The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	126289	132814	3000464	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|126289_126742_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|126747_127083_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721741.1|127299_127728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721742.1|127739_128156_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003733902.1|128433_128823_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|128835_129348_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|129395_129698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020246385.1|129739_130144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721747.1|130130_131999_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.3	1.7e-19
WP_003721748.1|131995_132814_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	4.2e-39
>prophage 2
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	1145120	1154078	3000464		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1145120_1145504_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003721507.1|1145525_1146509_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.3	3.1e-12
WP_003721508.1|1146523_1147537_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	6.0e-11
WP_003721509.1|1147745_1149236_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003721510.1|1149247_1150072_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	2.2e-67
WP_003721511.1|1150084_1150393_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003721512.1|1150452_1150857_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014601274.1|1150985_1152542_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.9e-17
WP_003721514.1|1152674_1154078_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	26.0	9.2e-18
>prophage 3
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	1285961	1345505	3000464	tRNA,protease	Bacillus_virus(16.67%)	58	NA	NA
WP_003723562.1|1285961_1287101_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1287181_1287577_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1287727_1287943_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003732794.1|1288061_1288595_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1288612_1289278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1289539_1290478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1290592_1291876_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1292061_1293321_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1293439_1294006_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1294040_1294610_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1294711_1295254_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1295263_1296127_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1296123_1296909_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1297042_1297903_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003732799.1|1298173_1300252_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_003723999.1|1300314_1301619_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003724000.1|1301901_1302804_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1302824_1303364_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1303377_1304787_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
WP_003726695.1|1304807_1305587_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003724129.1|1305689_1306109_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1306130_1306442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724131.1|1306444_1307317_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724132.1|1307358_1307955_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003732802.1|1308112_1308520_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003723731.1|1308700_1310668_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_003723732.1|1310664_1313124_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	1.1e-101
WP_003723733.1|1313206_1313674_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003723734.1|1314003_1315833_+	lmo1289 family class 1 internalin	NA	NA	NA	NA	NA
WP_003723735.1|1316164_1317967_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003723736.1|1318000_1319869_-	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_003723737.1|1320081_1320780_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	1.3e-12
WP_003723738.1|1321012_1322689_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003723739.1|1322814_1323732_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1323854_1324088_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003733804.1|1324198_1325422_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003723434.1|1325414_1326641_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1326844_1327213_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1327283_1328618_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003723436.1|1328761_1330057_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	61.6	1.8e-145
WP_003723437.1|1330100_1330622_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723438.1|1330651_1331266_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003723439.1|1331422_1331752_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723440.1|1331843_1332071_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003723441.1|1332217_1334212_+	transketolase	NA	NA	NA	NA	NA
WP_003723442.1|1334432_1334672_+	YneF family protein	NA	NA	NA	NA	NA
WP_003723443.1|1334722_1335565_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723444.1|1335583_1336315_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	59.1	1.2e-80
