The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014829	Bacillus cellulosilyticus DSM 2522, complete genome	4681672	448926	457214	4681672		Synechococcus_phage(50.0%)	8	NA	NA
WP_013487038.1|448926_450222_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.0	3.2e-17
WP_013487039.1|450335_451049_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	44.9	4.3e-48
WP_013487040.1|451048_451303_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_013487041.1|451299_451983_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013487042.1|451966_454189_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.2	5.3e-169
WP_013487043.1|454173_455586_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	6.6e-48
WP_013487044.1|455601_456639_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	39.5	3.8e-61
WP_041808106.1|456632_457214_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	5.9e-27
>prophage 2
NC_014829	Bacillus cellulosilyticus DSM 2522, complete genome	4681672	1991506	2000610	4681672		Staphylococcus_phage(50.0%)	10	NA	NA
WP_013488402.1|1991506_1992595_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	39.3	2.5e-63
WP_013488403.1|1992595_1993243_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	48.2	1.9e-42
WP_041808789.1|1993269_1994463_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.0	1.1e-117
WP_041808193.1|1994483_1994951_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	1.5e-44
WP_013488213.1|1995637_1996963_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.4	4.7e-40
WP_013488406.1|1997038_1997545_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_013488407.1|1997704_1998469_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.4	5.9e-11
WP_013488408.1|1998449_1999049_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.9	1.0e-13
WP_013488409.1|1999081_1999579_+	DUF3907 family protein	NA	NA	NA	NA	NA
WP_157184187.1|1999677_2000610_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.6	8.2e-39
>prophage 3
NC_014829	Bacillus cellulosilyticus DSM 2522, complete genome	4681672	2264279	2325666	4681672	holin,portal,integrase,head,terminase,tRNA,protease,capsid,tail	Paenibacillus_phage(22.22%)	73	2280199:2280258	2317081:2317164
WP_157184293.1|2264279_2264519_+|holin	holin	holin	A0A2H4JAH4	uncultured_Caudovirales_phage	36.4	2.8e-07
WP_013488660.1|2264835_2265984_+	FIST C domain	NA	NA	NA	NA	NA
WP_013488661.1|2266000_2267008_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_013488662.1|2267307_2267634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488663.1|2267754_2268936_-	DUF4317 domain-containing protein	NA	NA	NA	NA	NA
WP_013488664.1|2269282_2269933_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013488665.1|2270148_2271402_+	acyltransferase	NA	NA	NA	NA	NA
WP_041808846.1|2271552_2272530_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_013488667.1|2272811_2273237_+	cyclase/dehydrase	NA	NA	NA	NA	NA
WP_013488668.1|2273275_2275492_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_013488669.1|2275662_2276181_+	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	49.5	1.7e-22
WP_013488670.1|2276509_2277403_+	cation transporter	NA	NA	NA	NA	NA
WP_013488671.1|2277591_2278968_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_041808850.1|2279438_2279906_+	hypothetical protein	NA	NA	NA	NA	NA
2280199:2280258	attL	TTGTTTGGCGGGACCGTGTGGGAATCGAACCCACCGAGCTTGGCACGCAAGCCCCTGAAG	NA	NA	NA	NA
WP_013488673.1|2280507_2280654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488674.1|2281130_2281946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488675.1|2281960_2282146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488676.1|2282434_2283952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488677.1|2284060_2285170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157184189.1|2285336_2285498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013488678.1|2285710_2286304_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013488679.1|2286303_2286588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488680.1|2286866_2287589_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013488681.1|2287870_2288113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488682.1|2288252_2288495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488683.1|2288583_2289096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488684.1|2289151_2289307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488685.1|2289319_2289709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488687.1|2289865_2290132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488689.1|2290231_2290390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488691.1|2290925_2291393_+|terminase	phage terminase small subunit P27 family	terminase	A0A288WG26	Bacillus_phage	73.2	2.0e-54
WP_041808855.1|2291395_2293117_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	54.7	7.5e-179
WP_041808216.1|2293133_2294399_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	53.0	7.6e-120
