The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	68117	138037	3136818	transposase	Burkholderia_virus(60.0%)	50	NA	NA
WP_014104060.1|68117_69197_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014104061.1|69475_71275_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014104062.1|71271_73632_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014104060.1|74464_75544_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041247491.1|78155_78410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014104069.1|79552_81013_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014104070.1|81031_81409_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_158309202.1|81482_82955_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014104072.1|83030_84359_-	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_014104073.1|84425_85316_-	VOC family protein	NA	NA	NA	NA	NA
WP_014104074.1|85329_86067_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_014104075.1|86072_86954_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158309203.1|87097_88024_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.4	3.5e-05
WP_014104077.1|88124_89537_-	amidohydrolase	NA	NA	NA	NA	NA
WP_041247023.1|89575_90730_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_014104079.1|90804_91284_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_158309204.1|91348_92629_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.0	3.7e-50
WP_014104081.1|92979_94140_+	amidohydrolase	NA	NA	NA	NA	NA
WP_041247497.1|94170_95505_-	gluconate permease	NA	NA	NA	NA	NA
WP_014104083.1|95555_97037_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_193360662.1|97090_97462_-	RidA family protein	NA	NA	NA	NA	NA
WP_014104085.1|97496_98564_-	D-TA family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_158309205.1|98743_99721_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014104087.1|99942_100953_-	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_050856073.1|102027_102777_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014104091.1|102844_104305_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_014104092.1|104320_105307_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_014104093.1|105303_106794_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014104094.1|106860_108183_-	CapA family protein	NA	NA	NA	NA	NA
WP_050856074.1|108277_110686_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014104096.1|111289_112627_+	MFS transporter	NA	NA	NA	NA	NA
WP_014104098.1|113605_114565_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014104099.1|114599_115487_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014104100.1|115622_116834_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_014104101.1|116830_118063_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_014104102.1|118082_118988_+	N-carbamoyl-D-amino-acid hydrolase	NA	NA	NA	NA	NA
WP_014104103.1|119280_120771_+	amidase	NA	NA	NA	NA	NA
WP_041247501.1|120860_122114_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_158309206.1|122175_123432_+	MFS transporter	NA	NA	NA	NA	NA
WP_014104106.1|123542_123812_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014104109.1|124536_125760_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.8	1.5e-40
WP_014104112.1|126791_128240_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041247028.1|128614_129538_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_014104114.1|129822_130830_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_041247029.1|130895_132227_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.8	1.9e-36
WP_014104116.1|132255_133017_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014104117.1|133035_133965_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	25.9	2.1e-18
WP_014104118.1|134267_135758_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_081477854.1|136756_137119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268513.1|137199_138037_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	212156	244241	3136818	transposase	Leptospira_phage(50.0%)	28	NA	NA
WP_007400224.1|212156_212516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010510701.1|212512_212860_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007397838.1|212923_214534_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_041247514.1|215153_215534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014104181.1|215545_216799_+	TolC family protein	NA	NA	NA	NA	NA
WP_041247039.1|216795_217947_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014104183.1|217946_221021_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014104184.1|221020_221692_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014104185.1|221688_223041_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014104186.1|223089_223659_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_014104187.1|223648_224356_+	VIT family protein	NA	NA	NA	NA	NA
WP_158309208.1|224791_224938_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014104188.1|224910_225123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014104060.1|225233_226313_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014104189.1|226290_226806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014104190.1|226802_227333_-	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014104192.1|228429_228939_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014104193.1|229179_230520_-	MFS transporter	NA	NA	NA	NA	NA
WP_041247040.1|230547_232212_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_148268610.1|232254_233331_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014104196.1|233348_234413_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014104197.1|234409_235345_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_014104198.1|235401_236478_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_081477913.1|236933_239054_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_014104201.1|239132_240872_+	glycosyltransferase family 61 protein	NA	NA	NA	NA	NA
WP_007397838.1|241863_243474_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|243537_243885_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007400224.1|243881_244241_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	1365195	1397804	3136818	transposase	Planktothrix_phage(100.0%)	27	NA	NA
