The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017634	Escherichia coli O83:H1 str. NRG 857C, complete sequence	4747819	867707	878067	4747819	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_000188129.1|867707_869654_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|869726_869951_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|870273_870594_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|870624_872901_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|873853_874837_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101563.1|874833_878067_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	2.2e-83
>prophage 2
NC_017634	Escherichia coli O83:H1 str. NRG 857C, complete sequence	4747819	978311	1037253	4747819	head,holin,coat,protease,portal,terminase,integrase,tail,lysis	Enterobacteria_phage(46.27%)	84	970810:970826	1010339:1010355
970810:970826	attL	TGACCGTTGGCGAGAGC	NA	NA	NA	NA
WP_000375136.1|978311_978971_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001058323.1|979690_980809_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107399.1|980805_982599_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186413.1|982617_983325_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003644.1|983321_983909_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063964.1|983905_984304_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004917.1|984300_985158_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|985291_986836_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460796.1|986847_987984_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|987996_988089_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001528879.1|988168_989479_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000087763.1|989466_989679_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|989964_990177_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|990187_990376_+	cold-shock protein	NA	NA	NA	NA	NA
WP_012896763.1|990350_990581_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|990570_990744_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818456.1|990792_991866_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054735.1|991948_994681_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	7.0e-38
WP_000533675.1|994775_995849_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.5	3.3e-193
WP_014640122.1|995826_996045_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.4e-34
WP_001281200.1|996150_996495_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000545737.1|996522_996690_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000002134.1|996762_997047_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	95.7	1.1e-47
WP_000969522.1|997046_997307_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	95.3	3.5e-40
WP_000104415.1|997303_997942_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	54.0	2.1e-54
WP_000192142.1|997943_998546_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	92.4	1.0e-45
WP_000015506.1|998542_998767_-	hypothetical protein	NA	Q286X0	Escherichia_phage	100.0	1.2e-36
WP_001214454.1|998763_998931_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_001111304.1|998941_999238_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000951323.1|999261_999645_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_000031367.1|999644_1000250_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|1000506_1000659_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1000643_1000775_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000005791.1|1000799_1001768_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.4	5.9e-56
WP_000095077.1|1001940_1002564_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.1	9.5e-108
WP_000073664.1|1002774_1003314_+	super-infection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	6.2e-39
WP_114139863.1|1003356_1003608_-	hypothetical protein	NA	K7P7A1	Enterobacteria_phage	97.6	1.1e-22
WP_000856967.1|1004215_1004866_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1004946_1005132_+	helix-turn-helix domain-containing protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|1005240_1005534_+	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1005556_1005829_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000431318.1|1005891_1006779_+	replication protein	NA	A5VW95	Enterobacteria_phage	93.2	1.8e-144
WP_000806597.1|1006775_1008152_+	AAA family ATPase	NA	K7P852	Enterobacteria_phage	99.8	9.7e-254
WP_000229811.1|1008224_1008431_+	hypothetical protein	NA	A0A2I6PIF1	Escherichia_phage	100.0	2.4e-28
WP_000344549.1|1008448_1008757_+	hypothetical protein	NA	Q716C8	Shigella_phage	97.1	1.4e-51
WP_000814610.1|1008956_1009367_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	1.6e-71
WP_001254220.1|1009363_1009540_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_001363895.1|1009542_1009902_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
WP_000950962.1|1009894_1010071_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001003977.1|1010063_1010789_+	phage antirepressor KilAC domain-containing protein	NA	A0A2I6PIF5	Escherichia_phage	99.6	1.4e-131
1010339:1010355	attR	TGACCGTTGGCGAGAGC	NA	NA	NA	NA
WP_000002237.1|1010788_1011079_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	4.9e-51
WP_001008200.1|1011075_1011438_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994517.1|1011434_1011623_+	protein ninH	NA	A5VW84	Enterobacteria_phage	95.2	1.0e-25
WP_001235461.1|1011619_1012243_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1012676_1013000_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229398.1|1012983_1013460_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_000092266.1|1013456_1013924_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.7	8.5e-77
WP_033555627.1|1013911_1014064_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	8.1e-21
WP_000999686.1|1014302_1014683_+	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	2.5e-66
WP_000807788.1|1014786_1015029_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000729920.1|1015064_1015553_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000417851.1|1015530_1017030_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_000752843.1|1017030_1019196_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
WP_000438546.1|1019209_1020130_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	3.8e-161
WP_001196946.1|1020120_1021416_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_014640124.1|1021460_1021739_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	94.6	7.6e-25
WP_001054834.1|1021716_1022217_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_001122394.1|1022216_1023635_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.2	2.1e-275
