The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015064	Granulicella tundricola MP5ACTX9, complete genome	4309153	64747	122068	4309153	plate,integrase,transposase	Mycobacterium_phage(25.0%)	45	92950:92977	125581:125608
WP_013578477.1|64747_66079_+|plate	platelet-activating factor acetylhydrolase plasma/intracellular isoform II	plate	NA	NA	NA	NA
WP_041596847.1|66119_66335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578478.1|66424_68125_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.5	4.5e-35
WP_013578479.1|68417_69488_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_157477696.1|69519_71493_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_013578481.1|71524_71812_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_013578482.1|71795_72107_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013578483.1|72168_72999_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_013578485.1|76412_77132_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_013578486.1|77526_78465_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_049789389.1|78509_81677_+	TAT-variant-translocated molybdopterin oxidoreductase	NA	NA	NA	NA	NA
WP_041597226.1|81719_83120_+	hydrogenase	NA	NA	NA	NA	NA
WP_013578489.1|83119_83662_+	DUF3341 domain-containing protein	NA	NA	NA	NA	NA
WP_157477698.1|83747_84521_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_013578491.1|84588_85923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578492.1|85912_86626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049789170.1|86715_87603_+	SCO family protein	NA	NA	NA	NA	NA
WP_013578494.1|87605_88649_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_013578495.1|88645_90319_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_157477700.1|90449_91088_+	cytochrome c oxidase subunit 3 family protein	NA	NA	NA	NA	NA
WP_013578497.1|91120_91456_+	oxidase	NA	NA	NA	NA	NA
WP_013578498.1|91535_92810_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
92950:92977	attL	GGGGTTCGAATCCCTCTCCCTCCGCCAT	NA	NA	NA	NA
WP_013578499.1|93106_94363_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013578500.1|94561_94777_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013578501.1|94773_95070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578502.1|95066_96254_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	26.4	2.1e-10
WP_083808346.1|96356_97520_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013578504.1|98061_98976_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	25.2	2.1e-07
WP_013578505.1|99123_102231_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_013578506.1|102223_105031_+	site-specific DNA-methyltransferase	NA	G8I4P9	Mycobacterium_phage	26.6	5.5e-22
WP_013578507.1|105045_105519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578508.1|105518_107711_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_041596851.1|108511_108850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013578509.1|109237_109963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157477174.1|111632_112583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578511.1|112873_113206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578512.1|113224_114175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578513.1|115277_115988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157477176.1|116713_116932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578514.1|117303_117993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578515.1|118431_118833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013578516.1|118829_119315_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	34.4	2.0e-20
WP_083808349.1|119735_120167_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.4	4.7e-05
WP_049789173.1|120176_120443_-	recombinase family protein	NA	W8CYE4	Bacillus_phage	43.0	9.2e-12
WP_041597230.1|121108_122068_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	47.9	3.4e-72
125581:125608	attR	GGGGTTCGAATCCCTCTCCCTCCGCCAT	NA	NA	NA	NA
>prophage 2
NC_015064	Granulicella tundricola MP5ACTX9, complete genome	4309153	231451	239643	4309153		Ostreococcus_lucimarinus_virus(33.33%)	8	NA	NA
WP_013578591.1|231451_232384_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	32.1	9.7e-40
WP_013578592.1|232380_233433_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041596867.1|233438_235214_-	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.6	4.2e-76
WP_013578594.1|235213_236302_-	3-dehydroquinate synthase	NA	C7U071	Ostreococcus_tauri_virus	39.5	4.3e-31
WP_013578595.1|236285_236999_-	SDR family oxidoreductase	NA	E5ERI5	Ostreococcus_lucimarinus_virus	33.5	9.7e-24
WP_013578596.1|236998_237796_-	aldolase	NA	E5ERI3	Ostreococcus_lucimarinus_virus	32.4	6.2e-19
WP_157477709.1|237906_238539_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013578598.1|238767_239643_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	31.6	8.8e-27
>prophage 3
NC_015064	Granulicella tundricola MP5ACTX9, complete genome	4309153	1794889	1805139	4309153	integrase	uncultured_phage(33.33%)	8	1796338:1796353	1803058:1803073
WP_013579918.1|1794889_1796287_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	30.2	8.1e-06
1796338:1796353	attL	AGGGCCTAGAGCCTAG	NA	NA	NA	NA
WP_157477387.1|1796558_1797500_+	tyrosine recombinase	NA	A0A166YH27	Gordonia_phage	34.3	1.5e-11
WP_013579920.1|1797496_1798429_+|integrase	tyrosine-type recombinase/integrase	integrase	T2KT84	uncultured_phage	40.5	8.8e-17
WP_013579921.1|1798542_1799100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013579922.1|1799099_1801073_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.5	9.0e-11
