The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	31778	41814	2176073		Synechococcus_phage(28.57%)	7	NA	NA
WP_009908856.1|31778_35498_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.3	3.0e-39
WP_009908857.1|35500_36955_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	9.4e-58
WP_009908859.1|37010_38033_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	3.0e-58
WP_009908860.1|38029_38581_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.5	2.1e-26
WP_002935323.1|38590_40138_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.0	8.5e-73
WP_002935322.1|40202_41033_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	59.3	7.7e-89
WP_038425698.1|41022_41814_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	33.6	1.8e-26
>prophage 2
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	322411	393271	2176073	tRNA,transposase,holin,protease	Streptococcus_phage(27.27%)	55	NA	NA
WP_025310420.1|322411_323161_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002937466.1|323150_323912_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_086558053.1|324304_325597_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_002937462.1|325990_326557_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002937456.1|326556_327171_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_002937454.1|327443_327875_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_002937449.1|327954_328956_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002937445.1|328981_329827_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002937439.1|329819_330689_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002937437.1|330681_331893_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_002937435.1|332810_333929_+	pectin acetylesterase	NA	NA	NA	NA	NA
WP_013730135.1|333938_334958_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002937432.1|335179_336463_+	trigger factor	NA	NA	NA	NA	NA
WP_002937351.1|337507_338428_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002937350.1|338461_341617_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_144412078.1|341697_343063_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.2	2.2e-64
WP_011921912.1|344148_344730_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_009909339.1|344921_346526_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.6	4.4e-141
WP_024409215.1|347137_348019_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001140948.1|348413_348602_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004194311.1|354689_356708_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_038425707.1|356880_358185_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	72.8	3.4e-168
WP_014636805.1|358249_359209_-	asparaginase	NA	NA	NA	NA	NA
WP_004194297.1|359278_360124_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004194296.1|360125_360644_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	35.5	8.9e-19
WP_004194294.1|360659_361112_-	universal stress protein	NA	NA	NA	NA	NA
WP_002937606.1|361266_362481_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_009909355.1|362951_363740_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_009909357.1|363741_364293_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.7	1.2e-26
WP_011921928.1|366321_366669_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013730145.1|366850_367525_+	hydrolase	NA	NA	NA	NA	NA
WP_002939046.1|367742_368045_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_002939044.1|368044_369511_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002939042.1|369510_370950_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_074390696.1|371267_371423_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002939037.1|371725_372724_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.7	5.0e-10
WP_009909376.1|374037_375519_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002939032.1|375593_376502_+	EamA family transporter	NA	NA	NA	NA	NA
WP_009909358.1|376691_377894_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	97.5	4.2e-221
WP_002935152.1|378176_378806_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002935151.1|379012_379387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935150.1|379570_380098_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_011922650.1|380098_381205_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_024379048.1|381523_381835_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002935147.1|381847_382480_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	33.8	2.0e-20
WP_002935146.1|382476_383064_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_002935141.1|383518_384028_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002935140.1|384029_384389_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_009909388.1|384845_385592_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024390442.1|385592_387374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935136.1|387417_388506_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002935135.1|388507_388888_+	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_013730152.1|388947_390327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194216.1|390346_390757_+	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	34.2	2.1e-10
