The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016602	Vibrio furnissii NCTC 11218 chromosome 1, complete sequence	3294546	347293	406203	3294546	holin,tRNA	Natrialba_phage(14.29%)	52	NA	NA
WP_004728720.1|347293_348655_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014204174.1|348723_349053_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014204175.1|349046_349457_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014204176.1|349514_350228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014204177.1|350238_350880_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_014204178.1|350876_351464_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014204179.1|351473_352448_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_014204180.1|352541_355958_-|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_014204181.1|356042_357191_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014204182.1|357206_357464_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_148227969.1|357489_359124_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_014204184.1|359183_359462_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014204185.1|359473_359758_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014204186.1|359778_360057_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014204187.1|360739_361246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014204188.1|361248_362046_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014204189.1|362715_363150_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004728718.1|363638_365534_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_014204190.1|365533_366169_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014204191.1|366184_366958_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.9	1.1e-17
WP_014204192.1|366981_367863_+	ParB/RepB/Spo0J family partition protein	NA	A0A2K9V477	Faecalibacterium_phage	32.2	9.6e-13
WP_041942458.1|368050_368440_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004728713.1|368448_369261_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002540812.1|369320_369575_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_041942459.1|369653_370124_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004728711.1|370139_370673_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_038152645.1|370686_372228_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004728709.1|372271_373138_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004728708.1|373172_374576_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004728707.1|374594_375017_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_041942460.1|375170_376532_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	34.3	1.7e-29
WP_041942657.1|376566_377301_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041942461.1|377397_378171_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004728703.1|378262_379465_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014204198.1|379618_380524_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004728701.1|380578_381742_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_014204199.1|381767_383939_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_004728699.1|384156_384780_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.9	1.2e-22
WP_004728698.1|384813_386271_+	potassium transporter	NA	NA	NA	NA	NA
WP_014204200.1|386281_386806_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_014204201.1|393139_394522_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004724280.1|394660_395044_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.6	1.4e-08
WP_014204202.1|395304_397254_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_014204203.1|397257_398460_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_014204204.1|398446_399256_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_014204205.1|399252_399459_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_004724285.1|399464_400235_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014204206.1|400231_401344_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_014204207.1|401466_402651_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.2	2.4e-27
WP_014204208.1|402647_403490_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_041942658.1|403541_404459_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_014204210.1|404481_406203_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	32.7	8.8e-63
>prophage 2
NC_016602	Vibrio furnissii NCTC 11218 chromosome 1, complete sequence	3294546	1103167	1109711	3294546		Staphylococcus_phage(66.67%)	7	NA	NA
WP_172475410.1|1103167_1104301_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.6	2.5e-66
WP_014204549.1|1104312_1105563_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.9	9.2e-94