WP_000228482.1|1023634_1024336_+|tail	tail protein	tail	G5DA78	Enterobacteria_phage	98.7	1.8e-118
WP_000627636.1|1024335_1024791_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	2.3e-87
WP_000964863.1|1024793_1025486_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.4	9.8e-114
WP_000246981.1|1025496_1026846_+	phage DNA ejection protein	NA	Q9AYZ0	Salmonella_phage	99.6	1.1e-246
WP_001029854.1|1026845_1029014_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	96.4	0.0e+00
WP_000821345.1|1029109_1029529_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	99.3	3.0e-73
WP_000151196.1|1029573_1029759_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_001036008.1|1029733_1029943_-	hypothetical protein	NA	I6R975	Salmonella_phage	97.1	1.7e-29
WP_001283827.1|1029939_1030191_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_000865491.1|1030296_1030437_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	5.7e-05
WP_000204917.1|1030535_1031459_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	96.4	6.2e-172
WP_001104356.1|1031569_1032079_-	HNH endonuclease	NA	A0A291AXK3	Shigella_phage	44.9	2.6e-31
WP_000132319.1|1032167_1034570_+|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	88.8	2.8e-75
WP_000355430.1|1034810_1035098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001264957.1|1035559_1036588_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1036560_1037253_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
>prophage 3
NC_017634	Escherichia coli O83:H1 str. NRG 857C, complete sequence	4747819	1167201	1226021	4747819	head,portal,terminase,integrase,tail,tRNA,lysis,capsid	Enterobacteria_phage(55.93%)	80	1193058:1193073	1208238:1208253
WP_001441929.1|1167201_1168308_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1168361_1168823_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248662.1|1168832_1169486_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1169657_1170908_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1171021_1172164_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1172153_1172390_-	excisionase	NA	NA	NA	NA	NA
WP_000488403.1|1172529_1172769_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	6.7e-38
WP_000763364.1|1172816_1173035_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000188880.1|1173133_1173349_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548537.1|1173425_1173617_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149539.1|1173589_1173772_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	6.3e-28
WP_000186858.1|1173768_1174449_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|1174445_1175231_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995417.1|1175236_1175533_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
WP_000233576.1|1175608_1175815_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1176290_1176668_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380253.1|1176645_1177707_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	1.7e-64
WP_000712396.1|1177787_1178480_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|1178590_1178818_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|1178848_1179388_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147914.1|1179384_1180404_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	2.7e-112
WP_000788877.1|1180400_1181102_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145918.1|1181098_1181401_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
WP_001070442.1|1181468_1181801_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_014640128.1|1181849_1181999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709098.1|1182056_1183583_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
WP_000700204.1|1183932_1184976_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|1185325_1185427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|1185423_1185879_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_000224907.1|1185878_1186049_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|1186041_1186332_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|1186328_1186691_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|1186687_1186828_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|1186913_1187297_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|1187485_1188568_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1189157_1189373_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000193273.1|1189377_1189692_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001168526.1|1189688_1189928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101164.1|1190062_1190596_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001228695.1|1190812_1190995_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738422.1|1191085_1191379_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_000830178.1|1191859_1192186_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1192392_1192575_+	hypothetical protein	NA	NA	NA	NA	NA
1193058:1193073	attL	AGAAAGGAAACGACAG	NA	NA	NA	NA
WP_000453580.1|1193138_1193684_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027282.1|1193658_1195584_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1195580_1195787_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001337540.1|1195783_1197385_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123325.1|1197365_1198697_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_000201478.1|1198706_1199039_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000896726.1|1199502_1200738_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	8.5e-100
WP_000737991.1|1200739_1200967_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001049527.1|1201036_1201573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114139867.1|1201885_1202725_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000999172.1|1202717_1202942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790825.1|1202944_1203232_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000817023.1|1203228_1205049_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000125506.1|1205336_1205582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126716.1|1205578_1206028_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228111.1|1206245_1207286_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
WP_000190772.1|1207295_1207637_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178671.1|1207648_1208032_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000453554.1|1208277_1208472_+	hypothetical protein	NA	NA	NA	NA	NA
1208238:1208253	attR	CTGTCGTTTCCTTTCT	NA	NA	NA	NA
WP_000389900.1|1208535_1209084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001182199.1|1209088_1210252_-	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	28.9	7.4e-21
