The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021591	Serratia plymuthica 4Rx13, complete genome	5328010	3780210	3789977	5328010		Planktothrix_phage(33.33%)	8	NA	NA
WP_004947683.1|3780210_3781938_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	26.8	2.1e-19
WP_004947686.1|3781987_3782497_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004947689.1|3782591_3783908_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	2.1e-19
WP_004947692.1|3783913_3784594_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004947695.1|3784769_3785966_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	74.6	4.4e-37
WP_110605869.1|3785984_3787919_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	42.0	2.0e-39
WP_004947698.1|3787922_3788804_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.1	2.5e-53
WP_004947703.1|3788888_3789977_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.7	9.3e-34
>prophage 2
NC_021591	Serratia plymuthica 4Rx13, complete genome	5328010	4003766	4118363	5328010	protease,capsid,integrase,portal,head,terminase,tRNA,tail	Enterobacteria_phage(20.0%)	107	4060600:4060624	4104861:4104885
WP_004952075.1|4003766_4004963_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004952077.1|4005242_4005668_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	38.8	1.6e-13
WP_004952082.1|4008237_4013229_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_004952083.1|4013498_4014329_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_086012891.1|4014418_4015699_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	32.1	1.5e-35
WP_004952086.1|4016029_4016365_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004952087.1|4016367_4018218_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	1.9e-103
WP_004952088.1|4018244_4018766_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004952089.1|4018829_4019153_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.4	1.0e-20
WP_004952090.1|4019278_4019665_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	8.3e-54
WP_004952093.1|4019689_4020904_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	1.2e-34
WP_004952096.1|4020958_4021453_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_004952097.1|4021647_4022382_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_004952100.1|4022501_4023305_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_004952103.1|4023373_4024396_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_004952104.1|4024386_4025055_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_004952106.1|4025200_4026466_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_004952108.1|4026462_4027614_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_004952110.1|4027769_4029023_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.0	8.6e-100
WP_004952111.1|4029397_4030588_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_004952113.1|4030629_4031817_-	cytochrome c	NA	NA	NA	NA	NA
WP_004952114.1|4031813_4033724_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004952117.1|4033810_4035235_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006327351.1|4035270_4036077_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004952120.1|4036066_4037011_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004952122.1|4037012_4038041_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	6.3e-24
WP_004952123.1|4038095_4039250_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004952126.1|4039324_4040788_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004952128.1|4040903_4041827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004847623.1|4042150_4042489_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004952129.1|4042502_4044125_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.8	1.3e-92
WP_004952130.1|4044254_4045592_-	two-component system response regulator GlrR	NA	NA	NA	NA	NA
WP_004952131.1|4045588_4046461_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004952132.1|4046464_4047916_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.0	1.4e-13
WP_004952133.1|4047997_4048306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041417109.1|4048842_4052733_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.0e-127
WP_020439617.1|4053011_4054472_+	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	37.2	1.6e-09
WP_004952136.1|4054472_4054979_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	6.5e-06
WP_004952139.1|4055162_4056215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004952141.1|4056298_4056955_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_004952142.1|4056958_4058326_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004952145.1|4058345_4059239_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004952146.1|4059673_4060522_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
4060600:4060624	attL	TGCATCAACTGCGATATGTGCGAGC	NA	NA	NA	NA
WP_041417111.1|4060818_4061061_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	81.0	2.2e-28
WP_041417113.1|4061060_4061303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020453927.1|4061330_4062101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004952150.1|4064424_4067808_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	52.4	2.3e-309
WP_020453928.1|4067926_4068496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020453929.1|4068499_4069108_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.2	9.4e-60
WP_071824740.1|4069147_4069573_-	hypothetical protein	NA	J9Q806	Salmonella_phage	46.4	4.4e-24
WP_041417373.1|4069616_4070318_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	56.3	4.4e-77
WP_020453931.1|4070320_4071070_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	57.8	2.6e-83
WP_041417115.1|4071078_4071414_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	36.6	7.1e-17
WP_041417117.1|4071410_4074746_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	56.9	0.0e+00
WP_004952156.1|4074977_4075343_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	43.6	1.8e-21
WP_080653249.1|4075352_4075616_-	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	58.1	6.5e-18
WP_004952158.1|4075612_4076068_-	hypothetical protein	NA	Q7Y403	Yersinia_phage	73.5	6.1e-56
WP_004952159.1|4076102_4076495_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	67.7	2.5e-42
WP_004952161.1|4076491_4076881_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	52.7	6.9e-32
WP_041417121.1|4076867_4077206_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	50.9	2.0e-19
WP_041417123.1|4077202_4077529_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	54.6	4.9e-31
WP_071824741.1|4077544_4077814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004953488.1|4077969_4079190_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	79.8	4.1e-179
WP_004953490.1|4079202_4080057_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	79.6	4.8e-126
WP_004953495.1|4080069_4081374_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	79.5	7.4e-203
WP_020453933.1|4081373_4083119_-|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	43.9	1.0e-138
WP_004953501.1|4083069_4083537_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	2.0e-49
WP_004953504.1|4083716_4084046_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	63.1	2.5e-35
WP_147150524.1|4084163_4084688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041417125.1|4084835_4085033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147150525.1|4085053_4085266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004953511.1|4085262_4085793_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.1	9.1e-27
WP_004953513.1|4085792_4086269_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	61.0	1.9e-52
WP_016928147.1|4086273_4086501_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	54.0	7.6e-07
WP_004953515.1|4086575_4087604_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	63.6	3.7e-125
WP_004953525.1|4088288_4088864_-	SocA family protein	NA	NA	NA	NA	NA
WP_004953527.1|4089214_4089886_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	42.3	3.7e-41
WP_004953531.1|4089882_4090461_-	endonuclease	NA	A0A1P8DTE0	Proteus_phage	66.4	2.2e-42
WP_004953535.1|4090444_4091431_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.7	2.7e-109
WP_041417376.1|4091427_4092951_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	64.6	9.8e-199
WP_004953550.1|4093445_4093955_-	hypothetical protein	NA	S5FXP0	Shigella_phage	51.6	4.3e-42
WP_004953553.1|4094031_4094226_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	80.6	1.4e-20
WP_041417377.1|4094334_4095045_+	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	65.4	2.0e-85
WP_020453938.1|4096464_4096947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004953563.1|4097433_4097796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004953567.1|4098738_4100037_+	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	59.0	2.1e-85
WP_041417131.1|4100260_4100623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020453940.1|4100702_4101131_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_041417133.1|4101196_4101766_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	62.1	6.9e-65
WP_071824743.1|4101781_4101997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004953570.1|4102128_4103061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004953573.1|4103223_4104621_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004953576.1|4104836_4105097_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	5.5e-17
4104861:4104885	attR	TGCATCAACTGCGATATGTGCGAGC	NA	NA	NA	NA
WP_004953578.1|4105160_4105541_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004953580.1|4105540_4106272_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004953582.1|4106344_4107076_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004953584.1|4107084_4107993_-	GTPase Era	NA	NA	NA	NA	NA
WP_004953587.1|4107989_4108670_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	30.8	3.7e-20
WP_004953588.1|4108852_4109830_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004953591.1|4109862_4111662_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	7.2e-23
WP_004953595.1|4112202_4113042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004953599.1|4113038_4113515_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_004953603.1|4113511_4114471_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004953606.1|4114470_4115124_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004929136.1|4115154_4115730_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_004953609.1|4115908_4117546_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_020453942.1|4117580_4118363_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
