The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	909280	936509	4714237	portal,integrase,terminase,head,protease,capsid,tRNA	Clostridium_phage(16.67%)	38	901636:901651	927765:927780
901636:901651	attL	AAAGCATTTGTTATCT	NA	NA	NA	NA
WP_013655745.1|909280_909928_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_013655746.1|910113_910431_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.8	1.8e-17
WP_013655747.1|910520_911774_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013655748.1|912658_914539_+	DUF4914 family protein	NA	NA	NA	NA	NA
WP_013655749.1|914899_916030_-|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	33.0	1.4e-32
WP_013655750.1|916198_916744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655751.1|916821_917739_-	3'-5' exoribonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.5	1.4e-51
WP_013655752.1|917797_918166_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WE86	Clostridium_phage	39.8	2.1e-14
WP_013655753.1|918292_918457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655754.1|918459_918768_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013655755.1|918780_918987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655756.1|918999_919170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864033.1|919406_919607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655759.1|919794_920520_+	hypothetical protein	NA	I2E8X7	Clostridium_phage	33.5	2.7e-21
WP_013655760.1|920531_920696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655761.1|920670_921270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041713340.1|921293_921653_+	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	44.8	1.2e-19
WP_013655763.1|921657_922443_+	ParA family protein	NA	H7BUL8	unidentified_phage	43.3	1.4e-52
WP_013655764.1|922452_923409_+	ParB N-terminal domain-containing protein	NA	H7BUL7	unidentified_phage	35.1	3.4e-32
WP_013655765.1|923520_924198_-	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	48.4	2.3e-51
WP_013655766.1|924662_926183_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	45.8	1.9e-125
WP_013655767.1|926237_926522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013655768.1|926683_926977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013655769.1|927102_927270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655770.1|927306_927591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655771.1|927619_927967_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
927765:927780	attR	AGATAACAAATGCTTT	NA	NA	NA	NA
WP_013655772.1|927978_928527_+	sigma-70 region 4 type 2	NA	I2E8Y5	Clostridium_phage	33.9	5.6e-11
WP_041713347.1|928720_929023_+	HNH endonuclease	NA	A0A0S2SXR6	Bacillus_phage	55.7	1.3e-22
WP_013655774.1|929100_929496_+|terminase	P27 family phage terminase small subunit	terminase	A0A0S2SXN4	Bacillus_phage	40.2	1.1e-16
WP_013655775.1|929476_931207_+|terminase	terminase large subunit	terminase	Q0H264	Geobacillus_phage	71.4	3.0e-252
WP_157864104.1|931219_932416_+|portal	phage portal protein	portal	A0A0U4JE15	Exiguobacterium_phage	44.8	3.0e-86
WP_013655777.1|932408_932999_+|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	65.8	1.9e-65
WP_013655778.1|932980_934384_+|capsid	phage major capsid protein	capsid	A6XMJ6	Bacillus_virus	66.7	3.4e-137
WP_013655779.1|934519_934795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655780.1|934784_935090_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_013655781.1|935076_935514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655782.1|935510_935891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655783.1|935897_936509_+	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	46.6	6.3e-48
>prophage 2
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	944712	996397	4714237	integrase,holin,portal,capsid	Clostridium_phage(21.74%)	61	941080:941094	988038:988052
941080:941094	attL	AATATGCAAAAAAGG	NA	NA	NA	NA
WP_013655793.1|944712_945174_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	37.8	5.3e-15
WP_013655794.1|945145_945910_+	N-acetylmuramoyl-L-alanine amidase	NA	H7BUY1	unidentified_phage	38.2	5.5e-17
WP_013655795.1|946331_947342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655796.1|947673_948417_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_041713362.1|948616_949612_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013655798.1|949716_951366_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_013655799.1|951530_953213_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_013655800.1|953215_954007_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_013655801.1|954266_955400_+	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_013655802.1|955377_956220_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_013655803.1|956234_956783_+	Fe-S-containing hydro-lyase	NA	NA	NA	NA	NA
