The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017635	Escherichia coli W, complete sequence	4900968	197062	270411	4900968	plate,transposase,tRNA,protease	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001346129.1|197062_198415_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198444_200877_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200998_201484_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201487_202513_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202617_203073_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203076_203865_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203864_205013_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205009_205606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205642_209125_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209137_210097_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|210195_212337_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212393_212783_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212847_214146_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214194_214455_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214441_214642_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214807_215353_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215349_215772_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215785_216496_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|216650_217475_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217528_219247_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219357_220065_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220061_220466_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220583_221399_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221438_222092_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222084_223116_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223303_223879_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997038.1|229637_230441_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|230437_231352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231592_232393_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211687.1|232470_233241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233288_234647_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|234718_235474_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235507_236230_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236226_236694_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236758_237490_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|238029_238815_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|238951_239431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|239440_240355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240398_240881_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|240904_242257_-	membrane protein	NA	NA	NA	NA	NA
WP_122986077.1|242267_245702_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|245810_247223_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|247227_247971_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614350.1|247967_250775_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000343298.1|250783_251545_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|251549_252881_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252883_253408_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253404_254685_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254709_255792_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|255755_257606_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257609_258023_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|258029_259505_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259555_259780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|259814_260315_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|261012_261531_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103316.1|261740_263882_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001350059.1|263957_268007_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|267966_268404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420794.1|269274_270411_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017635	Escherichia coli W, complete sequence	4900968	292364	332044	4900968	tail,head,plate,transposase	Escherichia_phage(58.49%)	54	NA	NA
WP_000859525.1|292364_292760_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_000514023.1|292914_293610_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_001300256.1|293560_293749_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905064.1|293843_294425_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001171277.1|294529_295498_+	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	88.4	4.2e-163
WP_000972119.1|295500_296028_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000972171.1|296056_296590_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_000499359.1|296592_298059_-|tail	tail fiber protein	tail	A0A0C4UQS2	Shigella_phage	96.7	3.5e-246
WP_000301695.1|298058_298601_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331815.1|298591_299674_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000130548.1|299674_300112_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|300108_300702_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072824.1|300689_301829_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461070.1|301821_303309_-	DMT family permease	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000147074.1|303313_305386_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000344073.1|305530_305965_-	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000918402.1|305974_306331_-|tail	tail protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_001280310.1|306340_307828_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_001438403.1|307824_308028_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.1e-28
WP_000888926.1|308014_308563_-	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001104973.1|308562_308988_-	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000017158.1|308984_309395_-	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_000637410.1|309461_310379_-|head	head protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000716025.1|310375_311461_-	hypothetical protein	NA	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_001350023.1|311657_312128_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_001136431.1|312124_313444_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_000532638.1|313424_314963_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001097325.1|314962_316618_-	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000375394.1|316625_317201_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_000606409.1|317212_317503_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000364295.1|317499_317799_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_001001316.1|317798_317993_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_001350022.1|318151_318538_-	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_000907405.1|318521_319037_-	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001163387.1|319131_319554_-	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000004161.1|319695_320058_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_000515807.1|320050_320269_-	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000133853.1|320346_320736_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000091782.1|320732_321284_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000431116.1|321354_321621_+	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_001058561.1|321559_321862_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000429765.1|321863_322046_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_000465551.1|322032_322563_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000227260.1|322562_323093_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_001107930.1|323191_323716_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_000255655.1|323735_324035_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	99.0	2.8e-49