WP_014105152.1|1365195_1366275_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041247226.1|1366497_1366680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247227.1|1366768_1367671_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_193360659.1|1368451_1369208_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012812328.1|1369337_1370588_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_148268543.1|1370697_1371454_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014105161.1|1373086_1374115_-	methionine synthase	NA	NA	NA	NA	NA
WP_014105162.1|1374141_1375125_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_041247229.1|1377308_1377794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247230.1|1377774_1378254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268544.1|1378791_1379157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247231.1|1379233_1379755_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_014105164.1|1379822_1380914_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_041247663.1|1380921_1382004_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_014105166.1|1382345_1383104_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	4.8e-13
WP_193360673.1|1383100_1384072_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_193360674.1|1384104_1384932_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014105169.1|1384945_1387045_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041247664.1|1387984_1388452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105171.1|1388456_1389911_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_014105173.1|1390752_1391076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193360675.1|1391041_1391380_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_014105174.1|1391500_1392406_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_148268646.1|1392919_1394272_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_158309222.1|1395072_1395246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|1395687_1396938_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_148268546.1|1397047_1397804_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	1712362	1795344	3136818	integrase,capsid,head,terminase,portal,transposase,tail,plate,protease	Pseudomonas_phage(12.5%)	108	1705844:1705864	1788496:1788516
1705844:1705864	attL	AAGTTTTTGGTGAAGCTTTTT	NA	NA	NA	NA
WP_014105446.1|1712362_1712539_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148268559.1|1712645_1713173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247719.1|1713304_1713883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148268560.1|1714272_1715190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193360638.1|1715339_1715813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105451.1|1715955_1717152_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_014105452.1|1717232_1717406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247271.1|1717430_1717622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167537196.1|1717978_1718155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167537197.1|1718370_1718532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105456.1|1718562_1719048_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_167537198.1|1719281_1719458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105458.1|1719770_1720103_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014105459.1|1720106_1720295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247721.1|1720628_1721681_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_014105461.1|1721811_1722417_+	lipase	NA	NA	NA	NA	NA
WP_014105462.1|1722533_1722929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105463.1|1722943_1724599_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_014105464.1|1724839_1726060_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_041247273.1|1726194_1727454_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014105466.1|1728293_1728770_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_014105467.1|1728807_1729473_-	DedA family protein	NA	NA	NA	NA	NA
WP_014105468.1|1729716_1730358_-	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
WP_148268657.1|1730372_1730957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105470.1|1731141_1731372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105471.1|1731558_1732428_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_041247274.1|1733169_1733607_-	CHRD domain-containing protein	NA	NA	NA	NA	NA
WP_158309224.1|1733752_1733896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105475.1|1734878_1735229_-	RidA family protein	NA	NA	NA	NA	NA
WP_014105479.1|1736505_1737333_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_014105480.1|1737704_1738934_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	53.9	5.3e-118
WP_014105481.1|1738922_1739123_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_014105482.1|1739124_1739373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148268561.1|1739369_1739969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158309225.1|1739965_1740136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105485.1|1740269_1740482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247277.1|1740481_1742122_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	27.8	3.5e-08
WP_014105487.1|1742118_1742364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105488.1|1742350_1742614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247278.1|1742812_1743190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105489.1|1743305_1743755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437313.1|1743751_1744096_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081477930.1|1744187_1744412_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014105490.1|1744408_1744705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105491.1|1744864_1745218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105492.1|1745214_1745427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247729.1|1745468_1746455_+	toprim domain-containing protein	NA	A0A0U4B0G9	Pseudomonas_phage	40.5	1.6e-16
WP_014105494.1|1746441_1748286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106060.1|1748562_1748865_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	54.4	1.2e-18