WP_085951463.1|956929_957748_+	signal peptide peptidase SppA	NA	A0A2I7QTH6	Vibrio_phage	27.3	1.0e-08
WP_013655805.1|958046_959345_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_013655806.1|959356_960655_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_013655807.1|960674_961100_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_013655808.1|961288_961672_+	nucleotidyltransferase substrate-binding family protein	NA	NA	NA	NA	NA
WP_013655809.1|961896_962517_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_013655810.1|962599_963115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655811.1|963144_965181_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_013655812.1|965350_967474_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_013655813.1|967581_970197_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013655814.1|970772_971825_-|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	34.9	1.3e-48
WP_013655815.1|971838_972492_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013655816.1|972523_972880_-	helix-turn-helix transcriptional regulator	NA	A3F613	Streptococcus_phage	37.7	3.9e-05
WP_013655817.1|973129_973336_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013655818.1|973310_973511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655819.1|973507_974341_+	phage antirepressor Ant	NA	B6SBX3	Clostridium_virus	36.4	1.3e-27
WP_013655820.1|974343_974667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655821.1|974680_974869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041712906.1|974854_975433_-	hypothetical protein	NA	X5JB43	Clostridium_phage	28.1	6.1e-08
WP_013655823.1|975530_975845_+	RNA polymerase Rbp10	NA	NA	NA	NA	NA
WP_157864034.1|975831_975987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013655827.1|976383_976671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655828.1|976671_976848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655829.1|976851_978474_+	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	40.3	5.2e-105
WP_013655830.1|978476_979271_+	recombinase RecT	NA	H7BUU1	unidentified_phage	52.1	8.0e-59
WP_050794665.1|979257_980070_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RVR3	Clostridium_phage	50.6	1.7e-69
WP_013655832.1|980116_980935_+	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	52.8	2.7e-30
WP_162145064.1|980840_981662_+	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	38.8	2.9e-40
WP_013655834.1|981663_982089_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0A8WJX1	Clostridium_phage	38.8	9.2e-22
WP_013655835.1|982153_982324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655836.1|982379_982625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655837.1|982825_983230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655838.1|983258_983486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655839.1|983732_984392_+	DNA cytosine methyltransferase	NA	D5LH17	Escherichia_phage	30.1	3.7e-17
WP_013655841.1|984828_985023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655842.1|985208_985469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655843.1|985497_985668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864036.1|985697_985859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655844.1|985908_986295_+	hypothetical protein	NA	A0A0H3UZ02	Geobacillus_virus	37.6	4.8e-09
WP_013655845.1|986381_987344_+|integrase	site-specific integrase	integrase	A0A1G5SC03	Enterococcus_phage	34.0	7.9e-45
WP_013655846.1|987571_988036_+	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	33.1	2.5e-12
WP_013655847.1|988313_989030_+	hypothetical protein	NA	A0A1L2JY44	Aeribacillus_phage	46.8	5.5e-35
988038:988052	attR	AATATGCAAAAAAGG	NA	NA	NA	NA
WP_013655848.1|989031_990291_+|portal	phage portal protein	portal	A0A1J1J8Z1	Escherichia_phage	35.1	4.5e-56
WP_013655849.1|990430_991840_+|portal	phage portal protein	portal	F6K8Q7	Clostridium_phage	50.0	4.9e-120
WP_013655850.1|991852_993445_+|capsid	phage minor capsid protein	capsid	A0A2K9V3K1	Faecalibacterium_phage	39.4	1.6e-71
WP_013655851.1|993444_993744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655852.1|993808_993955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655853.1|993951_994179_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	46.4	1.3e-11
WP_013655854.1|994448_995036_+	phage scaffolding protein	NA	NA	NA	NA	NA
WP_013655855.1|995056_996397_+	hypothetical protein	NA	A0A0A7RTH8	Clostridium_phage	44.5	8.1e-88
>prophage 3
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	1035407	1046425	4714237	tail,integrase	uncultured_Caudovirales_phage(33.33%)	13	1035230:1035269	1050778:1050817
1035230:1035269	attL	ATCAGAATGTCGTGGGTTCGAATCCTACCGCGTGCGTAAA	NA	NA	NA	NA