WP_013488694.1|2294373_2295105_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	53.5	2.4e-62
WP_013488695.1|2295154_2296333_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	34.3	9.4e-48
WP_013488696.1|2296352_2296622_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	45.5	5.5e-12
WP_013488697.1|2296614_2296935_+|head	phage head closure protein	head	A0A2I7SCU2	Paenibacillus_phage	46.7	8.5e-20
WP_157184190.1|2296939_2297374_+	hypothetical protein	NA	A0A0C5AJ13	Paenibacillus_phage	56.1	1.7e-34
WP_013488699.1|2297357_2297756_+	DUF3168 domain-containing protein	NA	A0A2I7SC71	Paenibacillus_phage	46.2	1.1e-21
WP_013488700.1|2297762_2298191_+|tail	phage major tail protein, TP901-1 family	tail	A0A0C5AMZ4	Paenibacillus_phage	41.8	1.3e-20
WP_013488701.1|2298220_2298553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157184191.1|2298642_2298837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157184294.1|2298894_2299005_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013488703.1|2299058_2301290_+|tail	phage tail tape measure protein	tail	A0A0K2CYF4	Paenibacillus_phage	36.2	9.7e-70
WP_013488704.1|2301286_2302054_+|tail	phage tail family protein	tail	W8EK66	Geobacillus_phage	41.6	5.4e-20
WP_013488705.1|2302068_2302212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488706.1|2302212_2302530_+	hypothetical protein	NA	A0A0U4JWX9	Bacillus_phage	30.8	4.8e-07
WP_013488707.1|2302529_2303060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488708.1|2303060_2303984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488709.1|2304520_2304727_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013488710.1|2304841_2305684_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	23.7	2.9e-11
WP_081457279.1|2305730_2308883_+	hypothetical protein	NA	I3NL88	Bifidobacterium_phage	32.2	1.5e-47
WP_013488712.1|2308898_2309066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488713.1|2309106_2309307_+	UviB protein	NA	J9PTZ1	Bacillus_phage	42.2	1.7e-05
WP_013488714.1|2309321_2310002_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	59.7	4.0e-67
WP_013488715.1|2310009_2310255_+|holin	holin	holin	A0A2H4JAH4	uncultured_Caudovirales_phage	50.0	7.0e-14
WP_013488716.1|2310388_2310862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049786700.1|2311094_2311400_-	YolD-like family protein	NA	O64030	Bacillus_phage	41.8	2.1e-12
WP_013488718.1|2311759_2311897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488719.1|2312184_2312418_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013488720.1|2312558_2312837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488721.1|2312839_2314039_+	cell division protein FtsK	NA	B3RH36	Bacillus_virus	43.7	1.2e-90
WP_157184295.1|2314073_2314544_+	hypothetical protein	NA	A6XML4	Bacillus_virus	44.1	1.5e-17
WP_013488723.1|2314694_2314925_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	41.4	4.1e-08
WP_013488724.1|2315132_2315417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488725.1|2315413_2315674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488726.1|2315670_2315922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013488727.1|2315935_2316910_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.6	1.1e-20
WP_013488728.1|2317372_2318143_+	exonuclease domain-containing protein	NA	G3MBN3	Bacillus_virus	26.2	6.6e-10
2317081:2317164	attR	TTGTTTGGCGGGACCGTGTGGGAATCGAACCCACCGAGCTTGGCACGCAAGCCCCTGAAGGTTTTGAAGACCTCGGCAAACACC	NA	NA	NA	NA
WP_013488729.1|2318334_2320224_+	selenocysteine-specific translation elongation factor	NA	A0A2K9L516	Tupanvirus	28.6	4.0e-16
WP_013488730.1|2320361_2321381_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_081457380.1|2321414_2322434_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_013488733.1|2324253_2325666_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
>prophage 4
NC_014829	Bacillus cellulosilyticus DSM 2522, complete genome	4681672	2917805	2926505	4681672	capsid,head,tail	Bacillus_phage(66.67%)	11	NA	NA
WP_013489308.1|2917805_2918630_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	43.3	1.5e-52
WP_013489309.1|2918626_2921932_-|tail	phage tail tape measure protein	tail	A0A0U4II47	Bacillus_phage	37.3	1.8e-48
WP_013489310.1|2921944_2922094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013489311.1|2922147_2922531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013489312.1|2922589_2923159_-|tail	phage major tail protein, phi13 family	tail	A0A0S2SXT6	Bacillus_phage	33.3	1.7e-26
WP_013489313.1|2923162_2923486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013489314.1|2923482_2923902_-	phage protein, HK97 gp10 family	NA	NA	NA	NA	NA
WP_013489315.1|2923902_2924232_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_013489316.1|2924212_2924557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013489317.1|2924571_2925081_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013489318.1|2925140_2926505_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