WP_001101152.1|324035_324455_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_001151288.1|324469_324733_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_000968312.1|324977_325205_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001026710.1|325220_326159_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000424754.1|326197_328189_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_000337186.1|328190_328418_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_001474801.1|328653_329178_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001143092.1|329599_332044_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 3
NC_017635	Escherichia coli W, complete sequence	4900968	927955	995867	4900968	plate,portal,integrase,terminase,head,tail,lysis,capsid,transposase	Salmonella_phage(73.91%)	74	952090:952107	970167:970184
WP_000399648.1|927955_928936_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|929191_930457_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|930608_931424_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|931569_934002_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|934007_934907_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350053.1|935037_935700_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	8.2e-25
WP_000829261.1|935775_936525_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397383.1|936524_937760_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|937963_938929_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001296993.1|938915_940787_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090130.1|940806_942345_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|942362_943283_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236037.1|943285_944197_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|944374_946723_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|946730_948059_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|948105_949431_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|949643_950027_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555030.1|950137_951253_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|951249_951876_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
952090:952107	attL	TATTTTTTTTGAATGGAT	NA	NA	NA	NA
WP_000195961.1|952122_953325_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|953371_954130_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|954187_954784_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|955068_956301_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480893.1|956341_956626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|956711_957527_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|957526_958735_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|958818_959355_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_000290919.1|959459_960512_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.8	2.1e-107
WP_000350737.1|960592_962044_-	NTPase KAP	NA	R9TRQ8	Vibrio_phage	29.7	1.8e-45
WP_000646893.1|962044_962695_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.2	4.2e-34
WP_001069047.1|962754_962958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460867.1|963023_963533_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.0e-75
WP_000956172.1|963540_963837_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000934004.1|963922_964171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963473.1|964252_964594_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244226.1|964661_964895_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|964894_965122_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104176.1|965118_965976_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_000017523.1|965972_968387_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_001154431.1|968539_968728_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|968738_968972_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|969164_969500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818977.1|970032_971814_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
970167:970184	attR	ATCCATTCAAAAAAAATA	NA	NA	NA	NA
WP_000520345.1|971854_972880_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
WP_001098438.1|972879_974646_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|974788_975622_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742510.1|975638_976697_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|976700_977351_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|977446_977911_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868174.1|977910_978114_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000171568.1|978117_978333_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069915.1|978313_978826_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
WP_000727853.1|978827_979205_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080936.1|979201_979630_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.0	4.6e-45
WP_001039935.1|979725_980157_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829153.1|980149_980596_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	1.9e-57
WP_000339827.1|980651_981521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993765.1|981643_982222_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000177597.1|982218_982578_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000268312.1|982564_983473_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
WP_001086814.1|983465_984071_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000104786.1|984067_985459_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	77.9	5.1e-162
WP_085947772.1|985478_986692_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000378634.1|986872_987478_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	1.9e-97
WP_001145387.1|987477_987981_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.0	4.7e-49
WP_000905033.1|988011_988578_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046154.1|988720_989893_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207659.1|989902_990418_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|990472_990775_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|990789_990909_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282753.1|990901_993979_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980390.1|993975_994461_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_001011811.1|994457_995558_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	2.5e-175
WP_000972391.1|995648_995867_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 4
NC_017635	Escherichia coli W, complete sequence	4900968	1495101	1551643	4900968	holin,integrase,tRNA,terminase,tail,plate	Escherichia_phage(75.44%)	64	1495926:1495941	1553917:1553932
WP_001307164.1|1495101_1496334_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1495926:1495941	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000387388.1|1496588_1497572_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123740.1|1498049_1499423_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157422.1|1499551_1500487_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000040852.1|1500538_1501774_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1501775_1501991_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1502069_1502279_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1502271_1502466_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1502522_1503332_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105152.1|1503324_1505925_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_001349884.1|1506026_1506302_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_000245530.1|1506376_1506553_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	6.3e-25