WP_013655895.1|1035407_1036631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	30.0	3.2e-35
WP_013655896.1|1036633_1037089_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013655897.1|1037246_1037450_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013655898.1|1037490_1037658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655899.1|1037654_1037891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162145065.1|1038034_1038694_+	hypothetical protein	NA	A0A182BQB7	Lactococcus_phage	47.5	3.4e-07
WP_083801215.1|1038617_1039493_+	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	25.5	5.0e-14
WP_013655902.1|1039508_1040324_+	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	39.0	2.7e-14
WP_013655903.1|1040341_1040743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655904.1|1040841_1040982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655905.1|1041438_1041894_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_013655906.1|1041910_1042747_+	hypothetical protein	NA	A0A2H4JBI0	uncultured_Caudovirales_phage	51.4	3.6e-70
WP_013655907.1|1042798_1046425_+|tail	phage tail tape measure protein	tail	A0A0H4TEZ5	Erysipelothrix_phage	48.8	3.1e-65
1050778:1050817	attR	ATCAGAATGTCGTGGGTTCGAATCCTACCGCGTGCGTAAA	NA	NA	NA	NA
>prophage 4
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	1113175	1120474	4714237	portal,protease,terminase	Clostridium_phage(33.33%)	10	NA	NA
WP_013655994.1|1113175_1113817_+	radical SAM protein	NA	S4U737	Listeria_phage	41.5	3.5e-41
WP_013655995.1|1113845_1114073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013655996.1|1114505_1114910_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_013655997.1|1115055_1115475_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013655998.1|1115873_1116173_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	34.0	6.5e-06
WP_013655999.1|1116163_1117402_+|terminase	PBSX family phage terminase large subunit	terminase	I1TJV3	Clostridium_phage	48.1	5.9e-101
WP_013656000.1|1117414_1118749_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	35.3	2.5e-65
WP_041712913.1|1118738_1119527_+	hypothetical protein	NA	U6E9F1	Streptococcus_phage	27.0	1.8e-15
WP_013656002.1|1119516_1119699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656003.1|1119832_1120474_+	DUF4355 domain-containing protein	NA	A0A097BYH4	Leuconostoc_phage	33.0	4.2e-10
>prophage 5
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	1656614	1667971	4714237	integrase	Microbacterium_phage(12.5%)	9	1665781:1665794	1667416:1667429
WP_013656489.1|1656614_1660331_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	23.6	5.6e-30
WP_013656490.1|1660451_1660940_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.1	2.4e-26
WP_013656491.1|1661065_1661770_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	38.9	2.0e-37
WP_013656492.1|1661785_1663183_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	1.1e-60
WP_041713536.1|1663332_1664361_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.2	2.1e-59
WP_013656494.1|1664348_1664930_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.8	1.1e-22
WP_013656495.1|1664933_1666187_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
1665781:1665794	attL	TAGAATTCAATGTA	NA	NA	NA	NA
WP_013656496.1|1666279_1667401_-|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	30.6	1.5e-31
WP_013656497.1|1667401_1667971_-	helix-turn-helix transcriptional regulator	NA	Q38607	Lactococcus_phage	46.0	1.1e-06
1667416:1667429	attR	TAGAATTCAATGTA	NA	NA	NA	NA
>prophage 6
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	1894803	1903922	4714237		Streptococcus_phage(16.67%)	9	NA	NA
WP_013656705.1|1894803_1895658_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.9	2.5e-26
WP_013656706.1|1895854_1896310_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_013656707.1|1896327_1897257_+	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	57.8	2.1e-87
WP_013656708.1|1897546_1898221_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.1	8.3e-49
WP_013656709.1|1898595_1899603_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	45.3	3.4e-62
WP_013656710.1|1899857_1900292_+	DMT family transporter	NA	NA	NA	NA	NA
WP_013656711.1|1900315_1901260_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_013656712.1|1901328_1901808_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	43.8	1.8e-29
WP_013656713.1|1901804_1903922_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	35.3	2.0e-109
>prophage 7
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	2052164	2071538	4714237	portal,integrase,terminase,head,protease	Clostridium_phage(25.0%)	35	2042710:2042725	2067878:2067893
2042710:2042725	attL	GCTTTAAACATAAAAA	NA	NA	NA	NA
WP_013656843.1|2052164_2053262_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.5	4.6e-49