WP_013579923.1|1801148_1802552_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	5.1e-08
WP_041597540.1|1802714_1803053_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_013579925.1|1803069_1805139_-	S9 family peptidase	NA	F2Y2S5	Organic_Lake_phycodnavirus	21.7	6.3e-15
1803058:1803073	attR	AGGGCCTAGAGCCTAG	NA	NA	NA	NA
>prophage 4
NC_015064	Granulicella tundricola MP5ACTX9, complete genome	4309153	2291632	2298964	4309153	terminase,portal,head,protease,capsid	Streptococcus_phage(28.57%)	9	NA	NA
WP_013580321.1|2291632_2291980_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	47.4	2.8e-16
WP_013580322.1|2292113_2292614_+|terminase	phage terminase small subunit P27 family	terminase	A0A0R6PKB6	Moraxella_phage	38.8	3.4e-15
WP_013580323.1|2292624_2294292_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	44.6	4.9e-127
WP_013580324.1|2294292_2295639_+|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	38.8	1.0e-69
WP_013580325.1|2295628_2296381_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0M4R4P2	Enterococcus_phage	44.0	4.0e-28
WP_013580326.1|2296515_2297682_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	25.0	3.7e-20
WP_157477453.1|2297752_2297944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580328.1|2297953_2298613_+	DNA-packaging protein	NA	B4UTP7	Rhizobium_phage	34.1	2.9e-14
WP_013580329.1|2298613_2298964_+|head	phage head closure protein	head	NA	NA	NA	NA
>prophage 5
NC_015064	Granulicella tundricola MP5ACTX9, complete genome	4309153	2321864	2361464	4309153	integrase,transposase	Ralstonia_phage(25.0%)	32	2323251:2323309	2361578:2361636
WP_013580348.1|2321864_2323145_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	31.5	3.9e-07
2323251:2323309	attL	GTGGTGCCCGAGGGGGGACTTGAACCCCCATTCCCTAAAGGGCGACGGATTTTAAGTCC	NA	NA	NA	NA
WP_013580350.1|2323484_2324207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580352.1|2324522_2324816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580354.1|2325869_2326049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580355.1|2326637_2327597_+	lipoprotein transmembrane	NA	NA	NA	NA	NA
WP_013580356.1|2328811_2329360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083808424.1|2329674_2329980_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_049789267.1|2330060_2330261_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_049789268.1|2330337_2331306_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013580360.1|2331302_2332547_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157477916.1|2332950_2333769_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041597230.1|2335541_2336501_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	47.9	3.4e-72
WP_013580366.1|2337458_2338247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580367.1|2338248_2338851_+	class D sortase	NA	NA	NA	NA	NA
WP_013580369.1|2340007_2340340_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013580370.1|2341151_2342312_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	7.8e-39
WP_083808426.1|2342399_2342822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083808427.1|2343026_2343398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580373.1|2343472_2343742_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	62.1	6.5e-13
WP_013580376.1|2344829_2345045_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	56.5	4.0e-13
WP_013580377.1|2345279_2345528_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_013580378.1|2345826_2346453_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_157477457.1|2347562_2348375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580381.1|2348474_2349086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580382.1|2349746_2352929_-	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	24.6	1.1e-10
WP_013580384.1|2354088_2354610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580385.1|2354699_2354957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157477459.1|2355356_2355698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041597230.1|2356046_2357006_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	47.9	3.4e-72
WP_013580387.1|2357297_2358521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580388.1|2358520_2359723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580390.1|2360405_2361464_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	31.0	7.7e-17
2361578:2361636	attR	GTGGTGCCCGAGGGGGGACTTGAACCCCCATTCCCTAAAGGGCGACGGATTTTAAGTCC	NA	NA	NA	NA
>prophage 6
NC_015064	Granulicella tundricola MP5ACTX9, complete genome	4309153	2935945	2986607	4309153	integrase,transposase	Corynebacterium_phage(12.5%)	47	2930768:2930782	2989341:2989355
2930768:2930782	attL	CCAGCCTCAATCTCC	NA	NA	NA	NA
WP_013573305.1|2935945_2936977_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157477528.1|2937449_2937869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580854.1|2937995_2938739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580855.1|2938963_2939524_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013580856.1|2939784_2940234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013580857.1|2940176_2940458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580858.1|2940718_2942755_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_013580859.1|2942924_2943269_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_157477530.1|2943863_2944733_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	27.5	2.0e-18