WP_014105496.1|1748864_1749503_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014105497.1|1749523_1750093_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_014105498.1|1750092_1751730_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	38.6	1.7e-95
WP_014105499.1|1751736_1753056_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	35.6	4.3e-57
WP_014105500.1|1753058_1753757_+|head,protease	HK97 family phage prohead protease	head,protease	A0A218MM23	uncultured_virus	34.9	2.2e-12
WP_014105501.1|1753798_1755337_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	35.2	6.1e-55
WP_014105502.1|1755378_1755681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105503.1|1755680_1756325_+|head,tail	phage head-tail connector protein	head,tail	H9YSG3	environmental_Halophage	31.4	5.5e-10
WP_014105504.1|1756317_1756719_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_014105505.1|1756705_1757245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105506.1|1757241_1757805_+	hypothetical protein	NA	Q8W624	Enterobacteria_phage	34.1	2.4e-17
WP_014105507.1|1757804_1758056_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_014105508.1|1758052_1759528_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	36.2	4.0e-64
WP_014105509.1|1759537_1759915_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_014105510.1|1759911_1760223_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_014105511.1|1760340_1762566_+	lytic transglycosylase domain-containing protein	NA	A0A1P8VV74	Rathayibacter_phage	27.9	4.1e-12
WP_014105512.1|1762566_1763871_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	25.9	1.9e-17
WP_014105513.1|1763867_1765016_+|tail	tail protein	tail	NA	NA	NA	NA
WP_014105514.1|1765015_1765492_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_014105515.1|1765488_1765968_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_014105516.1|1765939_1767055_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	30.4	3.9e-27
WP_014105517.1|1767054_1767651_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_014105518.1|1767657_1769634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105519.1|1769633_1770047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105520.1|1770043_1770514_+	hypothetical protein	NA	A0A0M4RBJ6	Mycobacterium_phage	39.1	1.8e-05
WP_014105521.1|1770613_1770916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247283.1|1770918_1771404_+	hypothetical protein	NA	A0A1B2ANT4	Pseudoalteromonas_phage	37.3	4.3e-15
WP_050856162.1|1771766_1772159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105524.1|1772162_1772363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158309226.1|1772438_1772597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105526.1|1772621_1773620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105527.1|1773633_1774074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105528.1|1774253_1774802_-	hypothetical protein	NA	A0A088C495	Shewanella_sp._phage	33.5	1.5e-11
WP_014105529.1|1774801_1775473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105530.1|1775472_1776306_-	DUF2213 domain-containing protein	NA	E2GLV5	Acinetobacter_phage	36.4	3.7e-30
WP_148268658.1|1776299_1777721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105532.1|1777735_1778092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105533.1|1778220_1778796_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	45.3	4.8e-29
WP_148268659.1|1779301_1780678_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	47.7	3.7e-112
WP_014105535.1|1780716_1781520_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_014105536.1|1781516_1782377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158309227.1|1782373_1782514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105537.1|1782706_1782904_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148268563.1|1783051_1783684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247285.1|1784021_1784270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247286.1|1784266_1784500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105608.1|1784496_1784757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247287.1|1784753_1784951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247747.1|1785346_1785586_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014105540.1|1785582_1786302_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.2	6.1e-58
WP_014105541.1|1786298_1786766_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	37.7	7.0e-23
WP_014105542.1|1786981_1788193_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	45.1	1.6e-87
WP_014105543.1|1789123_1789570_+	cupin domain-containing protein	NA	NA	NA	NA	NA
1788496:1788516	attR	AAGTTTTTGGTGAAGCTTTTT	NA	NA	NA	NA
WP_014105544.1|1789776_1792335_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_158309228.1|1792595_1792751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105545.1|1792812_1793364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105189.1|1793547_1793937_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014105546.1|1793885_1794098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014104109.1|1794120_1795344_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.8	1.5e-40
>prophage 5
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	1826834	1954084	3136818	transposase,tRNA,integrase	Planktothrix_phage(11.11%)	113	1835332:1835349	1955195:1955212
WP_148268566.1|1826834_1827149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041247293.1|1827244_1827874_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014105576.1|1828176_1828365_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_014105577.1|1828372_1829014_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_014105578.1|1829110_1829314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105581.1|1830458_1831859_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	30.0	9.1e-50
WP_167537204.1|1831952_1832207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105583.1|1832509_1832863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247294.1|1832965_1833730_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014105585.1|1833756_1834071_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_041247295.1|1834141_1835353_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