WP_000158881.1|1211238_1211634_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000752952.1|1211645_1211999_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000985127.1|1212010_1212589_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000683157.1|1212585_1212981_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_001524522.1|1212988_1213729_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_000479173.1|1213744_1214167_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_000459452.1|1214148_1214583_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000840357.1|1214575_1217137_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.0	0.0e+00
WP_000847379.1|1217133_1217463_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152626.1|1217462_1218161_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_001337536.1|1218165_1218909_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090899.1|1218845_1219478_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	95.7	4.2e-95
WP_000515749.1|1219538_1222952_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001230375.1|1223021_1223621_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_001350275.1|1223685_1225746_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	5.7e-125
WP_000654168.1|1225742_1226021_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
>prophage 4
NC_017634	Escherichia coli O83:H1 str. NRG 857C, complete sequence	4747819	1589903	1645089	4747819	protease,portal,terminase,integrase,tail,lysis	Enterobacteria_phage(47.92%)	67	1595608:1595623	1639091:1639106
WP_000526701.1|1589903_1591364_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	3.9e-43
WP_120795384.1|1593339_1593453_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1593521_1593755_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1594071_1594662_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_014640154.1|1594889_1595183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353819.1|1595225_1596266_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
1595608:1595623	attL	GCATGACATGCACCAT	NA	NA	NA	NA
WP_000654143.1|1596275_1596557_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_000290534.1|1596556_1598929_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	3.1e-167
WP_000515748.1|1598989_1602403_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001531692.1|1602463_1603111_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	7.8e-113
WP_001718124.1|1603008_1603752_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	7.0e-150
WP_001152336.1|1603756_1604455_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447256.1|1604464_1604794_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.9e-60
WP_000372020.1|1604793_1607859_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.0	0.0e+00
WP_001161009.1|1607830_1608160_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001366333.1|1608168_1608555_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	96.9	7.5e-63
WP_000211132.1|1608615_1609359_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079412.1|1609369_1609771_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_000677119.1|1609767_1610358_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	2.1e-80
WP_001283153.1|1610369_1610645_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097055.1|1610637_1610961_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001136590.1|1611047_1613075_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_000985923.1|1613019_1614528_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_001072975.1|1614527_1614740_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507024.1|1614736_1616836_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.1	0.0e+00
WP_000421825.1|1616844_1617384_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|1617935_1618142_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_014640156.1|1618442_1618853_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	1.0e-62
WP_001019139.1|1619004_1619178_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1619349_1619505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1619584_1619650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1619652_1619841_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1619851_1620064_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1620427_1620925_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1620921_1621455_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1621451_1621763_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1621767_1621983_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1622736_1622952_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1623252_1623465_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1623519_1623609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047139.1|1623886_1624639_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	2.1e-130
WP_001533276.1|1624652_1625702_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	2.8e-112
WP_114139876.1|1625703_1625982_-	hypothetical protein	NA	A0A2I6TCC8	Escherichia_phage	43.8	8.8e-05
WP_000980994.1|1626048_1626300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1626516_1626729_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000354584.1|1626944_1628432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151126.1|1628749_1629172_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	7.7e-61
WP_000054493.1|1629212_1630178_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.8	1.2e-56
WP_000705348.1|1630158_1630680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000909905.1|1630663_1630891_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1630971_1631379_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379597.1|1631547_1631703_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000344945.1|1631704_1632235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854561.1|1632721_1632910_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1632906_1633098_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048387.1|1633191_1635663_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	9.4e-58
WP_000005552.1|1635735_1635987_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876982.1|1636021_1637302_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_001389342.1|1637303_1637432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836084.1|1637489_1638509_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001298659.1|1638520_1639735_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
1639091:1639106	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