WP_013580862.1|2945113_2945356_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013580863.1|2945594_2946557_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049789293.1|2946589_2946862_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041597090.1|2947162_2947459_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_013580865.1|2947820_2948078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580866.1|2948628_2951049_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.0	7.8e-65
WP_041597091.1|2951575_2952208_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_157477963.1|2952251_2954684_+	phosphoketolase	NA	NA	NA	NA	NA
WP_157477532.1|2954686_2955760_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	46.8	2.0e-73
WP_013580870.1|2955756_2956557_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_049789425.1|2956644_2959176_-	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
WP_013580872.1|2959181_2960867_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_013580873.1|2960910_2961780_-	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_013580874.1|2961836_2962769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580875.1|2962765_2964331_-	alternate F1F0 ATPase, F1 subunit alpha	NA	NA	NA	NA	NA
WP_013580876.1|2964327_2965116_-	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_013580877.1|2965119_2965404_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_013580878.1|2965418_2966135_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013580879.1|2966131_2966440_-	F1F0 ATPase	NA	NA	NA	NA	NA
WP_013580880.1|2966432_2966774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580881.1|2966763_2967156_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_013580882.1|2967145_2968618_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_041597758.1|2968857_2969817_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	48.2	4.4e-72
WP_013580885.1|2969961_2972055_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_013580886.1|2972199_2973192_-	zinc-binding alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	27.4	2.8e-13
WP_013580887.1|2973366_2973606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580888.1|2973949_2974723_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_013580889.1|2974706_2975276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580890.1|2975623_2976067_-	NUDIX hydrolase	NA	I4AZJ3	Saccharomonospora_phage	41.1	1.4e-12
WP_013580891.1|2976102_2977308_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.4	1.8e-09
WP_013580892.1|2977320_2978826_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013580893.1|2978822_2979158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013580894.1|2979519_2980200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013580895.1|2980391_2982098_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.0	8.9e-15
WP_013580896.1|2982180_2982597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083808440.1|2983183_2984437_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041597095.1|2984433_2985786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041597096.1|2985749_2986607_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2989341:2989355	attR	GGAGATTGAGGCTGG	NA	NA	NA	NA
>prophage 1
NC_015057	Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence	475658	13496	96241	475658	transposase,plate	Planktothrix_phage(33.33%)	54	NA	NA
WP_013572706.1|13496_14549_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013572707.1|14512_16360_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013572708.1|16363_16825_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_013572709.1|16854_18714_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_013572710.1|18700_19432_-	virulence protein SciE type	NA	NA	NA	NA	NA
WP_013572711.1|19439_19916_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013572712.1|19997_21491_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013572713.1|21483_22005_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013572714.1|22431_23787_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013572715.1|23890_25909_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_013572716.1|25966_28417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013572717.1|28656_30015_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013572718.1|30011_30746_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_013572719.1|30742_34129_+	ImcF domain-containing protein	NA	NA	NA	NA	NA
WP_013572720.1|34207_34984_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	G9BWD9	Planktothrix_phage	27.1	3.1e-07
WP_013572721.1|35289_36555_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_157478188.1|36718_37351_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_157478128.1|37875_40944_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.8e-19
WP_013572724.1|41014_42376_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_013572725.1|42372_44046_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_013572726.1|44042_48425_-	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_013572727.1|48428_49151_-	CbtA family protein	NA	NA	NA	NA	NA
WP_013572728.1|49181_49400_-	cobalt ABC transporter	NA	NA	NA	NA	NA