WP_013656844.1|2053387_2053819_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_041712944.1|2053841_2054246_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	43.8	1.2e-23
WP_013656846.1|2054525_2054732_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013656847.1|2054745_2054943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013656848.1|2054983_2055814_+	phage antirepressor KilAC domain-containing protein	NA	A0A141VTQ8	Staphylococcus_phage	43.9	2.1e-49
WP_013656849.1|2055813_2055990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656850.1|2055986_2056229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656851.1|2056271_2057042_+	conserved phage C-terminal domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	57.8	1.2e-32
WP_013656852.1|2057034_2057223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656853.1|2057219_2057639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656854.1|2057632_2057860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656855.1|2057859_2058123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656856.1|2058124_2058361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656857.1|2058347_2058533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656858.1|2058534_2058912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656859.1|2058943_2059492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656860.1|2059524_2059695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656861.1|2059711_2059891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656862.1|2059906_2060122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656863.1|2060438_2061317_+	DNA cytosine methyltransferase	NA	F4YCI6	Synechococcus_phage	46.6	7.0e-64
WP_013656864.1|2061393_2061741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656865.1|2061854_2062136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656866.1|2062319_2062556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656867.1|2062573_2062999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041712945.1|2063053_2063371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013656868.1|2063691_2064657_+|integrase	site-specific integrase	integrase	A0A060AEW6	Staphylococcus_phage	34.8	9.7e-43
WP_013656869.1|2064666_2065113_+	phage transcriptional regulator, RinA family	NA	A0A090EUN5	Clostridium_phage	35.5	8.5e-10
WP_013656870.1|2065454_2066012_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8SBK8	Clostridium_phage	40.8	5.1e-28
WP_013656871.1|2066310_2066805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864050.1|2066749_2067508_+	HNH endonuclease	NA	E9LUN5	Lactobacillus_phage	28.1	1.7e-13
WP_157864120.1|2067631_2067982_+	hypothetical protein	NA	NA	NA	NA	NA
2067878:2067893	attR	GCTTTAAACATAAAAA	NA	NA	NA	NA
WP_013656874.1|2067974_2069693_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	35.6	3.1e-92
WP_157864122.1|2069767_2070946_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	27.0	2.8e-36
WP_013656876.1|2070938_2071538_+|head,protease	HK97 family phage prohead protease	head,protease	Q9AZM3	Lactococcus_phage	41.8	8.5e-21
>prophage 8
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	2498411	2505948	4714237		Stx2-converting_phage(33.33%)	7	NA	NA
WP_013657275.1|2498411_2499560_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	24.3	1.6e-20
WP_013657276.1|2499653_2500268_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	1.8e-18
WP_013657277.1|2500248_2501019_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.0	2.2e-05
WP_013657278.1|2501142_2502333_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.5	6.8e-38
WP_013657279.1|2502425_2503730_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	57.0	8.0e-133
WP_013657280.1|2503753_2504923_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_013657281.1|2505057_2505948_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.8	1.4e-35
>prophage 9
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	2949648	3037442	4714237	tail,plate,portal,integrase,terminase,head,transposase,capsid,coat,tRNA	Clostridium_phage(36.59%)	104	3008955:3008970	3022771:3022786
WP_013657687.1|2949648_2950638_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_013657688.1|2950747_2951530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013657689.1|2951692_2952178_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_083801356.1|2952262_2952355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657690.1|2952499_2953909_-	hypothetical protein	NA	A0A223LDP1	Bacillus_phage	31.9	3.3e-47
WP_013657691.1|2953912_2955043_-	ATP-binding protein	NA	A0A223LDC9	Bacillus_phage	30.3	3.5e-44
WP_013657692.1|2955055_2955859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657693.1|2956179_2959848_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	54.1	1.3e-10