WP_003723445.1|1336336_1336843_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723446.1|1336852_1338157_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_072217143.1|1338146_1339352_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	3.7e-92
WP_003723448.1|1339329_1339704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1339996_1340725_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1340724_1341282_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723451.1|1341511_1342270_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.4	1.1e-22
WP_003723452.1|1342283_1343072_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003723453.1|1343086_1344229_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003723454.1|1344242_1345505_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	1836780	1845066	3000464		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1836780_1837347_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_003722244.1|1837343_1838393_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_003722245.1|1838411_1839839_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003722246.1|1839823_1842043_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	2.6e-160
WP_003722247.1|1842035_1842719_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1842722_1842968_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003722249.1|1842979_1843693_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.7	2.7e-42
WP_003722250.1|1843773_1845066_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	7.2e-17
>prophage 5
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	2359420	2402352	3000464	terminase,portal,plate,tail,holin,capsid	Listeria_phage(89.06%)	68	NA	NA
WP_003727807.1|2359420_2359654_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	1.8e-35
WP_009924649.1|2359953_2360187_+	hypothetical protein	NA	A8ATW9	Listeria_phage	48.1	9.2e-08
WP_003722517.1|2360215_2360587_+	anti-CRISPR protein AcrIIA2	NA	A0A059T5F6	Listeria_phage	92.7	5.3e-58
WP_003722518.1|2360592_2361042_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003722519.1|2361066_2361564_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	95.8	2.3e-88
WP_003722520.1|2361838_2362612_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_003734112.1|2362652_2363498_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	89.4	2.0e-137
WP_003722522.1|2363497_2363779_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2363791_2364157_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003734113.1|2364185_2364344_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	98.1	3.0e-18
WP_003727798.1|2364348_2364666_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.3e-49
WP_003734114.1|2364677_2365751_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	96.6	2.8e-192
WP_003734115.1|2365750_2366779_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	99.1	5.6e-190
WP_003722528.1|2366779_2367805_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	98.2	4.3e-198
WP_003727794.1|2367813_2368632_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.0	6.1e-147
WP_003734116.1|2368633_2373997_-	tape measure protein	NA	A8ASK6	Listeria_phage	93.1	0.0e+00
WP_003722531.1|2374007_2374613_-	bacteriophage Gp15 family protein	NA	Q9T1A8	Listeria_phage	100.0	1.3e-109
WP_003722532.1|2374617_2375040_-|tail	phage tail assembly chaperone	tail	A8ASK4	Listeria_phage	99.3	9.1e-70
WP_003733875.1|2375091_2375424_-	Ig domain-containing protein	NA	A0A059T5E4	Listeria_phage	95.9	1.7e-39
WP_003734117.1|2375353_2375788_-	hypothetical protein	NA	Q9T1B1	Listeria_phage	97.2	1.5e-75
WP_003727788.1|2375790_2376198_-	hypothetical protein	NA	Q9T1B2	Listeria_phage	98.5	9.0e-67
WP_003727787.1|2376197_2376536_-|capsid	minor capsid protein	capsid	Q9T1B3	Listeria_phage	100.0	2.2e-58
WP_003727786.1|2376535_2376898_-	hypothetical protein	NA	A0A0B5D151	Listeria_phage	95.8	8.6e-61
WP_003727785.1|2376897_2377293_-	hypothetical protein	NA	A0A059T5E3	Listeria_phage	97.7	3.7e-65
WP_003734118.1|2377311_2378313_-	hypothetical protein	NA	A0A059T6D4	Listeria_phage	97.9	5.0e-183
WP_003727783.1|2378312_2378903_-	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	89.8	2.6e-75
WP_003734119.1|2378993_2380121_-|capsid	phage minor capsid protein	capsid	A0A059T7W2	Listeria_phage	95.7	4.3e-199
WP_003734120.1|2380121_2381882_-|portal	phage portal protein	portal	A0A0B5D0F2	Listeria_phage	94.0	1.0e-268
WP_003734121.1|2381894_2383205_-|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	65.6	6.5e-167
WP_003722545.1|2383197_2383953_-|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	46.1	2.4e-44
WP_003734122.1|2383998_2384538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003734123.1|2384797_2385232_-	hypothetical protein	NA	A8AU03	Listeria_phage	95.1	9.0e-73
WP_003734124.1|2385250_2385415_-	hypothetical protein	NA	A8ASQ0	Listeria_phage	96.3	6.7e-21
WP_003734126.1|2385544_2385949_-	hypothetical protein	NA	A8AU00	Listeria_phage	98.5	1.7e-70
WP_014601286.1|2385914_2386055_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_014601287.1|2386051_2386357_-	hypothetical protein	NA	A8ATZ8	Listeria_phage	98.0	1.5e-45
WP_014931702.1|2386384_2386762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601288.1|2386783_2387266_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	93.1	2.7e-78
WP_003733878.1|2387262_2387442_-	hypothetical protein	NA	A0A076G7F4	Listeria_phage	87.3	8.1e-20
WP_003722556.1|2387438_2387909_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	89.7	2.9e-40
WP_003722557.1|2387905_2388349_-	hypothetical protein	NA	A8ASP1	Listeria_phage	87.1	2.1e-45
WP_003722558.1|2388345_2388543_-	hypothetical protein	NA	A0A0B5CU49	Listeria_phage	95.4	2.0e-27
WP_003734130.1|2388545_2389142_-	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	52.5	5.8e-54
