The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014760	Mycoplasma bovis PG45, complete sequence	1003404	77413	88773	1003404	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013456543.1|77413_78394_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.0e-15
WP_013456294.1|78397_79219_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	1.1e-07
WP_041309069.1|79302_80067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456612.1|80059_81040_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.3	1.8e-52
WP_013456297.1|81164_85541_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	8.1e-12
WP_013456310.1|85945_87169_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	2.6e-61
WP_013456569.1|87158_88124_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013456493.1|88113_88773_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NC_014760	Mycoplasma bovis PG45, complete sequence	1003404	138791	231492	1003404	transposase,tRNA	Mycoplasma_phage(26.67%)	54	NA	NA
WP_013456141.1|138791_140228_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SJ28	Klosneuvirus	37.9	1.1e-93
WP_013456293.1|140287_140656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456281.1|140771_142589_+	membrane protein	NA	NA	NA	NA	NA
WP_013456555.1|142684_143383_+	LemA family protein	NA	NA	NA	NA	NA
WP_013456508.1|143565_145953_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_013456071.1|146011_147853_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	1.2e-17
WP_013456016.1|148115_149528_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.2e-81
WP_013456380.1|149511_150348_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	2.5e-87
WP_013456215.1|150340_151234_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.3	2.1e-92
WP_013455994.1|151220_153122_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.2	3.9e-80
WP_013456051.1|153346_153547_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_041309082.1|153609_155238_+	membrane protein	NA	NA	NA	NA	NA
WP_013456483.1|155239_156376_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_013455960.1|156419_156698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455919.1|157050_158484_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080551559.1|158486_159227_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_013456029.1|159489_160902_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_080551560.1|161907_163428_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_080551561.1|163657_165178_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_013456537.1|165858_168294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456237.1|168445_170935_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.9	5.8e-140
WP_013456164.1|170937_171798_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	9.6e-34
WP_013455920.1|171897_172854_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013456186.1|172857_174051_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_013456618.1|174062_174485_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_013456473.1|174484_175066_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013456366.1|175093_176596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456327.1|176733_178170_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_013456220.1|178237_179218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456103.1|179469_181248_+	molecular chaperone DnaK	NA	A0A0G2YAL1	Acanthamoeba_polyphaga_mimivirus	45.2	1.3e-128
WP_013455992.1|181328_182612_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_041309088.1|182770_183154_+	membrane protein	NA	NA	NA	NA	NA
WP_013456296.1|183292_184282_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	33.2	1.8e-39
WP_013456249.1|184689_185490_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_078086175.1|186381_187410_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013456089.1|187693_190117_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_136868396.1|190103_191297_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	33.4	9.2e-35
WP_169306040.1|191436_191805_-	type III restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_013455963.1|195394_196900_-	trigger factor	NA	NA	NA	NA	NA
WP_013456067.1|198457_198913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456058.1|199477_199636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456199.1|199764_201174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309218.1|201143_203441_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013456291.1|210884_212021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456145.1|213199_214039_+	ParA family protein	NA	E2ELL2	Clostridium_phage	24.5	5.2e-08
WP_013456507.1|214118_214472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456607.1|214685_215948_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_013455984.1|216110_217679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456135.1|217963_218416_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	43.5	3.4e-22
WP_013456413.1|218520_220236_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_013456340.1|220226_220454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080551569.1|222263_223292_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	8.5e-21
WP_013456449.1|223751_225164_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_013455919.1|230058_231492_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_014760	Mycoplasma bovis PG45, complete sequence	1003404	635745	718739	1003404	transposase,tRNA,integrase	Orpheovirus(15.38%)	56	662705:662764	727676:727853
WP_013456500.1|635745_637122_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.2	1.7e-53
WP_013456614.1|637163_639104_+	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.0	2.8e-41
WP_013456620.1|639096_640626_+	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_013456324.1|640630_641416_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013456117.1|641526_642891_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013456509.1|643229_643733_+	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	32.8	7.4e-10
WP_041309148.1|643756_645631_+	peptidase S41	NA	NA	NA	NA	NA
WP_013455986.1|645664_646561_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_013456025.1|646610_647564_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013456165.1|647758_648685_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_013456257.1|648677_649526_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.0	8.2e-54