WP_000560220.1|1506546_1506768_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001169153.1|1507188_1507341_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000233319.1|1507771_1508191_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1508270_1508525_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1508521_1508944_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1508956_1509814_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788973.1|1509820_1510567_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450660.1|1510589_1511351_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_001151237.1|1511366_1511789_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000228824.1|1511972_1513100_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000569066.1|1513092_1514202_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000064766.1|1514198_1515176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813259.1|1515806_1515962_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000940320.1|1516430_1517030_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228041.1|1517029_1517320_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000640164.1|1517316_1517853_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_001349882.1|1519123_1519516_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000950573.1|1519505_1519781_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_000014545.1|1519783_1520161_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_133301706.1|1520175_1520358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291099.1|1520762_1521551_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_001204039.1|1521543_1522476_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_000126790.1|1522453_1522663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089432.1|1522666_1523758_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000021163.1|1523747_1525076_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_000807710.1|1525094_1526531_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.2e-266
WP_024190735.1|1526589_1527309_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
WP_000059667.1|1527289_1528612_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_001349881.1|1528604_1529222_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_001272365.1|1529236_1530265_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_000780861.1|1530322_1530793_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|1530792_1531233_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762302.1|1531229_1531670_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_001139506.1|1531656_1532601_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000506600.1|1532600_1533938_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_000613371.1|1533961_1534393_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000703979.1|1534389_1535007_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000016439.1|1535070_1537059_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000056323.1|1537062_1537731_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000209259.1|1537727_1537994_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_001271172.1|1537993_1539001_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000063616.1|1539000_1539714_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001261334.1|1540410_1540758_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_000733802.1|1541148_1541688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349878.1|1541709_1542936_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_001199732.1|1542919_1543546_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_000600270.1|1543542_1545096_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_000902859.1|1545098_1545644_+|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000117760.1|1545667_1548808_+	shikimate transporter	NA	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000701877.1|1548822_1549395_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_001082294.1|1549934_1550369_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837909.1|1550509_1551643_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
1553917:1553932	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 5
NC_017635	Escherichia coli W, complete sequence	4900968	1748391	1806777	4900968	portal,integrase,tail,terminase,head,lysis,capsid,transposase	Enterobacteria_phage(47.17%)	77	1779038:1779053	1811473:1811488
WP_000527779.1|1748391_1749852_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_000347482.1|1749940_1751224_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1751828_1751942_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1752010_1752244_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1752560_1753151_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1753248_1753824_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279140.1|1753823_1756898_-	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233072.1|1756962_1757562_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000033679.1|1757632_1761046_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090891.1|1761106_1761739_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001349921.1|1761675_1762419_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_001152622.1|1762424_1763123_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847360.1|1763122_1763452_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_000840335.1|1763448_1766010_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000459457.1|1766002_1766437_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479150.1|1766418_1766841_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_001349920.1|1766856_1767597_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|1767604_1768000_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|1767996_1768575_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000753007.1|1768586_1768940_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158921.1|1768951_1769350_-	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000063280.1|1769391_1770417_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001295978.1|1770472_1770805_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123305.1|1770814_1772134_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001349919.1|1772114_1773716_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000198149.1|1773712_1773919_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|1773915_1775841_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|1775815_1776361_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1776749_1776983_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1777040_1777451_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1777602_1777776_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1777947_1778103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1778182_1778248_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1778250_1778439_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1778449_1778662_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1779024_1779522_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
1779038:1779053	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|1779518_1780052_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1780048_1780360_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1780364_1780580_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1781333_1781549_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1781849_1782062_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1782116_1782206_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1782483_1783236_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|1783249_1784299_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|1784300_1784579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1784645_1784897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1785113_1785269_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1785340_1785628_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1785627_1785867_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1785891_1786197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1786399_1786732_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1787168_1788482_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1788659_1788842_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_072096395.1|1788816_1789035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310834.1|1790148_1790505_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1790501_1790924_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1790964_1791930_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1791910_1792432