WP_013657694.1|2960048_2960978_-	DMT family transporter	NA	NA	NA	NA	NA
WP_013657695.1|2961117_2961543_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_157864067.1|2961814_2962474_+	MtnX-like HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_013657697.1|2962470_2963538_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013657698.1|2963668_2965324_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_013657699.1|2965402_2965990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657700.1|2966549_2968739_+	carbohydrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083801357.1|2968954_2969905_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_013657702.1|2970903_2971788_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013657703.1|2971926_2972307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657704.1|2972559_2973423_-	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
WP_013657705.1|2973548_2974343_-	EcsC family protein	NA	NA	NA	NA	NA
WP_013657706.1|2974804_2975794_-	choloylglycine hydrolase family protein	NA	A0A1J0F9I3	Only_Syngen_Nebraska_virus	31.2	6.5e-26
WP_013657707.1|2975935_2976400_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	54.0	5.9e-38
WP_013657708.1|2976427_2977624_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.0	1.1e-112
WP_013657709.1|2977642_2978293_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.8	2.9e-22
WP_013657710.1|2978302_2979394_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.7	4.0e-45
WP_013657711.1|2979839_2980706_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013657712.1|2981069_2983175_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_013657713.1|2983247_2983481_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_013657714.1|2983693_2983951_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_013657715.1|2983950_2984211_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_013657717.1|2984672_2984957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657718.1|2985324_2987097_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013657719.1|2987107_2989480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864068.1|2989490_2991227_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013657722.1|2991842_2992538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013656278.1|2993149_2994466_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013657723.1|2994684_2995242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657724.1|2995264_2996158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657725.1|2996327_2997020_-	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	45.3	3.6e-23
WP_013657726.1|2997025_2997316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657727.1|2997309_2997576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657728.1|2997585_2997816_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_083801286.1|2997831_2998302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657730.1|2998231_2998795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657731.1|2998807_3000025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657732.1|3000040_3000544_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_013657733.1|3000536_3001616_-|plate	baseplate J/gp47 family protein	plate	H7BWD5	unidentified_phage	45.6	2.6e-84
WP_013657734.1|3001612_3002017_-	DUF2634 domain-containing protein	NA	A0A0A8WFW6	Clostridium_phage	48.5	9.4e-32
WP_013657735.1|3002006_3002543_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	28.4	2.1e-07
WP_013657736.1|3002535_3003516_-	hypothetical protein	NA	H7BVH4	unidentified_phage	59.2	3.4e-104
WP_013657737.1|3003508_3004201_-	LysM peptidoglycan-binding domain-containing protein	NA	X5J9Z8	Clostridium_phage	44.2	1.9e-40
WP_013657738.1|3004200_3006357_-	tape measure protein	NA	X5JAB7	Clostridium_phage	31.1	5.8e-88
WP_013657739.1|3006550_3006979_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	51.4	2.8e-34
WP_013657740.1|3007025_3007517_-|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	75.5	5.1e-64
WP_013657741.1|3007533_3008844_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A8WIF0	Clostridium_phage	61.9	6.6e-151
WP_013657742.1|3008845_3009040_-	hypothetical protein	NA	NA	NA	NA	NA
3008955:3008970	attL	TATTTCTTTGATTTTA	NA	NA	NA	NA
WP_013657743.1|3009032_3009458_-	hypothetical protein	NA	X5JAB5	Clostridium_phage	46.9	2.7e-29
WP_013657744.1|3009450_3009954_-	HK97 gp10 family phage protein	NA	A0A0A8WFV8	Clostridium_phage	46.1	8.1e-33
WP_013657745.1|3009953_3010337_-	hypothetical protein	NA	A0A0A8WFZ7	Clostridium_phage	53.5	1.2e-25
WP_013657746.1|3010333_3010669_-|head,tail	phage head-tail connector protein	head,tail	A0A0A7RTX9	Clostridium_phage	53.2	2.6e-27
WP_013657747.1|3010711_3011731_-|capsid	major capsid protein	capsid	S5MA55	Brevibacillus_phage	45.0	4.7e-72