WP_014204550.1|1105665_1106115_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_014204551.1|1106128_1107238_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.0	1.5e-42
WP_014204552.1|1107240_1107897_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	2.1e-33
WP_004724911.1|1107938_1109048_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	7.0e-61
WP_004724909.1|1109240_1109711_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
>prophage 3
NC_016602	Vibrio furnissii NCTC 11218 chromosome 1, complete sequence	3294546	2579554	2632096	3294546	tail,terminase,portal,head,tRNA,integrase,plate,capsid	Vibrio_phage(76.32%)	61	2617392:2617405	2636923:2636936
WP_014205445.1|2579554_2580256_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014205446.1|2580264_2582193_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.8	7.8e-92
WP_004726590.1|2582424_2582625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726591.1|2582917_2583751_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	3.7e-14
WP_014205447.1|2583826_2585830_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_014205448.1|2586043_2587894_+	signal peptide peptidase SppA	NA	V5Q7L6	Xylella_phage	29.1	6.9e-13
WP_004726595.1|2588027_2589041_+	asparaginase	NA	NA	NA	NA	NA
WP_004726596.1|2589116_2589401_-	YeaC family protein	NA	NA	NA	NA	NA
WP_038151480.1|2589512_2590334_+	DUF2989 domain-containing protein	NA	NA	NA	NA	NA
WP_004726598.1|2590365_2590782_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_014205449.1|2591120_2592116_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014205450.1|2592380_2593265_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_014205451.1|2593347_2594178_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_041942587.1|2594254_2595190_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_004726603.1|2595323_2595677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014205453.1|2596007_2596916_-	SEC-C domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	33.1	6.8e-30
WP_148227984.1|2597696_2598617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014205455.1|2598709_2598907_-	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	76.6	6.4e-18
WP_041942589.1|2598908_2599604_-	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	83.5	9.3e-112
WP_014205457.1|2599594_2600284_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	86.9	7.7e-119
WP_014205458.1|2600304_2600841_-	hypothetical protein	NA	A0A2I7RNK5	Vibrio_phage	85.9	3.6e-79
WP_041942590.1|2600844_2601114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041942703.1|2603506_2604076_-	hemolysins-related protein	NA	A0A2I7RNJ4	Vibrio_phage	83.1	1.0e-92
WP_014205462.1|2604095_2605283_-|plate	baseplate J/gp47 family protein	plate	A0A2I7RNJ7	Vibrio_phage	82.8	2.0e-191
WP_014205463.1|2605275_2605608_-	DUF2590 family protein	NA	A0A2I7RNH9	Vibrio_phage	81.3	7.4e-43
WP_014205464.1|2605607_2607494_-|tail	phage tail tape measure protein	tail	A0A1D9C9V3	Salinivibrio_phage	60.7	9.2e-231
WP_014205465.1|2607504_2607648_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	51.1	5.3e-06
WP_014205466.1|2607689_2607953_-|tail	putative phage tail assembly chaperone	tail	A0A2I7RNJ9	Vibrio_phage	54.0	3.2e-17
WP_014205467.1|2607949_2608228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014205468.1|2608228_2608813_-	hypothetical protein	NA	A0A1D9CA16	Salinivibrio_phage	60.8	3.4e-59
WP_041942591.1|2608818_2609241_-	hypothetical protein	NA	A0A2I7RB50	Vibrio_phage	62.6	4.7e-42
WP_041942592.1|2609248_2609455_-	TraR/DksA C4-type zinc finger protein	NA	A0A2I7RNJ6	Vibrio_phage	64.7	8.7e-18
WP_014205470.1|2609467_2609923_-	DUF2597 family protein	NA	A0A2I7RNI0	Vibrio_phage	90.1	2.7e-75
WP_014205471.1|2609926_2611048_-	DUF2586 domain-containing protein	NA	A0A2I7RNI8	Vibrio_phage	81.4	1.1e-173
WP_014205472.1|2611070_2611739_-	hypothetical protein	NA	A0A1D9C9S1	Salinivibrio_phage	41.4	2.0e-39
WP_014205473.1|2611728_2612214_-|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	72.6	1.6e-62
WP_014205474.1|2612210_2612630_-|head	head completion/stabilization protein	head	A0A2I7RNH7	Vibrio_phage	73.4	7.2e-51
WP_014205475.1|2612746_2613457_-|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	76.1	4.7e-103
WP_014205476.1|2613467_2614478_-|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	60.4	3.5e-104
WP_014205477.1|2614477_2615380_-|capsid	GPO family capsid scaffolding protein	capsid	R9TRS3	Vibrio_phage	66.8	3.4e-106
WP_014205478.1|2615551_2617375_+|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	85.4	3.9e-295
WP_014205479.1|2617371_2618403_+|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	84.5	7.7e-171
2617392:2617405	attL	TACCGACACCGCGC	NA	NA	NA	NA