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1792415_1792646_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1792729_1793137_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1793303_1793459_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1793618_1793837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1793840_1794005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1794404_1794593_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1794589_1794781_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048348.1|1794873_1797351_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|1797438_1797675_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876956.1|1797709_1798990_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001360138.1|1799009_1799120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836076.1|1799177_1800197_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001295394.1|1800208_1801423_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1801628_1801955_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1802089_1802431_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1802465_1803026_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1803028_1803739_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1803846_1804152_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041685.1|1804350_1806777_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
1811473:1811488	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 6
NC_017635	Escherichia coli W, complete sequence	4900968	2301592	2364926	4900968	holin,capsid,portal,tRNA,integrase,tail,head,terminase,lysis,plate	Escherichia_phage(43.48%)	73	2306650:2306677	2337657:2337684
WP_000675150.1|2301592_2302996_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2302992_2303715_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2303905_2304238_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2304446_2304743_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2304744_2305041_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2305143_2306505_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2306650:2306677	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2306777_2306996_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000978900.1|2308238_2308718_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000069968.1|2308732_2311180_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000785970.1|2311172_2311292_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2311324_2311600_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2311656_2312175_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286686.1|2312187_2313378_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_000905100.1|2313437_2314031_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_000049773.1|2314476_2314917_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000805553.1|2314888_2315482_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000216987.1|2315481_2316765_-|tail	tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_001285343.1|2316761_2317373_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121496.1|2317365_2318274_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_000127163.1|2318278_2318626_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093712.1|2318622_2319258_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_001001782.1|2319324_2319777_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_000917165.1|2319769_2320237_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_072134039.1|2320199_2320373_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_000040687.1|2320344_2320770_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
WP_000736570.1|2320757_2321183_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_001144178.1|2321197_2321695_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123123.1|2321694_2321976_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2321979_2322183_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_001350080.1|2322182_2322692_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000203429.1|2322791_2323535_-|terminase	terminase endonuclease subunit	terminase	Q94MF3	Enterobacteria_phage	98.8	1.1e-123
WP_001248588.1|2323538_2324612_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	9.7e-201
WP_001085948.1|2324670_2325525_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|2325698_2327471_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038162.1|2327470_2328499_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|2328557_2329130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|2329122_2330556_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_000268602.1|2331721_2333998_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|2333987_2334263_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|2334259_2334484_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277968.1|2334486_2334786_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_000557703.1|2334785_2335010_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217680.1|2335073_2335574_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_001081582.1|2335751_2336027_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2336148_2336448_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2336563_2337577_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001352710.1|2337841_2338159_-	hypothetical protein	NA	NA	NA	NA	NA
2337657:2337684	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2338564_2339464_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2339545_2340325_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2340424_2341465_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|2341512_2342868_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2342871_2343156_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2343186_2343639_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|2343648_2344911_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|2344939_2345794_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2346103_2347156_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2347412_2348690_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846224.1|2348686_2349691_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2349687_2350653_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2350626_2351373_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|2351424_2352243_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2352307_2353108_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2353104_2353893_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2354115_2354388_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134569.1|2354508_2355333_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2355551_2355890_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405707.1|2355971_2357006_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945468.1|2357021_2359502_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2359517_2360192_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2360272_2360815_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2361107_2361389_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2361651_2362761_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2362892_2364926_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 7
NC_017635	Escherichia coli W, complete sequence	4900968	2377437	2386878	4900968		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|2377437_2378574_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|2378570_2380571_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|2380695_2381157_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2381196_2381667_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2381713_2382433_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2382429_2384115_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2384336_2385068_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2385127_2385235_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2385215_2385947_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569367.1|2385951_2386878_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 8