>prophage 5
NC_014829	Bacillus cellulosilyticus DSM 2522, complete genome	4681672	3272091	3337653	4681672	coat,tRNA,protease,transposase,integrase	Streptococcus_phage(22.22%)	55	3261074:3261089	3275282:3275297
3261074:3261089	attL	AAATTATAAAAGTTTG	NA	NA	NA	NA
WP_013489657.1|3272091_3274248_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013489658.1|3274244_3275084_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_013489659.1|3276003_3276621_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
3275282:3275297	attR	AAATTATAAAAGTTTG	NA	NA	NA	NA
WP_013489660.1|3276771_3278193_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_013489661.1|3278415_3280821_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	65.3	3.9e-250
WP_013489662.1|3280813_3281182_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.9	1.5e-49
WP_013489663.1|3281619_3283260_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	7.7e-48
WP_013489664.1|3283281_3283680_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_013489665.1|3284089_3284665_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_013489666.1|3284728_3285304_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_041809107.1|3285429_3286848_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_013489668.1|3287110_3288205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013489669.1|3288905_3289469_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_013489670.1|3289860_3290550_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_013489671.1|3290546_3291140_-	fimbrial assembly family protein	NA	NA	NA	NA	NA
WP_013489672.1|3291143_3292115_-	Tfp pilus assembly protein, ATPase PilM	NA	NA	NA	NA	NA
WP_013489673.1|3292132_3292885_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013489674.1|3292923_3293346_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_013489675.1|3293604_3294810_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_013489676.1|3294815_3295850_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_013489677.1|3295860_3297522_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_013489678.1|3297820_3298249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013489679.1|3298259_3298733_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_013489680.1|3298729_3300184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013489681.1|3300345_3302040_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.6	9.4e-17
WP_013489682.1|3302346_3303627_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013489683.1|3303774_3304689_+	RimK family alpha-L-glutamate ligase	NA	A0A127KMC2	Cyanophage	32.3	2.1e-26
WP_013489684.1|3304690_3305548_+	RimK domain-containing protein ATP-grasp	NA	NA	NA	NA	NA
WP_013489685.1|3305761_3306394_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013489686.1|3306395_3307436_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013489687.1|3307432_3308164_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_013489688.1|3308317_3308608_-	permease	NA	NA	NA	NA	NA
WP_013489689.1|3308876_3309269_+	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_013489690.1|3309756_3310596_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_013489691.1|3311185_3312244_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_013489692.1|3312513_3315156_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	3.1e-160
WP_013489693.1|3315722_3315929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013489694.1|3316093_3317110_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013489695.1|3317106_3318027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013489696.1|3318042_3319281_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_013489697.1|3319537_3320494_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_081457318.1|3320738_3321959_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_013489699.1|3322117_3323401_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013489700.1|3323427_3324405_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013489701.1|3324423_3325197_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013489702.1|3325213_3326146_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_013489703.1|3326232_3327051_-	cytochrome c	NA	NA	NA	NA	NA
WP_013489704.1|3327066_3328455_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013489705.1|3328748_3329237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013489706.1|3329323_3329917_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013489707.1|3329918_3332237_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.4	2.9e-186
WP_013489708.1|3332664_3334344_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	31.4	6.3e-05
WP_013489709.1|3334888_3335287_-	glyoxalase	NA	NA	NA	NA	NA
WP_013489710.1|3335270_3336068_-	phosphosulfolactate synthase	NA	NA	NA	NA	NA
WP_013489711.1|3336381_3337653_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.0	1.3e-148