WP_013730153.1|391171_393271_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.1	7.4e-120
>prophage 3
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	433004	468881	2176073	integrase,portal,transposase	Streptococcus_phage(97.62%)	43	433181:433195	441556:441570
WP_002937018.1|433004_434405_+	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	2.3e-24
433181:433195	attL	TTTGGTGCCAGAAAT	NA	NA	NA	NA
WP_002937017.1|434406_434778_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002937015.1|434804_435731_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	100.0	9.9e-170
WP_024409220.1|435960_437118_-|integrase	site-specific integrase	integrase	A0A1X9I5C3	Streptococcus_phage	100.0	2.2e-219
WP_013730164.1|437314_438046_-	hypothetical protein	NA	A0A1X9I5E4	Streptococcus_phage	100.0	3.7e-103
WP_013730165.1|438093_438477_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I5R2	Streptococcus_phage	100.0	2.9e-67
WP_002937004.1|438483_438864_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5A1	Streptococcus_phage	100.0	3.9e-64
WP_002937001.1|439048_439249_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	100.0	9.6e-30
WP_013730167.1|439717_439972_+	hypothetical protein	NA	A0A1X9I581	Streptococcus_phage	100.0	9.7e-43
WP_013730168.1|440012_440261_+	hypothetical protein	NA	A0A1X9I6Q0	Streptococcus_phage	100.0	1.1e-38
WP_022540561.1|440250_440403_+	hypothetical protein	NA	A0A1X9I663	Streptococcus_phage	100.0	2.0e-19
WP_013730169.1|440407_440749_+	hypothetical protein	NA	A0A1X9I5G6	Streptococcus_phage	100.0	2.1e-56
WP_013730170.1|440748_441228_+	siphovirus Gp157 family protein	NA	A0A1X9I5D2	Streptococcus_phage	100.0	4.8e-67
WP_013730171.1|441224_441470_+	hypothetical protein	NA	A0A1X9I5F0	Streptococcus_phage	100.0	4.3e-40
WP_013730172.1|441450_441915_+	hypothetical protein	NA	A0A1X9I5S7	Streptococcus_phage	100.0	7.1e-84
441556:441570	attR	TTTGGTGCCAGAAAT	NA	NA	NA	NA
WP_013730173.1|441883_443056_+	hypothetical protein	NA	M1PF69	Streptococcus_phage	98.7	7.0e-229
WP_013730175.1|443405_444104_+	ERF family protein	NA	A0A1X9I5A9	Streptococcus_phage	100.0	2.2e-113
WP_022540564.1|444103_444400_+	hypothetical protein	NA	A0A1X9I5B1	Streptococcus_phage	100.0	1.6e-52
WP_022540565.1|444396_444795_+	single-stranded DNA-binding protein	NA	A0A1X9I6R5	Streptococcus_phage	100.0	2.7e-68
WP_013730177.1|444805_445633_+	bifunctional DNA primase/polymerase	NA	A0A1X9I684	Streptococcus_phage	100.0	4.6e-158
WP_079253058.1|445616_446996_+	helicase	NA	A0A1X9I5H6	Streptococcus_phage	99.8	3.8e-266
WP_013730179.1|447352_447508_+	hypothetical protein	NA	A0A1X9I5E8	Streptococcus_phage	100.0	9.7e-22
WP_013730180.1|447504_447813_+	DUF1372 family protein	NA	A0A1X9I5G5	Streptococcus_phage	100.0	3.8e-49
WP_013730181.1|447814_448030_+	hypothetical protein	NA	A0A1X9I5W1	Streptococcus_phage	100.0	9.7e-36
WP_013730182.1|448218_448533_+	hypothetical protein	NA	A0A1X9I5C1	Streptococcus_phage	100.0	5.2e-54
WP_002937915.1|448605_449040_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	100.0	2.0e-72
WP_024409219.1|449576_449936_+	hypothetical protein	NA	A0A1X9I6S2	Streptococcus_phage	99.2	9.8e-41
WP_013730185.1|449932_451198_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	100.0	5.4e-243
WP_013730186.1|451190_452411_+	hypothetical protein	NA	A0A1X9I5H8	Streptococcus_phage	100.0	2.0e-239
WP_022540567.1|452415_452649_+	hypothetical protein	NA	A0A1X9I5G0	Streptococcus_phage	100.0	1.6e-39
WP_162487885.1|452850_454143_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.5	1.3e-212
WP_009909540.1|455767_456406_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	100.0	4.6e-126
WP_024409271.1|456468_458982_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	100.0	0.0e+00
WP_013730270.1|459143_460220_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	100.0	2.1e-195
WP_009909544.1|460284_461523_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	100.0	1.2e-223
WP_009909545.1|461532_462318_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	100.0	1.6e-136
WP_013730271.1|462340_462745_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	100.0	1.1e-64
WP_013730272.1|462871_463723_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	100.0	6.3e-155
WP_025310423.1|463821_465081_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	99.8	4.5e-242
WP_012775019.1|465202_465937_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	99.5	1.5e-120
WP_024409273.1|466041_467487_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	99.8	1.6e-227
WP_011922111.1|467504_468194_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	96.1	1.3e-110
WP_009909562.1|468203_468881_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	100.0	1.6e-121
>prophage 4
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	547464	605583	2176073	transposase,protease	Streptococcus_phage(78.26%)	51	NA	NA
WP_009909666.1|547464_549702_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	94.0	1.4e-97
WP_002935351.1|549703_549847_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002935353.1|550025_550682_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	99.1	2.1e-113
WP_002935354.1|550775_551603_+	hypothetical protein	NA	M1PFV6	Streptococcus_phage	97.8	6.6e-133
WP_002935355.1|551608_552880_+	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	100.0	1.7e-212