NC_017635	Escherichia coli W, complete sequence	4900968	2586470	2662191	4900968	holin,portal,integrase,tRNA,coat,tail,terminase,lysis	Enterobacteria_phage(51.67%)	89	2583675:2583691	2635554:2635570
2583675:2583691	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283590.1|2586470_2587283_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2587282_2588296_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2588361_2589498_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2589596_2590592_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127762.1|2590588_2591767_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2592077_2593298_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|2593456_2595463_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2595583_2595862_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2595895_2596444_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2596443_2597253_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|2597252_2598077_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2598080_2599166_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001306448.1|2599200_2600133_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2600298_2600850_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2600971_2601844_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2601830_2602355_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2602351_2602822_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2602818_2603367_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2603341_2604094_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112828.1|2604113_2606756_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2606837_2607401_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2608075_2608561_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425056.1|2608763_2610908_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2610907_2612218_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2612397_2612682_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2613053_2614394_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937836.1|2614758_2615817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2615998_2616754_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2617047_2617980_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958678.1|2618291_2619449_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
WP_000575660.1|2619694_2620822_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.2	1.0e-19
WP_001280400.1|2620854_2623053_-|tail	phage tail protein	tail	F8UBT4	Escherichia_phage	37.6	4.1e-105
WP_000287053.1|2623174_2623435_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	98.8	3.6e-37
WP_001029828.1|2623524_2625522_-	hypothetical protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
WP_000246948.1|2625521_2626910_-	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	64.0	7.7e-150
WP_000964882.1|2626919_2627612_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614044.1|2627614_2628070_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.1e-86
WP_000785560.1|2628069_2628918_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.2	3.8e-99
WP_001122413.1|2628917_2630336_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	1.0e-274
WP_001054835.1|2630335_2630836_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	1.2e-89
WP_001349928.1|2630813_2631068_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	95.5	1.1e-25
WP_001196941.1|2631112_2632408_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	4.7e-242
WP_000373008.1|2632407_2633319_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	6.3e-161
WP_000752844.1|2633332_2635498_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_000417851.1|2635498_2636998_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
2635554:2635570	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_000729921.1|2636975_2637464_-	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	99.4	4.1e-90
WP_000807791.1|2637543_2637786_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
WP_001058931.1|2638034_2638520_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_001139680.1|2638723_2638876_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000088943.1|2638863_2639331_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.1e-75
WP_000229392.1|2639327_2639804_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2639787_2640111_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_029798719.1|2640221_2640404_+	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.5e-26
WP_001235461.1|2640544_2641168_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994515.1|2641164_2641353_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008199.1|2641349_2641712_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002243.1|2641708_2641999_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_000950973.1|2642712_2642889_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000386657.1|2642888_2643248_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_001254255.1|2643250_2643427_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153270.1|2643423_2643951_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810178.1|2643947_2644394_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	93.2	3.4e-75
WP_000131504.1|2644788_2646225_-	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	99.4	4.4e-273
WP_000065676.1|2646214_2647114_-	hypothetical protein	NA	K7PH26	Enterobacteria_phage	99.7	6.1e-164
WP_000166207.1|2647106_2647253_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438534.1|2647285_2647582_-	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_000067727.1|2647691_2647907_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000872381.1|2648024_2648678_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
WP_000216180.1|2649031_2649340_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	65.7	8.2e-28
WP_000804697.1|2649342_2649621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000392415.1|2649678_2650044_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
WP_000657742.1|2650096_2650426_+	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	72.9	1.9e-14
WP_000865176.1|2650425_2650614_+	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_000365276.1|2651224_2651932_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_000168259.1|2651932_2652448_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.3	1.3e-65
WP_001016190.1|2652456_2653005_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.8	3.6e-103
WP_001111278.1|2653021_2653315_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214452.1|2653325_2653490_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_000812168.1|2653486_2654005_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	6.6e-54
WP_001065198.1|2654001_2654646_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.1	1.1e-130
WP_000151160.1|2654642_2655242_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	94.1	3.8e-45
WP_000206740.1|2655243_2655933_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	79.1	4.1e-96
WP_000002088.1|2655925_2656210_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	92.6	9.4e-47
WP_000152200.1|2656252_2657053_+	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	1.7e-157
WP_001281185.1|2657110_2657455_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	95.6	6.5e-58
WP_001163428.1|2657578_2657779_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|2658308_2659556_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274885.1|2659627_2660542_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2660757_2662191_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 9
NC_017635	Escherichia coli W, complete sequence	4900968	2925828	2933296	4900968	transposase,integrase	Escherichia_phage(66.67%)	6	2923616:2923629	2930729:2930742
2923616:2923629	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2925828_2926311_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2927053_2928283_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2928321_2928738_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2928809_2930558_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|2930559_2932278_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2930729:2930742	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_000878218.1|2932429_2933296_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 10