1835332:1835349	attL	GCAGGGGGCTGCATCTTC	NA	NA	NA	NA
WP_014105587.1|1835452_1836907_-	class II fumarate hydratase	NA	NA	NA	NA	NA
1835332:1835349	attL	GCAGGGGGCTGCATCTTC	NA	NA	NA	NA
WP_014105588.1|1837088_1837718_-	LysE family translocator	NA	NA	NA	NA	NA
WP_014105590.1|1838779_1839643_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014105591.1|1839656_1840553_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_193360639.1|1840524_1842294_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	26.5	2.4e-07
WP_041247296.1|1842678_1843128_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_014105594.1|1843200_1844880_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041247297.1|1844894_1845524_-	SCO family protein	NA	NA	NA	NA	NA
WP_014105596.1|1845523_1848298_-	DNA polymerase I	NA	A7XX31	Thermus_virus	33.1	1.4e-54
WP_014105597.1|1848312_1848528_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_148268567.1|1848600_1849686_+	alpha/beta fold hydrolase	NA	A0A0G3G493	Raccoon_poxvirus	25.3	1.4e-05
WP_014105599.1|1850165_1850726_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	43.0	6.5e-31
WP_014105600.1|1851736_1854334_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.0	1.1e-61
WP_014105601.1|1854337_1854640_-	hypothetical protein	NA	I6S1U6	Salmonella_phage	42.5	9.5e-05
WP_014105602.1|1854636_1854909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105603.1|1854905_1855313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105604.1|1855513_1855720_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_041247300.1|1855814_1856588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148268569.1|1856590_1856779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105606.1|1856775_1857105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247301.1|1857101_1857350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247302.1|1857346_1857580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105608.1|1857576_1857837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247287.1|1857833_1858031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050856109.1|1858027_1858273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148268661.1|1858464_1858914_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041247303.1|1859018_1859633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268570.1|1859664_1859904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247304.1|1860427_1860727_-	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	36.8	1.1e-05
WP_014105611.1|1860866_1861271_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_041247305.1|1861254_1861467_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_014105613.1|1861757_1862975_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	46.9	2.9e-92
WP_041247756.1|1863639_1864188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247757.1|1864336_1866070_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_041247306.1|1866162_1867608_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_041247307.1|1867722_1867974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268520.1|1868997_1869755_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014105619.1|1870930_1873105_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014105620.1|1873133_1873448_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014104109.1|1874298_1875522_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.8	1.5e-40
WP_041247760.1|1875966_1876212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007397838.1|1876212_1877823_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|1877886_1878234_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007400224.1|1878230_1878590_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_193360693.1|1878752_1879145_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_167537200.1|1879443_1879608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105627.1|1888025_1890629_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.7	1.7e-118
1890487:1890504	attR	GAAGATGCAGCCCCCTGC	NA	NA	NA	NA
WP_041247309.1|1891065_1892130_-	aldo/keto reductase	NA	NA	NA	NA	NA
1890487:1890504	attR	GAAGATGCAGCCCCCTGC	NA	NA	NA	NA
WP_014105629.1|1892314_1893007_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014105630.1|1893224_1894244_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_041247310.1|1894295_1894811_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_041247311.1|1894913_1896737_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.3	5.9e-49
WP_014105633.1|1896806_1897841_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_014105634.1|1897839_1898748_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_014105635.1|1898737_1899706_-	cation transporter	NA	NA	NA	NA	NA
WP_014105636.1|1899847_1900699_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_014105637.1|1900695_1901499_+	NAD kinase	NA	NA	NA	NA	NA
WP_148268662.1|1901608_1902304_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014105639.1|1902327_1902816_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014105640.1|1902853_1903318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105641.1|1903317_1904289_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014105642.1|1904396_1905509_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014105643.1|1905607_1905865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105644.1|1905905_1906331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247313.1|1906514_1906994_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_010510087.1|1907214_1907409_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_014105647.1|1907436_1908348_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_014105648.1|1908363_1909881_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_014104060.1|1911099_1912179_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014105650.1|1912380_1914051_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_081477885.1|1914280_1914625_-	endoribonuclease MazF	NA	Q708N9	Streptococcus_phage	42.3	5.8e-06