WP_014205480.1|2618407_2619193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075989875.1|2619345_2619597_+	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	84.3	2.8e-34
WP_014205482.1|2619591_2619810_-	hypothetical protein	NA	Q8HA64	Vibrio_phage	90.3	7.5e-28
WP_014205484.1|2620483_2621278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041942594.1|2621267_2621690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014205485.1|2621700_2624604_-	replication endonuclease	NA	R9TNQ0	Vibrio_phage	51.9	4.7e-250
WP_014205486.1|2624677_2624914_-	hypothetical protein	NA	R9TPY7	Vibrio_phage	82.1	1.6e-31
WP_014205487.1|2624895_2625363_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	35.1	2.2e-08
WP_014205488.1|2625359_2625656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041942595.1|2625738_2626023_-	hypothetical protein	NA	R9TPY3	Vibrio_phage	57.4	4.4e-20
WP_014205490.1|2626034_2626574_-	phage regulatory CII family protein	NA	R9TRR3	Vibrio_phage	58.1	9.8e-53
WP_041942596.1|2626684_2626885_-	hypothetical protein	NA	A0A2I7RNG9	Vibrio_phage	51.5	3.1e-12
WP_049781801.1|2627041_2627695_+	helix-turn-helix domain-containing protein	NA	R9TR74	Vibrio_phage	65.3	6.5e-75
WP_049781803.1|2627717_2628140_+	hypothetical protein	NA	R9TPX9	Vibrio_phage	56.1	4.5e-37
WP_014205494.1|2628168_2628357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014205495.1|2628410_2629526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041942597.1|2629522_2629939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049781805.1|2629942_2630641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014205497.1|2631037_2632096_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7RNH5	Vibrio_phage	86.5	2.8e-176
2636923:2636936	attR	TACCGACACCGCGC	NA	NA	NA	NA
>prophage 4
NC_016602	Vibrio furnissii NCTC 11218 chromosome 1, complete sequence	3294546	2890181	2897225	3294546		Megavirus(16.67%)	9	NA	NA
WP_004729403.1|2890181_2890613_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	38.3	4.4e-19
WP_004729404.1|2890679_2891972_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.1	1.7e-34
WP_004729407.1|2892148_2892343_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004729409.1|2892398_2892737_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_014205650.1|2892750_2894604_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.5	4.2e-111
WP_014205651.1|2894625_2895141_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004729414.1|2895207_2895531_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
WP_004729416.1|2895590_2895974_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	9.1e-53
WP_004729418.1|2896010_2897225_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.2	6.3e-31
>prophage 5
NC_016602	Vibrio furnissii NCTC 11218 chromosome 1, complete sequence	3294546	3106307	3117454	3294546	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_014205774.1|3106307_3108890_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.7	1.3e-78
WP_014205775.1|3109077_3109548_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004723845.1|3109642_3110695_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	6.3e-112
WP_014205776.1|3110867_3111356_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	3.4e-28
WP_014205777.1|3111440_3114002_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	1.5e-34
WP_004723838.1|3114070_3115060_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
WP_014205778.1|3115132_3116068_-	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	31.7	3.0e-12
WP_014205779.1|3116067_3116694_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	1.7e-35
WP_004723832.1|3116686_3117454_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	1.5e-67
>prophage 1
NC_016628	Vibrio furnissii NCTC 11218 chromosome 2, complete sequence	1621862	380415	413210	1621862	capsid,head,terminase,portal,plate,integrase,tail	Vibrio_phage(22.22%)	45	380312:380332	415203:415223
380312:380332	attL	CCCGCCCATTGGCGGGTTTTT	NA	NA	NA	NA
WP_014257419.1|380415_381420_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	49.7	8.2e-85
WP_014257420.1|381747_382836_+	ParA family protein	NA	NA	NA	NA	NA
WP_193386124.1|382825_382966_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_041943166.1|382986_383490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257421.1|383526_384813_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_193386118.1|384827_384920_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_041943168.1|385020_385428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193386119.1|385488_386214_-	peptidase	NA	M4MB93	Vibrio_phage	29.6	3.4e-24
WP_004726785.1|386364_386823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257423.1|386880_387420_+	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	57.0	3.4e-53