WP_041309150.1|650042_651416_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_041309152.1|651416_651659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456474.1|651734_654044_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_013456568.1|654046_655885_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013456456.1|655848_657936_+	peptidase S41	NA	NA	NA	NA	NA
WP_013455951.1|658047_659487_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013456519.1|659551_661162_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013456216.1|661154_662504_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
662705:662764	attL	TAAAAAATTCCCAATTTTGGACACTATATTTTTAAAATAGACTTCAATTCTTTAATATAT	NA	NA	NA	NA
WP_013455925.1|662915_664160_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013456060.1|665942_666842_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456502.1|667016_667316_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_013456595.1|667474_668383_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_014829901.1|668612_668987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309154.1|669396_670386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455919.1|670414_671848_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456244.1|672431_673724_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_013456407.1|673723_675199_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	33.5	7.9e-52
WP_013456489.1|675188_675644_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013455954.1|675624_677625_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013456082.1|677915_678983_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_080551572.1|679127_680729_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013456451.1|680962_682732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456634.1|682880_683705_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013456385.1|683691_684666_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013455955.1|686075_686867_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013456065.1|687020_687287_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_013456459.1|687377_688265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456636.1|688296_689139_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013456468.1|689131_689998_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013456399.1|690068_692435_-	membrane protein	NA	NA	NA	NA	NA
WP_013456191.1|692471_693434_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.5e-06
WP_013455950.1|693414_694011_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013456429.1|694960_696820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456158.1|697014_697725_-	signal peptidase II	NA	NA	NA	NA	NA
WP_013456277.1|697726_700405_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.3	1.6e-79
WP_013456530.1|700644_702264_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	1.0e-108
WP_041309157.1|703534_704191_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_013455925.1|704221_705466_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013456106.1|707237_708689_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	24.6	3.2e-29
WP_013456475.1|708688_710206_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013456290.1|710536_711334_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	29.3	1.5e-20
WP_013455940.1|711395_712712_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013456154.1|713522_715793_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_013456150.1|715794_716838_-	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013456112.1|717305_718739_+|transposase	transposase	transposase	NA	NA	NA	NA
727676:727853	attR	ATATATTAAAGAATTGAAGTCTATTTTAAAAATATAGTGTCCAAAATTGGGAATTTTTTAATAAATAATTAAAAAGTATAAAGTAAATCAATAAAAATGTACCTATATACTTGCTTAAATAGGCATAAAAAATACAAAGTATTATATAATATAAAATAATTTATTAACCAGGAGAATA	NA	NA	NA	NA
>prophage 4
NC_014760	Mycoplasma bovis PG45, complete sequence	1003404	726299	803981	1003404	transposase,tRNA	Tupanvirus(15.38%)	60	NA	NA
WP_013456029.1|726299_727712_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_013456572.1|727858_728101_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456627.1|728103_730293_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_041309159.1|730292_731099_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013456129.1|731101_732652_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.3	3.2e-80
WP_013456041.1|732673_732958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456361.1|733026_734085_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_013456378.1|734074_734311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456491.1|734348_734834_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456373.1|735007_735166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|735299_735452_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013456589.1|735506_736205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456168.1|736323_736659_-	HIT family protein	NA	NA	NA	NA	NA
WP_013456238.1|736658_738044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455929.1|738055_740230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309160.1|740323_740911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456603.1|741024_741294_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_013456020.1|741372_741927_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.1e-21
WP_013456351.1|741989_743936_-	transketolase	NA	NA	NA	NA	NA
WP_013456235.1|744034_744979_+	endonuclease	NA	NA	NA	NA	NA
WP_041309271.1|745665_746382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041309162.1|747148_747865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456202.1|748082_749069_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.7	2.2e-42
WP_013456076.1|749989_750319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611595.1|750857_751886_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.4	2.5e-20
WP_013456417.1|752423_753398_-	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	38.6	5.4e-49
WP_013456527.1|753586_754303_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013456442.1|754304_755234_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_076611929.1|755387_756989_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013456439.1|757352_759938_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	28.9	2.0e-87
WP_013456118.1|759951_761868_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.0	4.3e-119
WP_013456207.1|761982_763380_-	CvpA family protein	NA	NA	NA	NA	NA
WP_013455969.1|763392_763953_-	peptide deformylase	NA	NA	NA	NA	NA