WP_014105651.1|1914621_1914864_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014105652.1|1915180_1916467_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_014105653.1|1916557_1917637_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158309230.1|1917721_1918087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105654.1|1918482_1919409_-	Bpu10I family restriction endonuclease	NA	NA	NA	NA	NA
WP_014105655.1|1919401_1920637_-	hypothetical protein	NA	S4VQ82	Pandoravirus	34.6	1.0e-52
WP_148268520.1|1921049_1921806_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_050856112.1|1921837_1922503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105658.1|1923281_1923470_+	type I restriction-modification system subunit M N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010511145.1|1923492_1924524_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014105660.1|1926267_1927458_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014105661.1|1927457_1928456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105662.1|1928602_1931998_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.1	2.1e-15
WP_148268573.1|1932159_1932917_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148268663.1|1934137_1934866_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_041247314.1|1935099_1935972_-	arginine deiminase	NA	NA	NA	NA	NA
WP_041247315.1|1936377_1937358_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014105667.1|1937423_1938986_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_014105668.1|1939014_1939740_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	4.3e-27
WP_014105669.1|1939885_1941019_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_014105671.1|1941274_1943644_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_014105672.1|1943686_1944901_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_014105673.1|1945222_1945903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105674.1|1946223_1947537_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014105675.1|1947544_1948429_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_014105676.1|1948514_1949378_-	squalene synthase HpnC	NA	NA	NA	NA	NA
WP_014105677.1|1949374_1950607_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014105678.1|1950617_1951613_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_014105679.1|1951805_1952888_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_014105680.1|1952933_1953836_+	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_193360640.1|1953904_1954084_+|transposase	transposase	transposase	NA	NA	NA	NA
1955195:1955212	attR	CCCGCGCGTGCTGGAACA	NA	NA	NA	NA
>prophage 6
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	2033939	2135074	3136818	transposase,tRNA,protease	uncultured_Mediterranean_phage(10.0%)	74	NA	NA
WP_014105758.1|2033939_2034644_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014105759.1|2034739_2035681_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014105760.1|2035677_2036346_-	DedA family protein	NA	NA	NA	NA	NA
WP_014105761.1|2036442_2038434_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_014105762.1|2038546_2039980_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	31.6	1.3e-38
WP_148268577.1|2039998_2040220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105763.1|2040230_2041706_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_014105764.1|2041762_2043202_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	43.0	4.3e-95
WP_014105765.1|2043229_2044288_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_014105766.1|2044410_2044896_+	flavin reductase	NA	NA	NA	NA	NA
WP_193360683.1|2045294_2045786_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_041247326.1|2045869_2046391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193360684.1|2046480_2047854_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	29.4	5.6e-28
WP_014105770.1|2047953_2049276_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014105771.1|2049298_2050168_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_014105772.1|2050370_2051207_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_014105773.1|2051203_2052433_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_041247327.1|2052629_2053601_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_041247328.1|2053758_2055066_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_148268578.1|2055831_2056998_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_193360685.1|2057500_2058673_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_014105778.1|2059317_2060844_+	hypothetical protein	NA	M4QMJ4	Micromonas_pusilla_virus	30.0	7.7e-26
WP_014105779.1|2060887_2062513_+	hypothetical protein	NA	V5L4U5	Insectomime_virus	28.3	6.5e-15
WP_007397838.1|2063481_2065092_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|2065155_2065503_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007400224.1|2065499_2065859_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014104109.1|2066274_2067498_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.8	1.5e-40
WP_148268665.1|2067853_2069188_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_148268579.1|2070434_2072384_-	dextranase	NA	NA	NA	NA	NA
WP_014104109.1|2074057_2075281_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.8	1.5e-40
WP_014105788.1|2075936_2076536_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	48.5	1.5e-30
WP_012812328.1|2077702_2078953_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_014105792.1|2079065_2080112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012812328.1|2080654_2081905_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_014104060.1|2082710_2083790_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014105797.1|2084157_2085300_+	hypothetical protein	NA	M4QMJ4	Micromonas_pusilla_virus	29.3	2.3e-19
WP_148268580.1|2085554_2086306_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.6	8.4e-26
WP_014105800.1|2087137_2088172_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.3	3.1e-47
WP_148268666.1|2091473_2091560_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158309231.1|2091576_2091750_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014105807.1|2091888_2093040_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_014105808.1|2093034_2093682_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.1e-10
WP_014105809.1|2093697_2094885_-	capsule polysaccharide transporter	NA	NA	NA	NA	NA