WP_004726788.1|387429_387762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020433788.1|387834_388146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257424.1|388127_388355_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	72.0	2.5e-26
WP_041943172.1|388490_388871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014257425.1|388913_391544_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	59.0	2.3e-296
WP_014257426.1|391553_391790_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_014257427.1|391947_392571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257428.1|392892_394083_+	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004726803.1|394079_395018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004726805.1|395010_395586_+|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	30.5	1.3e-10
WP_014257429.1|395582_395969_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_014257430.1|395965_397012_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	24.2	5.6e-12
WP_014257431.1|396993_397473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257432.1|397469_398552_+|tail	phage tail protein	tail	A0A193H2T9	Shigella_phage	36.7	4.0e-13
WP_041943175.1|398551_399478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257434.1|399594_400011_+	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	50.0	4.2e-27
WP_004726817.1|400021_400252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004726819.1|400242_400494_+	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	45.2	1.2e-08
WP_014257436.1|401203_402115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014257437.1|402537_403155_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	58.7	2.7e-22
WP_193386120.1|403305_403464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041943177.1|403453_404047_+	Fic family protein	NA	S4TP71	Salmonella_phage	29.5	7.4e-09
WP_014257439.1|404068_405025_-|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	42.4	7.3e-59
WP_014257440.1|405035_406760_-|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	5.5e-113
WP_014257441.1|406930_407758_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	33.8	9.3e-18
WP_014257442.1|407800_408838_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.4	1.1e-63
WP_014257443.1|408946_409396_+|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_014257444.1|409395_409860_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014257445.1|409856_410396_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_014257446.1|410396_410579_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_014257447.1|410575_411709_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	38.7	9.0e-48
WP_004726844.1|411712_412078_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_014257448.1|412088_412796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014257449.1|412779_413067_+|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	39.3	4.8e-06
WP_014257450.1|413102_413210_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
415203:415223	attR	CCCGCCCATTGGCGGGTTTTT	NA	NA	NA	NA
>prophage 2
NC_016628	Vibrio furnissii NCTC 11218 chromosome 2, complete sequence	1621862	938368	946018	1621862		Clostridium_phage(16.67%)	9	NA	NA
WP_041943260.1|938368_938986_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	36.1	2.5e-20
WP_014257811.1|939177_939822_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.8	2.5e-18
WP_014257812.1|940066_940657_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014257813.1|940796_941768_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	5.3e-65
WP_004727460.1|941784_942111_-	thiol reductase thioredoxin	NA	A0A023NHA9	Dinoroseobacter_phage	33.0	9.0e-09
WP_081454240.1|942211_942535_-	thioredoxin fold domain-containing protein	NA	A0A2K9L3H4	Tupanvirus	29.5	6.4e-07
WP_004727458.1|942546_942975_-	OsmC family protein	NA	NA	NA	NA	NA
WP_041943262.1|943015_944200_-	MFS transporter	NA	NA	NA	NA	NA
WP_004727456.1|944623_946018_-	dihydrolipoyl dehydrogenase	NA	G3MA85	Bacillus_virus	25.1	1.8e-05
>prophage 3
NC_016628	Vibrio furnissii NCTC 11218 chromosome 2, complete sequence	1621862	974841	982050	1621862		Escherichia_phage(66.67%)	7	NA	NA
WP_014257837.1|974841_976155_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	2.5e-17
WP_014257838.1|976397_977198_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	47.0	1.0e-53
WP_014257839.1|977464_978370_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	73.2	1.5e-109
WP_014257840.1|978372_979629_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.2	8.5e-132
WP_014257841.1|979625_980258_+	aldolase	NA	A0A077SK32	Escherichia_phage	62.1	4.0e-69
WP_014257842.1|980257_981034_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_014257843.1|981078_982050_+	SDR family oxidoreductase	NA	A0A0G3FXV3	Raccoon_poxvirus	28.6	1.6e-05