WP_000598292.1|1639940_1640267_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705201.1|1640401_1640743_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1640777_1641338_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001350228.1|1641340_1642051_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|1642158_1642464_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041662.1|1642662_1645089_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.0e-213
>prophage 5
NC_017634	Escherichia coli O83:H1 str. NRG 857C, complete sequence	4747819	2234125	2241760	4747819		Enterobacteria_phage(100.0%)	7	NA	NA
WP_001292758.1|2234125_2235262_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	2.5e-162
WP_014640174.1|2235258_2237262_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2237386_2237848_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2237888_2238359_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2238405_2239125_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2239121_2240807_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240405.1|2241028_2241760_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
>prophage 6
NC_017634	Escherichia coli O83:H1 str. NRG 857C, complete sequence	4747819	2815352	2822492	4747819		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2815352_2817914_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141292.1|2818019_2818676_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	2.5e-50
WP_001296319.1|2818726_2819494_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847999.1|2819689_2820598_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.3e-117
WP_000590417.1|2820594_2821857_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|2821853_2822492_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 1
NC_017659	Escherichia coli O83:H1 str. NRG 857C plasmid pO83_CORR, complete sequence	147060	13610	67501	147060	bacteriocin,integrase,transposase	Escherichia_phage(38.46%)	55	43766:43825	74725:75493
WP_000654811.1|13610_14579_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_032300423.1|14598_14847_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	9.2e-06
WP_001259758.1|15016_15328_-	colicin V	NA	NA	NA	NA	NA
WP_014640552.1|15305_15542_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|16005_16287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|16644_17172_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|17415_18231_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|18280_18634_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|18811_19603_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|19599_20289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|20332_20683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952217.1|21226_22315_+	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000698737.1|22316_24542_+	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000963206.1|24591_25491_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000111771.1|25480_25771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|26066_26297_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|26293_26710_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350638.1|26871_29010_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|29363_29621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|29620_30211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|30473_32030_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|32220_32838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089728.1|33130_34264_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|34368_34692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001214976.1|36486_36894_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|37031_37916_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|37947_39147_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|39252_39903_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|39934_40177_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000656305.1|42305_42683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|42883_43543_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
43766:43825	attL	GGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGG	NA	NA	NA	NA
WP_001067855.1|45231_45936_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027062.1|46147_47008_-	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	99.7	7.8e-161
WP_001067855.1|47592_48297_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|49052_49904_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|50211_51027_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|51087_51891_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|51890_52727_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000845049.1|52698_53817_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.7	1.5e-71
WP_000777555.1|53973_54447_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_001206317.1|54539_55331_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|55494_55842_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|55835_56675_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|56802_57303_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|57478_58264_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|58250_59774_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000059618.1|59875_60604_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001611016.1|60685_60964_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000928197.1|60971_61223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014640556.1|61153_61975_+	serine hydrolase	NA	NA	NA	NA	NA
WP_000451766.1|62876_63494_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000140042.1|63530_64370_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000031017.1|64406_65315_+	Mph(B) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_071779295.1|65426_65693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000344783.1|65833_67501_-|transposase	transposase	transposase	NA	NA	NA	NA
74725:75493	attR	CCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCAATATCTAAGTTTTCATTAGCCATTAGATGTATCTCGAGTATTTAGTTAAGAAACTGATAGGTCAGTATTTGCATCAATGTTCATTGAATTTGTATCCGAAGTCAATCTGATGTAGGAACTTCAAAACTGCGCAAAACACGCAAATACGCACAAGAAAGTAGGGCTGCGCTTGGAATTCGGAAAATAAACCACATCAAAACTACTTTTTAGCCAAATAACGTTTGGGAATCACCAGAATGGTGGGACAACAGCGGTTTTAGTGCCCTAAATCGTACGTTTTCATCCAGTTGCCCCTCAAACCCCATGTTCAAGTCAGAATAGTGGACAGGCGGCCAAGAACTTCGTTCATGATAGTCTCCGGAACCCGTTCGAGTCGTTTTCCGCCCCGTGCTTTCATATCAATTGTCCGGGGTTGATCGCAACGTACAACACCTGTGGTACGTATGCCAACACCATCCAACGACACCGCAAAGCCGGCAGTGCGGGCAAAATTGCCTCCGCTGGTTACGGGCACAACAACAGGCAGGCGGGTCACGCGATTAAAGGCCGCCGGTGTGACAATCAGCACCGGCCGCGTTCCCTGCTGCTCATGACCTGCGGTAGGATCAAGCGAGACAAGCCAGATTTCCCCTCTTTCCATGTCAGATTTCCTCCTGACCAGTCGCCGGTGCATCCAGCCATTCTCGTTCTTCAGCTGATATTTCAGCA	NA	NA	NA	NA