WP_148268581.1|2094973_2096263_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_014105811.1|2096534_2096675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105814.1|2098026_2098839_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014105815.1|2099237_2100548_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_014105816.1|2100711_2101683_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_041247336.1|2101706_2102162_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_041247337.1|2102175_2103570_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014105819.1|2103582_2105454_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_041247788.1|2105468_2106077_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014105821.1|2106069_2106891_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.8	4.0e-21
WP_014105822.1|2106893_2107793_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	33.2	2.6e-13
WP_014105823.1|2108122_2108863_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_014105824.1|2108859_2109639_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014105825.1|2109638_2110217_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_041247338.1|2110381_2113210_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.6	5.5e-78
WP_014105827.1|2113206_2113962_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014105828.1|2113943_2116049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105829.1|2116085_2117060_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_193360641.1|2117063_2117201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247339.1|2117461_2117896_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	46.7	9.2e-09
WP_014105832.1|2118017_2119601_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.1e-22
WP_193360642.1|2119903_2120821_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	3.2e-27
WP_014105834.1|2120849_2121587_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_014105835.1|2121631_2122207_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014105836.1|2122411_2123614_+	MFS transporter	NA	NA	NA	NA	NA
WP_014105837.1|2123659_2124244_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_014105838.1|2124564_2125359_+	polyprenol monophosphomannose synthase	NA	NA	NA	NA	NA
WP_148268582.1|2125683_2127192_+	mannosyltransferase	NA	NA	NA	NA	NA
WP_014105840.1|2127307_2128975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247340.1|2129084_2130188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247341.1|2133613_2135074_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 7
NC_016027	Komagataeibacter medellinensis NBRC 3288, complete genome	3136818	2361425	2391418	3136818	integrase,capsid,head,portal,terminase,tail,plate,protease	Pseudomonas_phage(23.08%)	40	2387148:2387161	2392284:2392297
WP_014105516.1|2361425_2362541_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	30.4	3.9e-27
WP_014105515.1|2362512_2362992_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_014105514.1|2362988_2363465_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_014105513.1|2363464_2364613_-|tail	tail protein	tail	NA	NA	NA	NA
WP_014106052.1|2364609_2365914_-	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	25.9	1.5e-17
WP_014105511.1|2365914_2368140_-	lytic transglycosylase domain-containing protein	NA	A0A1P8VV74	Rathayibacter_phage	27.9	4.1e-12
WP_014105510.1|2368257_2368569_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_014105509.1|2368565_2368943_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_014105508.1|2368952_2370428_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	36.2	4.0e-64
WP_014105507.1|2370424_2370676_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_014105506.1|2370675_2371239_-	hypothetical protein	NA	Q8W624	Enterobacteria_phage	34.1	2.4e-17
WP_014105505.1|2371235_2371775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014105504.1|2371761_2372163_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_014105503.1|2372155_2372800_-|head,tail	phage head-tail connector protein	head,tail	H9YSG3	environmental_Halophage	31.4	5.5e-10
WP_014106053.1|2372799_2373102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014106054.1|2373143_2374682_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	41.6	1.6e-55
WP_014106055.1|2374723_2375422_-|head,protease	HK97 family phage prohead protease	head,protease	A0A218MM23	uncultured_virus	34.2	6.4e-12
WP_014106056.1|2375424_2376744_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	35.3	5.6e-57
WP_014106057.1|2376750_2378388_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	39.6	7.3e-99
WP_014106058.1|2378387_2378957_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_014106059.1|2378977_2379616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014106060.1|2379615_2379918_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	54.4	1.2e-18
WP_014106061.1|2380197_2382048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247729.1|2382034_2383021_-	toprim domain-containing protein	NA	A0A0U4B0G9	Pseudomonas_phage	40.5	1.6e-16
WP_014105492.1|2383062_2383275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014106062.1|2383271_2383625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081477896.1|2384152_2384347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050856121.1|2384925_2385378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148268587.1|2385457_2386108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268588.1|2386203_2386458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106067.1|2386484_2386721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041247372.1|2386892_2387141_+	hypothetical protein	NA	NA	NA	NA	NA
2387148:2387161	attL	TGCGCCCCCACGGC	NA	NA	NA	NA
WP_014105488.1|2387339_2387603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014105487.1|2387589_2387835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268668.1|2387834_2389472_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	27.8	3.5e-08
WP_014106071.1|2389471_2389684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106072.1|2389680_2389821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268669.1|2390002_2390248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148268589.1|2390240_2390585_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148268590.1|2390641_2391418_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2392284:2392297	attR	TGCGCCCCCACGGC	NA	NA	NA	NA