WP_002935357.1|552916_553783_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	99.7	4.6e-153
WP_002935358.1|553957_554596_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	98.6	2.6e-113
WP_002935359.1|554592_555477_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	98.3	3.6e-153
WP_002935361.1|555496_555814_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	100.0	3.1e-54
WP_002935362.1|555815_556679_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	99.7	2.1e-158
WP_002935363.1|557148_558240_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	98.6	1.5e-204
WP_002935364.1|558239_558797_+	GNAT family acetyltransferase	NA	M1PSC3	Streptococcus_phage	98.4	4.5e-93
WP_002935365.1|559170_560352_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	99.7	2.7e-220
WP_002935366.1|560354_560861_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	97.0	1.2e-92
WP_002935368.1|560844_561198_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	100.0	1.9e-60
WP_009909675.1|561214_562114_-	cation transporter	NA	M1Q1N9	Streptococcus_phage	98.3	1.3e-161
WP_002935370.1|562413_563241_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	99.6	8.3e-152
WP_002935371.1|563396_565058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935372.1|565217_566606_+	amino acid permease	NA	NA	NA	NA	NA
WP_002935373.1|566728_567610_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935375.1|567802_568639_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935376.1|568656_569532_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935377.1|569654_570266_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_024409330.1|570661_571606_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.9e-20
WP_002935380.1|574274_576197_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_029694137.1|576473_577352_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002935387.1|577676_578423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935389.1|579274_580993_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	99.0	0.0e+00
WP_002935390.1|581083_581653_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002935392.1|581639_582188_-	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	37.8	2.8e-23
WP_022540619.1|582180_582876_-	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_002935394.1|583379_585050_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_002935395.1|585093_585903_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935400.1|587677_588529_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935402.1|588686_589304_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	51.5	3.8e-48
WP_002935404.1|589304_589814_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002935405.1|589803_590457_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002935406.1|590467_590755_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_002935416.1|591051_591828_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_002935421.1|591959_592703_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002935426.1|592715_593690_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002935429.1|593876_594200_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002935430.1|594232_594538_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002935431.1|594550_595852_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002935432.1|596003_598448_+	glycyl radical protein	NA	A0A2H4YEI2	Aeromonas_phage	47.2	4.9e-06
WP_002935438.1|598462_599131_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.0	1.5e-21
WP_002935440.1|599162_600119_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002935441.1|600239_601334_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_002935442.1|601502_602579_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002935444.1|602651_603587_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_086558053.1|604290_605583_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
>prophage 5
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	826722	841262	2176073	integrase	Streptococcus_phage(100.0%)	25	829971:829987	839427:839443
WP_002935718.1|826722_827850_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	58.0	5.7e-87
WP_002935708.1|827840_828068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730449.1|828077_828530_-	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
WP_002935704.1|828679_829987_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	100.0	8.3e-247
829971:829987	attL	ACAACTTGAAAAAATAA	NA	NA	NA	NA
WP_024415669.1|830146_831310_-|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	99.7	9.7e-223
WP_024409199.1|831393_831939_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U6	Streptococcus_phage	100.0	9.5e-96
WP_024409200.1|832096_832285_+	hypothetical protein	NA	A0A1X9I5U7	Streptococcus_phage	100.0	7.2e-27
WP_024409201.1|832463_832739_+	hypothetical protein	NA	A0A1X9I5W5	Streptococcus_phage	100.0	8.0e-43
WP_024409202.1|832728_832932_+	hypothetical protein	NA	A0A1X9I5V6	Streptococcus_phage	100.0	4.4e-30
WP_024409203.1|832924_833128_+	hypothetical protein	NA	A0A1X9I725	Streptococcus_phage	100.0	2.8e-29
WP_024409204.1|833138_833405_+	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	100.0	5.6e-41
