013494326.1|3910234_3910645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494327.1|3910965_3911586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494328.1|3911596_3912337_-	trypsin-like peptidase domain-containing protein	NA	B4UTS4	Rhizobium_phage	33.3	5.4e-09
WP_041307941.1|3912338_3912917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041307942.1|3913014_3914016_+	ERCC4 domain-containing protein	NA	NA	NA	NA	NA
WP_041309042.1|3914035_3914560_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_013494333.1|3914974_3916483_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.7	3.0e-38
WP_013494334.1|3916730_3917657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013494335.1|3917653_3918097_+|holin	phage holin family protein	holin	NA	NA	NA	NA