WP_013572729.1|49616_50201_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013572730.1|50480_54101_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013572731.1|54227_57617_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157478190.1|57662_58868_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_013572733.1|59060_60317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013572734.1|60344_61310_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013572735.1|61398_61866_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013572736.1|61882_62758_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013572737.1|62807_64127_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013572738.1|64197_65208_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_013572739.1|65423_66020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013572740.1|66030_66663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013572741.1|66655_68053_+	dyp-type peroxidase	NA	NA	NA	NA	NA
WP_013572742.1|68233_70681_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157478130.1|70743_71328_-	solute-binding protein	NA	NA	NA	NA	NA
WP_041597976.1|71284_71692_-	solute-binding protein	NA	NA	NA	NA	NA
WP_013572743.1|71801_72248_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_013572744.1|72297_74535_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_013572745.1|74994_76044_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013572746.1|76215_77490_-	MGT family glycosyltransferase	NA	NA	NA	NA	NA
WP_041597977.1|77618_78767_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_157478132.1|79101_80151_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_041597979.1|80147_81758_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.7	5.1e-20
WP_013572750.1|81806_82601_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_013572751.1|82597_83263_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-34
WP_013572752.1|83838_87252_-	NHL repeat containing protein	NA	NA	NA	NA	NA
WP_041597981.1|87293_88706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041597982.1|88864_91063_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_013572753.1|91132_93079_-	family 16 glycosylhydrolase	NA	M1HKY4	Acanthocystis_turfacea_Chlorella_virus	31.6	4.3e-21
WP_013572754.1|93293_94559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157477320.1|94699_96241_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	28.4	2.3e-06
>prophage 1
NC_015060	Granulicella tundricola MP5ACTX9 plasmid pACIX905, complete sequence	115221	51615	99833	115221	integrase,transposase	Virus_Rctr85(22.22%)	40	67966:67981	82454:82469
WP_013573293.1|51615_52578_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	27.4	2.5e-14
WP_013573295.1|53465_53693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049789507.1|53881_54514_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_157478410.1|54727_56779_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041598313.1|57496_58366_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013573299.1|58527_59922_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_013573300.1|60076_63139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041598314.1|63661_65491_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013573302.1|65493_67218_+	AAA family ATPase	NA	S5M596	Bacillus_phage	28.2	2.5e-09
WP_013573303.1|67575_68211_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	56.7	1.6e-30
67966:67981	attL	TTCGCGGAGTTCGAAG	NA	NA	NA	NA
WP_013573304.1|68267_68648_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013573305.1|68792_69824_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157478412.1|70167_70701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573307.1|70756_72700_-	PBS lyase	NA	NA	NA	NA	NA
WP_013573308.1|73446_74400_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	28.0	2.5e-14
WP_013573309.1|74543_75875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157478414.1|76601_76772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157478416.1|76944_77496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573312.1|77973_79512_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.7	4.5e-50
WP_157478418.1|79932_80148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789515.1|80922_81354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041598289.1|82105_82681_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	41.7	6.9e-28
82454:82469	attR	TTCGCGGAGTTCGAAG	NA	NA	NA	NA
WP_013573315.1|82814_84011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573316.1|84099_84735_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	57.5	7.3e-31
WP_041598291.1|84755_85172_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013573318.1|85281_85620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157478416.1|85697_86249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041598292.1|86390_87188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573320.1|89610_90279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573321.1|90414_91161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573322.1|91264_91675_+	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_013573324.1|92682_93126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573325.1|93216_93690_+	DUF2321 domain-containing protein	NA	U3PDZ3	Staphylococcus_phage	27.5	1.0e-05
WP_157478420.1|93838_94060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573327.1|94502_94760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573329.1|94960_95134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013573330.1|95169_95526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013573331.1|95530_96262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083808548.1|96627_98211_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	28.2	4.1e-06
WP_013573335.1|98501_99833_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