>prophage 1
NC_016037	Komagataeibacter medellinensis NBRC 3288 plasmid pGXY010, complete sequence	255866	104474	249350	255866	integrase,transposase	uncultured_Caudovirales_phage(21.05%)	111	171842:171901	233934:234802
WP_007397838.1|104474_106085_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|106148_106496_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	51.4	4.3e-25
WP_007400224.1|106492_106852_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	42.3	1.0e-05
WP_014106856.1|107201_108113_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014106857.1|108303_109701_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_007396728.1|110154_110841_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	1.5e-26
WP_007396730.1|111272_111980_-	VIT family protein	NA	NA	NA	NA	NA
WP_007396731.1|111969_112551_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_014106858.1|112797_113292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524216.1|113861_115403_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_010509921.1|117022_118624_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_007396744.1|119252_119951_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.9	9.1e-83
WP_174520959.1|119971_121270_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.9	2.3e-132
WP_014106862.1|121266_121689_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	8.8e-49
WP_014106863.1|121685_122039_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023524214.1|122162_122564_+	RcnB family protein	NA	NA	NA	NA	NA
WP_102325815.1|123130_123898_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	28.7	2.1e-08
WP_014106867.1|123894_124704_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041247918.1|124925_126005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014106869.1|126045_126954_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023524212.1|126973_127858_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_014106874.1|130917_133212_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014106875.1|133325_134216_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014106876.1|135791_136307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106877.1|136287_136773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106880.1|137542_138061_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_014106881.1|138131_139220_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_014106882.1|139227_140310_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_014106883.1|140652_141411_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	8.2e-13
WP_014106884.1|141407_142415_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_014106885.1|142411_143251_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010516556.1|143252_145352_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007396790.1|146291_146759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106887.1|146763_148218_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_148268689.1|148779_149965_+|transposase	IS3-like element ISGxy1 family transposase	transposase	Q716C2	Shigella_phage	31.8	4.9e-28
WP_014106890.1|150273_151182_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_110914778.1|151695_153054_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_023524197.1|154050_154263_+	CbtB-domain containing protein	NA	NA	NA	NA	NA
WP_070097777.1|154276_155059_+	CbtA family protein	NA	NA	NA	NA	NA
WP_014106893.1|155573_156161_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_014106894.1|156229_157462_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_014106895.1|157454_157787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524194.1|157901_159236_-	hypothetical protein	NA	Q8W6C3	Saccharomonospora_phage	24.8	3.9e-18
WP_014106897.1|159586_162520_-|transposase	IS110 family transposase	transposase	A0A0K1Y8T6	Streptomyces_phage	28.7	2.1e-64
WP_193360695.1|162516_163947_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_014106901.1|165645_170859_+	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	24.1	5.4e-39
WP_041247921.1|171136_171691_+	hypothetical protein	NA	NA	NA	NA	NA
171842:171901	attL	CCTAGAGGGTGTTATGTACTTTCGTTCCTGATTGGTGCAGTAATGAGGGATGGCACCCGC	NA	NA	NA	NA
WP_014106903.1|171890_172700_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148268690.1|172582_173170_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_014106905.1|173458_174235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014106906.1|174224_175562_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014106907.1|175996_177442_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014106908.1|177780_178179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014106909.1|178252_178903_+	cation transporter	NA	NA	NA	NA	NA
WP_014106910.1|178895_180338_+	TolC family protein	NA	NA	NA	NA	NA
WP_014106911.1|180334_181369_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014106912.1|181368_184503_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.0e-61
WP_110914815.1|184622_185809_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	3.1e-22
WP_014106913.1|186118_187207_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_041247923.1|187210_187780_-	hydrolase	NA	NA	NA	NA	NA
WP_014106915.1|187896_188526_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014106916.1|188658_189552_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041247943.1|190506_191445_+	plasmid replication initiator	NA	NA	NA	NA	NA
WP_007400691.1|192777_193476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081477947.1|194421_194616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106919.1|195002_196448_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_110914585.1|196572_197463_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_014106921.1|197775_198849_-	alkene reductase	NA	NA	NA	NA	NA
WP_081477948.1|199741_199891_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_014106923.1|199877_200897_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014106924.1|200899_202333_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014106925.1|202611_204384_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	24.1	8.4e-08