WP_014601289.1|2389153_2390116_-	DNA cytosine methyltransferase	NA	H7BVD3	unidentified_phage	38.7	4.5e-48
WP_003734132.1|2390133_2390388_-	hypothetical protein	NA	Q8W5X5	Listeria_phage	97.6	2.7e-37
WP_003734133.1|2390384_2391314_-	hypothetical protein	NA	I1W658	Staphylococcus_phage	40.5	8.8e-17
WP_003727756.1|2391334_2392144_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A290GJV0	Caldibacillus_phage	54.3	2.1e-78
WP_003727755.1|2392097_2392979_-	hypothetical protein	NA	A0A2P1JTZ5	Anoxybacillus_phage	59.0	1.2e-87
WP_003727754.1|2392975_2393179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727753.1|2393396_2393585_-	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	98.4	1.0e-28
WP_003727752.1|2393693_2393909_-	hypothetical protein	NA	Q9T176	Listeria_phage	90.1	1.8e-26
WP_003727751.1|2393905_2394439_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	93.1	1.1e-83
WP_003727750.1|2394559_2395339_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	98.5	1.1e-142
WP_003727749.1|2395402_2395645_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	100.0	1.8e-38
WP_003727748.1|2395637_2395799_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003727747.1|2395830_2396112_-	hypothetical protein	NA	A0A0B5CTX3	Listeria_phage	100.0	1.0e-40
WP_003727746.1|2396137_2396422_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	2.9e-40
WP_003727745.1|2396433_2396628_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	96.9	6.3e-26
WP_003727743.1|2396852_2397119_-	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_003727742.1|2397122_2397365_-	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	100.0	1.7e-36
WP_003727741.1|2397490_2397796_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	100.0	6.4e-49
WP_003727740.1|2397828_2398320_+	hypothetical protein	NA	A0A059T5E8	Listeria_phage	100.0	3.4e-92
WP_003727739.1|2398342_2398561_+	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	100.0	5.4e-34
WP_003727738.1|2398576_2399299_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	100.0	1.3e-105
WP_003727737.1|2399320_2400061_+	hypothetical protein	NA	Q9T192	Listeria_phage	100.0	4.5e-133
WP_003727736.1|2400124_2401483_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.7	3.0e-255
WP_003733969.1|2401473_2401950_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2402004_2402352_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 6
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	2555805	2563649	3000464		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2555805_2556777_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2556784_2557753_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2557754_2558630_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003722607.1|2558737_2560468_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.2	7.8e-176
WP_003734087.1|2560509_2561571_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003722609.1|2561587_2562571_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.9	2.2e-50
WP_003722610.1|2562689_2563649_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NC_017545	Listeria monocytogenes J0161, complete sequence	3000464	2650110	2721202	3000464	terminase,tRNA,protease,integrase,tail,holin	Listeria_phage(87.5%)	90	2681942:2681991	2721290:2721339
WP_003723609.1|2650110_2651781_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|2651777_2652227_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003723611.1|2652304_2652958_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003723612.1|2653031_2653217_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003723613.1|2653251_2654574_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
WP_003723614.1|2654588_2655425_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003723615.1|2655742_2655943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723616.1|2655964_2656288_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003734106.1|2656442_2658104_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003723619.1|2658239_2658854_-	SdpI family protein	NA	NA	NA	NA	NA
WP_003723620.1|2658877_2659510_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003723621.1|2659510_2660035_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_003733266.1|2660037_2661036_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003723623.1|2661132_2661405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723624.1|2661453_2662365_-	cation transporter	NA	NA	NA	NA	NA
WP_003723275.1|2662490_2667083_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003733264.1|2667303_2668131_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003733263.1|2668245_2669121_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723278.1|2669131_2669425_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003723279.1|2669457_2669619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723280.1|2669687_2670356_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	5.0e-38
WP_003723281.1|2670355_2671444_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003723282.1|2671522_2672902_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	47.1	2.6e-57
WP_003723283.1|2672898_2673576_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.4	2.6e-58
WP_003723284.1|2673622_2674408_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003723285.1|2674469_2674946_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003723286.1|2674945_2677933_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003723287.1|2678430_2679273_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_003723288.1|2679322_2680804_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003723289.1|2680904_2681792_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2681942:2681991	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_003723290.1|2682415_2682679_+	anti-CRISPR protein AcrIIA4	NA	A0A2D0TCG7	unidentified_phage	100.0	1.9e-41