WP_013456611.1|764020_764569_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013456371.1|764569_765589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456270.1|765732_767508_-	membrane protein	NA	NA	NA	NA	NA
WP_013456311.1|767558_768011_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_013456630.1|767997_769839_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_078086175.1|770061_771090_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013954624.1|771695_772145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456232.1|772319_774635_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_041309277.1|774628_775960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456363.1|776593_778027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148220217.1|778141_779953_-	LppA family lipoprotein	NA	NA	NA	NA	NA
WP_041309281.1|780797_783107_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013456262.1|783076_784501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456072.1|785007_787941_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	34.0	8.8e-87
WP_013456541.1|787942_788860_+	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	31.2	9.6e-32
WP_080551572.1|789320_790922_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013456376.1|791045_793088_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013456179.1|793252_795346_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.2	1.8e-54
WP_013456121.1|795375_795846_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004024001.1|795876_796290_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013456204.1|796610_797828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456632.1|797865_799479_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	2.4e-54
WP_041309168.1|799584_799785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309169.1|799904_800636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954980.1|800778_801123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456337.1|801254_802109_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456540.1|802592_803981_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_014760	Mycoplasma bovis PG45, complete sequence	1003404	888845	949161	1003404	transposase,tRNA,integrase	Faecalibacterium_phage(21.43%)	53	895037:895053	952164:952180
WP_080551570.1|888845_889874_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013455943.1|890582_891707_+	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	29.6	2.5e-21
WP_013456499.1|891842_893126_-	MFS transporter	NA	NA	NA	NA	NA
WP_153700572.1|893156_893294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955038.1|893361_893538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955039.1|893868_894132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456336.1|894273_895554_-	ATP-binding protein	NA	NA	NA	NA	NA
895037:895053	attL	AATTTAGCCAACATATC	NA	NA	NA	NA
WP_013456354.1|895867_896491_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.9	1.9e-23
WP_013456057.1|896515_897574_-	membrane protein	NA	NA	NA	NA	NA
WP_013456503.1|897621_898539_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	2.3e-09
WP_013456176.1|898573_899242_-	chromate transporter	NA	NA	NA	NA	NA
WP_013455977.1|899241_899895_-	chromate transporter	NA	NA	NA	NA	NA
WP_013456477.1|899901_900519_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004024108.1|900573_900789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456259.1|901077_901689_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013456320.1|901738_903412_-	ribonuclease J	NA	NA	NA	NA	NA
WP_013455948.1|904457_905183_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	36.9	1.4e-30
WP_013456583.1|905175_906078_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_013456476.1|906077_906725_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.6	2.2e-22
WP_013456384.1|906739_907327_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_013456226.1|907329_907620_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_013456609.1|907636_909487_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	38.9	2.6e-52
WP_080551575.1|909725_910754_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456015.1|911271_911937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456011.1|912066_913563_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013456010.1|913565_914465_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013456212.1|914654_915407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455980.1|915604_916138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456446.1|916124_916733_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_041309179.1|916791_917697_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013456425.1|917735_918392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456231.1|918532_919045_-	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	34.4	1.4e-11
WP_013456169.1|919073_920879_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.7	2.8e-27
WP_013456107.1|920857_921160_-	YlxR family protein	NA	NA	NA	NA	NA
WP_013455982.1|921143_922778_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_013456594.1|922785_923232_-	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_013456273.1|923371_923944_-	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	70.1	9.4e-70
WP_013456539.1|924019_925390_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	73.1	1.5e-153
WP_013456029.1|925932_927345_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_041309306.1|927497_928526_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	1.9e-20
WP_013455942.1|928736_929744_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_013456629.1|930289_931381_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456431.1|931423_932188_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_080551576.1|934620_935088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148220218.1|937699_938812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456322.1|939719_940334_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_041309184.1|940326_941187_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_080551566.1|942028_942208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455927.1|942194_943211_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_041309186.1|943602_943827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456109.1|945423_946182_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456538.1|946866_947475_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456123.1|948411_949161_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
952164:952180	attR	AATTTAGCCAACATATC	NA	NA	NA	NA