WP_013657749.1|3012137_3012764_-	phage scaffolding protein	NA	NA	NA	NA	NA
WP_013657750.1|3012925_3013117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657751.1|3013219_3013396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162145082.1|3013364_3013661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657753.1|3013680_3013863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657754.1|3013846_3015220_-|capsid	minor capsid protein	capsid	A0A0A8WIE7	Clostridium_phage	51.5	2.8e-120
WP_041713792.1|3015209_3016646_-|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	46.6	3.5e-113
WP_013657756.1|3016658_3017963_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J4X1	uncultured_Caudovirales_phage	64.4	8.2e-162
WP_013657757.1|3017950_3018808_-|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	49.3	1.1e-69
WP_013657758.1|3018971_3019376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657759.1|3019602_3020565_-|integrase	site-specific integrase	integrase	W5RV39	Staphylococcus_phage	35.5	6.5e-47
WP_013655844.1|3020635_3021022_-	hypothetical protein	NA	A0A0H3UZ02	Geobacillus_virus	37.6	4.8e-09
WP_157864036.1|3021071_3021233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657760.1|3021263_3021437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657761.1|3021457_3021712_-	sporulation transcriptional regulator SpoIIID	NA	NA	NA	NA	NA
WP_013657763.1|3022340_3022664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657764.1|3022762_3022936_+	hypothetical protein	NA	NA	NA	NA	NA
3022771:3022786	attR	TAAAATCAAAGAAATA	NA	NA	NA	NA
WP_013656444.1|3022984_3023185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864044.1|3023196_3023445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013656442.1|3023472_3023613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657765.1|3023648_3023972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657766.1|3024004_3024619_-	DNA cytosine methyltransferase	NA	A0A1Z1LWY8	Mycobacterium_phage	29.9	3.0e-13
WP_013656861.1|3024696_3024876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013656860.1|3024892_3025063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657767.1|3025199_3025643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013655835.1|3025676_3025847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657768.1|3025911_3026337_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0A8WJX1	Clostridium_phage	39.0	2.4e-22
WP_162145064.1|3026338_3027160_-	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	38.8	2.9e-40
WP_013655832.1|3027065_3027884_-	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	52.8	2.7e-30
WP_050794665.1|3027930_3028743_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RVR3	Clostridium_phage	50.6	1.7e-69
WP_013655830.1|3028729_3029524_-	recombinase RecT	NA	H7BUU1	unidentified_phage	52.1	8.0e-59
WP_013657769.1|3029526_3031149_-	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	39.5	3.7e-103
WP_013657771.1|3031329_3031617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657773.1|3031795_3032017_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013657775.1|3032239_3032449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013657776.1|3032417_3032591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657777.1|3032594_3033428_-	phage antirepressor Ant	NA	A0A1W6JNL5	Staphylococcus_phage	40.1	6.0e-33
WP_013657778.1|3033490_3033667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013657779.1|3033726_3034476_-	ORF6C domain-containing protein	NA	A0A2R2ZGW3	Clostridioides_phage	42.9	2.4e-41
WP_013657780.1|3034498_3034708_-	DUF739 family protein	NA	NA	NA	NA	NA
WP_013657781.1|3034876_3035356_+	helix-turn-helix transcriptional regulator	NA	A0A2K9V426	Faecalibacterium_phage	43.4	6.1e-14
WP_013657782.1|3035367_3035841_+	hypothetical protein	NA	A0A0A7RTX7	Clostridium_phage	46.2	1.3e-24
WP_013657783.1|3035873_3037442_+	recombinase family protein	NA	R9W007	Paenibacillus_phage	53.2	4.8e-156
>prophage 10
NC_015275	Cellulosilyticum lentocellum DSM 5427, complete sequence	4714237	4169476	4176564	4714237		Streptomyces_phage(16.67%)	7	NA	NA
WP_013658764.1|4169476_4171231_-	FkbM family methyltransferase	NA	A0A222Z098	Streptomyces_phage	25.0	1.7e-08
WP_013658765.1|4171257_4172007_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	2.9e-10
WP_013658766.1|4172024_4172819_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013658767.1|4172836_4173943_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	30.0	9.1e-37
WP_013658768.1|4173945_4174599_-	acetyltransferase	NA	A0A0U2LUG6	Niemeyer_virus	32.4	8.4e-06
WP_013658769.1|4174588_4175518_-	GDP-mannose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	29.9	5.0e-28
WP_013658770.1|4175532_4176564_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	61.9	7.8e-115