WP_162841287.1|833415_833574_+	hypothetical protein	NA	A0A1X9I5Z1	Streptococcus_phage	100.0	3.1e-23
WP_024409205.1|833578_833794_+	hypothetical protein	NA	A0A1X9I5W7	Streptococcus_phage	100.0	2.4e-34
WP_079269917.1|833807_834602_+	DnaD domain protein	NA	A0A1X9I617	Streptococcus_phage	100.0	1.3e-149
WP_024409207.1|834617_835463_+	ATP-binding protein	NA	A0A1X9I6C4	Streptococcus_phage	100.0	2.6e-156
WP_024409208.1|835930_836371_+	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	100.0	2.0e-75
WP_024409209.1|836440_836941_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	100.0	1.3e-94
WP_009910450.1|837080_837467_+	hypothetical protein	NA	A0A1X9I5X3	Streptococcus_phage	100.0	4.6e-60
WP_009910449.1|837650_837833_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5W4	Streptococcus_phage	100.0	3.7e-28
WP_009910448.1|837872_838325_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1X9I727	Streptococcus_phage	100.0	1.7e-82
WP_009910447.1|838436_838646_+	hypothetical protein	NA	A0A1X9I6N3	Streptococcus_phage	100.0	1.0e-34
WP_012775256.1|839752_839974_+	hypothetical protein	NA	A0A1X9I609	Streptococcus_phage	100.0	1.2e-33
839427:839443	attR	ACAACTTGAAAAAATAA	NA	NA	NA	NA
WP_009910443.1|839975_840236_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	55.8	3.9e-23
WP_002935700.1|840402_841044_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002935693.1|841076_841262_-	hypothetical protein	NA	W6LMT3	Streptococcus_phage	68.9	2.3e-17
>prophage 6
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	925764	976374	2176073	tRNA,transposase,protease	Streptococcus_phage(30.0%)	47	NA	NA
WP_013730428.1|925764_927021_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.4	7.5e-128
WP_013730427.1|927327_929139_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	37.6	9.5e-100
WP_013730426.1|929312_929954_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009909533.1|929963_930596_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	6.6e-32
WP_024390310.1|930622_931453_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002935153.1|932003_933206_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
WP_013730423.1|933585_934731_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_013730422.1|934754_935756_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013730421.1|936496_937456_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013730419.1|938507_939401_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002938126.1|939410_940211_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	9.0e-10
WP_002938125.1|940414_941482_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_002938123.1|941494_942364_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002938121.1|942409_943435_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	35.2	3.2e-44
WP_002938119.1|943444_944482_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	34.3	2.2e-45
WP_002938116.1|944782_945376_-	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_074390814.1|945475_947533_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	31.1	5.8e-85
WP_002938107.1|947596_948538_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009910108.1|948769_950572_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002938105.1|950573_951014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002938103.1|951029_951578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910106.1|951652_952372_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_002938100.1|952432_953434_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_002938099.1|953698_954184_+	LURP-one-related family protein	NA	NA	NA	NA	NA
WP_009910105.1|954463_957082_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	1.5e-61
WP_002938097.1|957156_957609_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002938096.1|957812_958007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730415.1|958157_958724_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_009910096.1|958736_958952_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013730414.1|958948_959707_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_009910094.1|959728_959935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012775187.1|959960_960650_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002936096.1|960659_960977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002936095.1|960986_961661_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002936094.1|961768_962863_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002936093.1|963773_964589_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002936092.1|964640_965282_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_002936090.1|965298_966300_+	sugar kinase	NA	NA	NA	NA	NA
WP_022540650.1|966310_966952_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_032505201.1|967237_967672_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002936082.1|967683_968874_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002936080.1|968883_969375_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_002936077.1|969394_970171_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002936073.1|970157_970973_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_009910076.1|970979_971288_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_009910073.1|971384_974879_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002935153.1|975171_976374_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