NC_017635	Escherichia coli W, complete sequence	4900968	3006925	3014065	4900968		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3006925_3009487_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3009592_3010249_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|3010299_3011097_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3011262_3012171_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3012167_3013430_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3013426_3014065_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NC_017635	Escherichia coli W, complete sequence	4900968	4301179	4392788	4900968	plate,holin,portal,integrase,tRNA,terminase,head,tail,lysis,capsid,transposase,protease	Escherichia_virus(38.3%)	96	4331841:4331887	4364519:4364565
WP_000560983.1|4301179_4301617_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4301661_4302603_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4302666_4303575_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4303803_4304115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4304115_4304406_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4305010_4305229_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4305447_4305690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027702.1|4306019_4306949_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4306945_4307581_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4307577_4308480_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4308492_4311543_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753583.1|4311736_4312570_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|4312722_4313763_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931314.1|4313812_4315561_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019466.1|4315560_4316631_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446010.1|4316620_4318072_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4318082_4318529_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4318829_4319144_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4319153_4319978_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211486.1|4320219_4321479_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144046.1|4321475_4322945_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217162.1|4323232_4324069_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001350036.1|4324052_4324991_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063504.1|4324987_4326022_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4326306_4326927_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166050.1|4327186_4328170_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4328318_4328993_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4329098_4330472_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4330468_4331167_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4331316_4331817_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4331841:4331887	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023383.1|4332002_4332983_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001192857.1|4333052_4333346_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4333498_4333771_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217679.1|4333940_4334441_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557702.1|4334504_4334729_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_001277905.1|4334728_4335031_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_001113263.1|4335030_4335255_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027664.1|4335251_4335527_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268589.1|4335516_4337802_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_014640573.1|4337801_4338254_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_000554771.1|4338253_4338460_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001143634.1|4338702_4339641_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000570053.1|4339637_4340675_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_000368931.1|4340667_4341741_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038147.1|4342156_4343191_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000156872.1|4343190_4344963_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001248585.1|4346048_4347122_+|capsid	phage major capsid protein, P2 family	capsid	Q94ME5	Enterobacteria_phage	100.0	1.1e-201
WP_000203449.1|4347125_4347869_+|terminase	terminase endonuclease subunit	terminase	Q94MF3	Enterobacteria_phage	99.6	2.3e-124
WP_000988633.1|4347968_4348478_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4348477_4348681_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4348684_4348966_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000736609.1|4349478_4349904_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	3.8e-60
WP_000040682.1|4349891_4350317_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000917179.1|4350424_4350892_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001001780.1|4350884_4351337_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093706.1|4351403_4352039_+|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_000127163.1|4352035_4352383_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|4352387_4353296_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285313.1|4353288_4353819_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_000104720.1|4353829_4355839_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001164149.1|4355842_4356370_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000014362.1|4356585_4357485_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|4357804_4358995_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|4359007_4359526_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4359582_4359858_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4359890_4360010_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001283070.1|4360002_4362450_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000978900.1|4362464_4362944_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000882968.1|4362943_4364107_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000468308.1|4364188_4364407_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4364643_4365546_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4364519:4364565	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4365726_4366689_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4367008_4367998_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708994.1|4368104_4368860_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4368914_4369682_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4369789_4370389_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|4370489_4370930_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4371141_4371441_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4371467_4371896_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4371900_4372647_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4372743_4373754_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4373889_4375398_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4375420_4376266_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4376690_4376936_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4377020_4377506_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4377598_4378525_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4378591_4379923_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4379932_4380463_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4380555_4381515_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4381606_4382632_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001350069.1|4382787_4384986_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4385188_4385401_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000015021.1|4385560_4389733_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_001323627.1|4389734_4390058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|4390964_4391573_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4391807_4392788_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