WP_003723291.1|2682683_2683133_+	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	94.6	1.3e-71
WP_003723292.1|2683206_2683806_-	N-acetyltransferase	NA	Q9T197	Listeria_phage	100.0	1.0e-111
WP_003733956.1|2683792_2683969_-	hypothetical protein	NA	Q9T198	Listeria_phage	100.0	6.3e-25
WP_003723293.1|2684207_2684915_-	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	98.7	2.0e-130
WP_003723294.1|2684914_2685196_-|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
WP_003733957.1|2685195_2685501_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_003723296.1|2685551_2687714_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	99.7	0.0e+00
WP_003734108.1|2687726_2689295_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.6	3.1e-304
WP_003733958.1|2689291_2694082_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	88.2	0.0e+00
WP_003723779.1|2694086_2694362_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	95.6	5.7e-41
WP_003723780.1|2694394_2694826_-	hypothetical protein	NA	A8ATV7	Listeria_phage	94.4	9.3e-70
WP_031670280.1|2694874_2695114_-	Ig-like domain-containing protein	NA	A8ASK3	Listeria_phage	89.9	1.8e-30
WP_003723782.1|2695136_2695568_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	82.9	8.1e-58
WP_003723783.1|2695539_2695944_-	hypothetical protein	NA	A8ATV5	Listeria_phage	98.4	2.1e-63
WP_003723784.1|2695940_2696258_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	95.2	1.7e-49
WP_003733959.1|2696247_2696613_-	hypothetical protein	NA	A8ATV3	Listeria_phage	95.9	1.6e-62
WP_003723785.1|2696612_2696966_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003723786.1|2696966_2697122_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003723787.1|2697135_2698008_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	93.8	2.3e-152
WP_003723788.1|2698030_2698585_-	hypothetical protein	NA	A8ATU9	Listeria_phage	98.9	8.8e-89
WP_003723789.1|2698680_2699724_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	97.1	9.1e-196
WP_003723790.1|2699728_2701285_-	hypothetical protein	NA	A8ATU7	Listeria_phage	98.8	4.5e-300
WP_003733960.1|2701299_2702619_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	88.3	1.5e-232
WP_003723792.1|2702557_2703343_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	95.1	3.0e-127
WP_003723793.1|2703382_2703610_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	6.8e-32
WP_003723794.1|2704155_2704758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723795.1|2704784_2705222_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	95.8	8.5e-71
WP_003723796.1|2705387_2705774_-	DUF2481 family protein	NA	A0A0B5CU14	Listeria_phage	65.4	5.6e-42
WP_003733961.1|2705777_2706182_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	86.6	4.5e-58
WP_003723797.1|2706126_2706318_-	hypothetical protein	NA	A8ASP6	Listeria_phage	98.4	1.8e-25
WP_003723952.1|2706336_2706819_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	7.4e-76
WP_003723953.1|2706815_2707316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723954.1|2707312_2707714_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	72.5	1.1e-43
WP_003723955.1|2707710_2707971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723956.1|2707970_2708177_-	hypothetical protein	NA	A0A059T5G1	Listeria_phage	100.0	6.0e-27
WP_003723957.1|2708173_2708659_-	pentapeptide repeat-containing protein	NA	A0A059T6G6	Listeria_phage	94.4	6.6e-48
WP_003723958.1|2708655_2708865_-	hypothetical protein	NA	A0A060ALG0	Listeria_phage	92.8	3.8e-29
WP_003723959.1|2708861_2709269_-	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	53.7	5.2e-30
WP_003733963.1|2709265_2709454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723960.1|2709446_2710049_-	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	44.7	4.2e-36
WP_003723961.1|2710045_2710255_-	hypothetical protein	NA	A8ASN7	Listeria_phage	92.8	2.7e-27
WP_003723963.1|2710561_2710759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723964.1|2710762_2711668_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	93.4	9.1e-144
WP_003723965.1|2711705_2712617_-	recombinase RecT	NA	NA	NA	NA	NA
WP_003723967.1|2712609_2714121_-	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	36.2	6.1e-76
WP_003722564.1|2714353_2714542_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003733681.1|2714644_2714851_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003733682.1|2714840_2715371_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	89.6	2.7e-79
WP_003733683.1|2715494_2716271_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_003733684.1|2716334_2716532_+	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_003722567.1|2716533_2716815_-	hypothetical protein	NA	A8ATX8	Listeria_phage	95.7	1.8e-37
WP_003733686.1|2716840_2717125_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
WP_003733687.1|2717136_2717331_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003733688.1|2717351_2717561_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	95.6	3.5e-30
WP_003724014.1|2717726_2718149_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	98.6	7.7e-69
WP_003724015.1|2718164_2718590_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	100.0	2.2e-76
WP_003724016.1|2718604_2719312_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	100.0	2.8e-124
WP_003724017.1|2719370_2719976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724018.1|2720038_2721202_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.2	4.4e-50
2721290:2721339	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