>prophage 7
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	1166828	1177103	2176073		Streptococcus_phage(33.33%)	11	NA	NA
WP_002936496.1|1166828_1168481_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.3	6.2e-13
WP_002936495.1|1168477_1168801_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_009909865.1|1168919_1169180_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_009909862.1|1169190_1169748_+	sugar O-acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	38.6	4.9e-07
WP_009909860.1|1169806_1170649_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	44.3	4.7e-33
WP_024409355.1|1170741_1172835_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	3.1e-102
WP_002936486.1|1173411_1173906_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002936483.1|1173971_1174337_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_006738653.1|1174595_1174769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909851.1|1174765_1175590_+	replication initiator protein A	NA	A0A286QNA4	Streptococcus_phage	37.6	5.8e-12
WP_029743109.1|1175747_1177103_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	55.6	2.9e-125
>prophage 8
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	1253485	1266924	2176073		Streptococcus_phage(71.43%)	9	NA	NA
WP_038425701.1|1253485_1254670_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	58.1	4.0e-123
WP_024406079.1|1254666_1255626_+	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	49.5	7.3e-75
WP_050571928.1|1255703_1256075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024406080.1|1256093_1263365_+	DEAD/DEAH box helicase family protein	NA	A0A248SL14	Klebsiella_phage	37.4	4.1e-287
WP_024383732.1|1263361_1264000_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024383731.1|1264046_1264340_-	hypothetical protein	NA	E4ZFJ0	Streptococcus_phage	64.6	6.3e-30
WP_024383730.1|1264326_1264677_-	hypothetical protein	NA	M1PLN9	Streptococcus_phage	51.6	4.3e-25
WP_024383729.1|1264673_1266089_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	71.8	1.2e-198
WP_024383728.1|1266231_1266924_-	helix-turn-helix transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	72.5	1.3e-86
>prophage 9
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	1385819	1457383	2176073	transposase,tRNA,protease,holin,capsid,terminase	Streptococcus_phage(81.82%)	60	NA	NA
WP_013730345.1|1385819_1387037_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002939269.1|1387038_1388181_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002939268.1|1388293_1388710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730344.1|1388770_1389154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024409196.1|1389172_1390201_-	amino acid lyase	NA	NA	NA	NA	NA
WP_013730343.1|1390371_1391577_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_012775068.1|1392179_1392413_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_086558053.1|1392596_1393889_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_013730342.1|1394102_1395125_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002935490.1|1395235_1395853_-	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_009909731.1|1396024_1398478_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.3	2.0e-92
WP_002935488.1|1398678_1399131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935487.1|1399133_1399628_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_002935485.1|1399660_1400263_-	Fic family protein	NA	NA	NA	NA	NA
WP_002935482.1|1400286_1402236_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.9	9.2e-125
WP_009909724.1|1402378_1403023_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002935480.1|1403032_1406686_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.6	5.5e-22
WP_002935479.1|1406685_1409952_-	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_002935476.1|1414004_1414169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730339.1|1414541_1415855_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002935474.1|1416058_1416187_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_013730338.1|1416243_1418028_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_009909716.1|1418267_1419011_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.3e-26
WP_009909715.1|1419007_1420618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730337.1|1421185_1421941_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_002935464.1|1422291_1422543_-|holin	holin	holin	NA	NA	NA	NA
WP_013730336.1|1422785_1423550_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013730335.1|1423628_1424312_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_009909709.1|1424590_1425331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909707.1|1425772_1428052_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	1.2e-128
WP_002935458.1|1428341_1429709_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002935455.1|1429893_1430232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935451.1|1430398_1432189_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	100.0	0.0e+00