WP_014106926.1|204399_205647_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_019091908.1|205663_205951_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_014106928.1|205938_207117_-	MSMEG_0565 family glycosyltransferase	NA	NA	NA	NA	NA
WP_014106929.1|207113_208088_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_023524185.1|208084_208648_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014106931.1|208647_209754_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_014106932.1|209750_210725_-	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_010512510.1|210749_211232_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_014106934.1|211572_212976_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_193360696.1|213130_214213_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014106936.1|214725_215448_-	TonB family protein	NA	NA	NA	NA	NA
WP_041247944.1|215579_216014_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_014106938.1|216081_218238_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_193360697.1|219511_220594_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014106942.1|222366_222912_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010512019.1|223000_223222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014106943.1|223218_223797_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_010512024.1|225967_226423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|226437_227688_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_110914731.1|227867_228633_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	39.7	2.0e-11
WP_014106948.1|229477_230755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014106949.1|230912_232175_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.1	7.2e-30
WP_014106903.1|233134_233944_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010512344.1|235810_236176_+	DUF488 family protein	NA	NA	NA	NA	NA
233934:234802	attR	GCGGGTGCCATCCCTCATTACTGCACCAATCAGGAACGAAAGTACATAACACCCTCTAGGCCCTTCGCGTCCCAGGGCCAGACCGCTCTCAATCGCCAGTAGACCGCCGACGAATTTGACCGGGATGAGTGGCCATGACGCCGGGCCGGTAATGCCCGATAGCACGGCTTCGACATGAGGAATGCCGCTGCCTGCCGCCAGCGGTGCAAGGCGGCGTACCATTTCTACAGCTGCCAGAGCTGCCAGGGCAACGCCGACGACCAGAAAGAAGCCTCCCCACGGCGAACCATGCAGAAACCGAGGGGCCATCTCCGTTCGCGTGAATTCCAGCCACTCCAGAAACAGGCGAAAGGTTCCGCAGATCGTACCGGTTGCGATACCGATCAGGATTGACGCTGACGCGAGGAAAACCAGACTGCAGGAACTGTCGGTTCGTTCTGAGTGCGGTGTTCTATCTGGCACCTGCTGTAGCACGGCGTCTTCTTTCGTTGACTGAGGTTCCCCGGCTTCGAATGCGACATCTGCGATCCGGGTCGCTGTTCATGAGGGACCCGTTTCCGGGCTCGGATCAGTTTTTTTCTGAATCTCCTTCTGCTCGGTCTTTTCCATGAAACCTGTAGCAAGGACGGAATATAGTGGATGAGGGCAGATCATTCGCGACACTCCGAACGCCAGAAATGCGGTTGCCAGAAGCGCCAGCGTGACCTGCTGGTTATCGCATATCTCCATCACGATGATCGTCGCTGTGAGCGGAGATTGGGCAACGCCACAGAAATATGCCGCCATCCCAAGCAGAACGACAGCACCTGGAGAGGTATGGGGTAGGAACTGTCCGATCCACCCGCCCATGCCAGCACCGATAGCTAGGG	NA	NA	NA	NA
WP_014106953.1|236237_236627_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_023524174.1|236623_236896_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_010512346.1|236909_237125_-	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_010512347.1|237160_237739_+	DUF488 domain-containing protein	NA	A0A2K9L455	Tupanvirus	40.0	5.1e-23
WP_193360696.1|237987_239070_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010512257.1|239161_239791_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014106954.1|239911_241891_-	oleate hydratase	NA	NA	NA	NA	NA
WP_014106955.1|242099_242996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014106956.1|243094_243913_+	pirin family protein	NA	NA	NA	NA	NA
WP_014106935.1|244106_245186_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014106957.1|245276_245570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014106958.1|245656_247027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524172.1|247397_247580_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148268691.1|247822_248272_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_193360696.1|248267_249350_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_016021	Komagataeibacter medellinensis NBRC 3288 plasmid pGXY020, complete sequence	76071	21307	58368	76071	transposase	Streptococcus_phage(18.18%)	27	NA	NA
WP_010511145.1|21307_22339_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041247961.1|22809_23769_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_110914815.1|24364_25551_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	3.1e-22
WP_014095376.1|26579_28502_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	32.9	1.5e-74
WP_014095377.1|28700_29480_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.8	1.4e-31
WP_041247965.1|30032_31055_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_014095380.1|31316_32702_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_014095381.1|32759_33647_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_012813131.1|33989_34439_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012813132.1|34475_35798_-	porin	NA	NA	NA	NA	NA
WP_041247966.1|36073_36163_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_014095382.1|36165_37872_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_014095383.1|37886_39995_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	30.3	2.8e-34
WP_167537206.1|40014_40629_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_014095385.1|40628_43316_+	sensor histidine kinase KdpD	NA	Q8QNA2	Ectocarpus_siliculosus_virus	23.5	2.8e-07
WP_012813137.1|43312_43996_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	9.3e-24
WP_012813329.1|44299_44869_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010512305.1|45008_45623_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	2.1e-38
WP_041247968.1|45748_48640_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.9	8.7e-188
WP_014095387.1|49156_52819_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_007284568.1|52818_53139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007284570.1|54041_54941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007284571.1|54928_55588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247969.1|55632_55860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070097778.1|55824_56397_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_148268692.1|56440_57214_-	Fic family protein	NA	NA	NA	NA	NA
WP_087652208.1|57158_58368_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	1.9e-96
