The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NC_016631	Granulicella mallensis MP5ACTX8, complete sequence	6237577	3939231	3998503	6237577	integrase,protease,transposase	Bacillus_phage(20.0%)	44	3962721:3962750	3964222:3964251
WP_014266341.1|3939231_3940197_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014266342.1|3940193_3941486_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_190273674.1|3941638_3941794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150110626.1|3941820_3942180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014266343.1|3942621_3946386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014266344.1|3946429_3947074_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	33.0	2.0e-12
WP_014266345.1|3947226_3948264_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	33.3	3.0e-05
WP_014266346.1|3948260_3949775_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_014266347.1|3949767_3952986_+	error-prone DNA polymerase	NA	A0A0K2FL87	Brevibacillus_phage	26.2	1.3e-70
WP_014266349.1|3953262_3954330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014266350.1|3954334_3956146_-	restriction system-associated AAA family ATPase	NA	NA	NA	NA	NA
WP_014266351.1|3956142_3957642_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014266352.1|3957710_3959291_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.5	1.3e-36
WP_014266353.1|3959292_3962109_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
3962721:3962750	attL	TTAAGTCCGCTGTGTCTGCCGATTTCACCA	NA	NA	NA	NA
WP_014266354.1|3962804_3964082_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_150110627.1|3964304_3966698_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.5e-12
3964222:3964251	attR	TTAAGTCCGCTGTGTCTGCCGATTTCACCA	NA	NA	NA	NA
WP_085942754.1|3966872_3967490_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014266357.1|3967486_3967732_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_150110889.1|3969138_3970038_-	glutamate formimidoyltransferase	NA	NA	NA	NA	NA
WP_014266360.1|3970198_3970930_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_014266361.1|3971001_3971742_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014266362.1|3971957_3972242_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_014266363.1|3972229_3972523_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_083836696.1|3972558_3973893_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014266365.1|3973826_3974147_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_150110890.1|3974215_3975202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014266367.1|3975577_3975850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014266368.1|3975939_3977328_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_014266369.1|3977324_3977828_+	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_044178829.1|3978083_3979214_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014266371.1|3979843_3981085_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014263964.1|3981356_3982427_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_150110628.1|3982632_3983334_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	2.0e-29
WP_014266373.1|3983545_3985621_-	hypothetical protein	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	33.4	4.8e-31
WP_014266374.1|3985786_3986908_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_190273675.1|3987023_3988118_-	beta-lactamase family protein	NA	NA	NA	NA	NA
WP_014266376.1|3988910_3991388_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.6	4.7e-126
WP_052310631.1|3991709_3991982_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014266378.1|3992059_3992356_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_150110629.1|3992454_3993252_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_014266380.1|3993391_3994681_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_150110891.1|3994855_3996274_+	trigger factor	NA	NA	NA	NA	NA
WP_044176876.1|3996382_3996973_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.4	1.9e-49
WP_014266383.1|3997216_3998503_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.9	4.3e-123