WP_086558053.1|1432403_1433696_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_024394270.1|1434097_1434475_-	hypothetical protein	NA	A0A1X9I733	Streptococcus_phage	100.0	1.9e-63
WP_024409231.1|1434539_1435277_-	PlySs2 family phage lysin	NA	A0A1X9I5W6	Streptococcus_phage	100.0	1.9e-139
WP_029743088.1|1435373_1435760_-|holin	phage holin family protein	holin	A0A1X9I5Y2	Streptococcus_phage	100.0	1.1e-61
WP_024409233.1|1435805_1436150_-	hypothetical protein	NA	A0A1X9I5X6	Streptococcus_phage	100.0	6.7e-63
WP_024409234.1|1436152_1436368_-	hypothetical protein	NA	A0A1X9I729	Streptococcus_phage	100.0	4.3e-28
WP_024409235.1|1436367_1441674_-	hypothetical protein	NA	A0A1X9I6P1	Streptococcus_phage	100.0	0.0e+00
WP_002937853.1|1441670_1442366_-	adenylosuccinate synthetase	NA	M1PFK1	Streptococcus_phage	100.0	5.8e-130
WP_002937855.1|1442365_1444948_-	hypothetical protein	NA	M1NRZ6	Streptococcus_phage	100.0	6.2e-262
WP_024409236.1|1444937_1445321_-	DUF5361 domain-containing protein	NA	A0A1X9I625	Streptococcus_phage	100.0	3.6e-65
WP_024415622.1|1445317_1445596_-	hypothetical protein	NA	M1Q1D2	Streptococcus_phage	100.0	3.6e-43
WP_024409238.1|1445606_1446194_-	hypothetical protein	NA	A0A1X9I5X2	Streptococcus_phage	100.0	3.3e-102
WP_024409239.1|1446209_1446545_-	hypothetical protein	NA	A0A1X9I5X7	Streptococcus_phage	100.0	6.5e-55
WP_024409240.1|1446541_1446781_-	hypothetical protein	NA	A0A1X9I5Y4	Streptococcus_phage	100.0	4.8e-36
WP_024409241.1|1446773_1447112_-	hypothetical protein	NA	A0A1X9I5Z3	Streptococcus_phage	100.0	4.7e-61
WP_024409242.1|1447098_1447494_-	phage Gp19/Gp15/Gp42 family protein	NA	A0A1X9I730	Streptococcus_phage	100.0	3.7e-65
WP_047020681.1|1447497_1447710_-	hypothetical protein	NA	A0A1X9I6Q1	Streptococcus_phage	98.5	4.3e-28
WP_024390456.1|1447716_1448607_-|capsid	phage major capsid protein	capsid	M1PF50	Streptococcus_phage	100.0	6.8e-168
WP_024409244.1|1448610_1449075_-	DUF4355 domain-containing protein	NA	A0A1X9I604	Streptococcus_phage	100.0	5.5e-76
WP_024409245.1|1449155_1450571_-|terminase	terminase	terminase	A0A1X9I637	Streptococcus_phage	100.0	1.2e-267
WP_024390459.1|1450654_1450885_-	hypothetical protein	NA	A0A1X9I6E9	Streptococcus_phage	100.0	4.8e-33
WP_024390460.1|1450884_1451139_-	hypothetical protein	NA	A0A1X9I5Y1	Streptococcus_phage	100.0	1.2e-40
WP_002938966.1|1452919_1453258_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	100.0	1.9e-54
WP_013730266.1|1453267_1454371_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_004194717.1|1454378_1455545_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	3.5e-39
WP_004194719.1|1455548_1456223_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	64.6	7.7e-79
WP_004194720.1|1456219_1457383_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.7	2.1e-140
>prophage 10
NZ_CP002007	Streptococcus suis 05HAS68 chromosome, complete genome	2176073	2145685	2165032	2176073	integrase,transposase	Streptococcus_phage(66.67%)	23	2150717:2150774	2163489:2163546
WP_002938187.1|2145685_2146522_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_013730677.1|2146518_2147058_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002939074.1|2147067_2147925_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002939071.1|2148006_2149290_-	insulinase family protein	NA	NA	NA	NA	NA
WP_009911054.1|2149286_2150540_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	99.0	4.2e-232
2150717:2150774	attL	AAAAACATACTAAGATTAGTAGTGAGGAAATCTCCGACGGGAGAAAGTACTCACTACT	NA	NA	NA	NA
WP_013730680.1|2151323_2151872_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	58.1	4.7e-50
WP_013730681.1|2151949_2152408_-	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	42.0	7.6e-22
WP_013730682.1|2152420_2153236_-	DnaD domain protein	NA	A0A2I6QQV2	Streptococcus_phage	66.0	2.0e-81
WP_013730683.1|2153222_2153507_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	83.9	8.9e-37
WP_024409270.1|2153496_2153835_-	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	97.8	5.1e-47
WP_013730685.1|2153831_2153981_-	hypothetical protein	NA	A0A1X9I6A8	Streptococcus_phage	89.8	2.4e-17
WP_013730686.1|2153992_2154196_-	hypothetical protein	NA	A0A1X9I5T6	Streptococcus_phage	79.1	7.2e-25
WP_013730687.1|2154183_2154573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730688.1|2155011_2155638_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	32.8	9.5e-15
WP_013730689.1|2155650_2156397_-	Bro-N domain-containing protein	NA	A0A0A7RW33	Clostridium_phage	50.7	2.1e-24
WP_013730690.1|2156415_2156643_-	helix-turn-helix transcriptional regulator	NA	Q38329	Lactococcus_phage	51.6	2.8e-09
WP_013730691.1|2156796_2157510_+	helix-turn-helix transcriptional regulator	NA	Q708R9	Streptococcus_phage	50.6	3.7e-15
WP_013730692.1|2157873_2158704_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	62.1	1.2e-89
WP_013730693.1|2158868_2160041_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	96.9	3.1e-216
WP_002936175.1|2160178_2160562_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	94.5	4.6e-36
WP_002936177.1|2160564_2161659_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_086558053.1|2162097_2163390_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_014637236.1|2163550_2165032_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.9	3.6e-97
2163489:2163546	attR	AGTAGTGAGTACTTTCTCCCGTCGGAGATTTCCTCACTACTAATCTTAGTATGTTTTT	NA	NA	NA	NA
