The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	69799	79173	5249232	transposase	Klebsiella_phage(16.67%)	7	NA	NA
WP_001299665.1|69799_71302_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	4.6e-84
WP_001299662.1|71431_72451_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000594911.1|73264_74089_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_001254878.1|74137_75583_-|transposase	IS30 family transposase	transposase	Q858R9	Enterobacteria_phage	69.5	7.2e-74
WP_000177060.1|76634_76892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|77448_78216_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|78216_79173_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 2
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	400911	521115	5249232	transposase,tail,capsid,tRNA,head,portal,protease,plate,terminase,integrase	Enterobacteria_phage(40.68%)	111	445793:445808	528440:528455
WP_001299463.1|400911_402264_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|402293_404726_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|404847_405333_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|405336_406362_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|406466_406922_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|406925_407714_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|407713_408862_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|408858_409455_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294752.1|409491_412974_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|412986_413946_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021017.1|414044_416186_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|416242_416632_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|416696_417995_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|418043_418304_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|418290_418491_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|418656_419202_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|419198_419621_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|419634_420345_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260712.1|421376_423095_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|423206_423914_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|423910_424315_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|424432_425248_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|425287_425941_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|425933_426965_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|427152_427728_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997004.1|433622_434426_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	3.5e-38
WP_000648610.1|434422_435337_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|435577_436378_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211688.1|436455_437226_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|437273_438632_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|438703_439459_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001299438.1|439492_440215_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|440211_440679_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|440743_441475_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086139.1|442014_442800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236641.1|442936_443416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|443425_444340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|444383_444866_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|444889_446242_-	membrane protein	NA	NA	NA	NA	NA
445793:445808	attL	CTGCTGGAGCTTATCG	NA	NA	NA	NA
WP_001240530.1|449795_451208_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|451212_451956_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614369.1|451952_454760_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	9.0e-81
WP_000343289.1|454768_455530_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|455534_456866_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|456868_457393_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|457389_458670_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|458694_459777_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|459740_461591_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|461594_462008_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_029788048.1|463540_463786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037387.1|463799_464300_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|464997_465516_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103113.1|465725_467867_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.4e-25
WP_000509081.1|467942_472202_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_001299446.1|472305_473043_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000939263.1|474725_475208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122996047.1|475122_475308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299364.1|475414_476092_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624629.1|476091_476439_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_000381395.1|476458_478030_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000937502.1|479578_479884_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239873.1|479940_480609_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|480974_481088_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836763.1|481156_481390_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	85.7	7.0e-32
WP_000087135.1|481708_482299_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	37.2	1.4e-23
WP_000885627.1|482396_482972_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	7.2e-102
WP_024184406.1|482971_485998_-|tail	tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001230516.1|486062_486662_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	2.8e-109
WP_000515289.1|486728_490127_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.3	0.0e+00
WP_071821436.1|490187_490820_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_000167714.1|490756_491500_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	3.3e-147
WP_001152620.1|491505_492204_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000847401.1|492203_492533_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_000840229.1|492529_495091_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.6	0.0e+00
WP_000459457.1|495083_495518_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|495499_495922_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001299458.1|495937_496678_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.3	2.2e-127
WP_000683105.1|496685_497081_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975048.1|497077_497656_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000753019.1|497667_498021_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|498032_498428_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000063282.1|498469_499495_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	1.6e-189
WP_001299443.1|499550_499883_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123287.1|499892_501212_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	4.0e-233
WP_001299451.1|501192_502794_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.7e-308
WP_000198149.1|502790_502997_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027318.1|502993_504919_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|504893_505439_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|505827_506022_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_164474067.1|506499_507712_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	6.5e-169
WP_000881075.1|507818_508616_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|508625_509177_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709094.1|509641_511168_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|511225_511375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|511422_511755_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|511822_512125_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788815.1|512121_512823_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_001551200.1|512819_513749_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182903.1|513835_514375_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|514443_514674_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259987.1|514712_515468_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|516063_516270_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|516345_516642_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|516647_517433_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|517429_518110_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|518106_518268_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|518260_518818_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_077248689.1|518828_519110_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	2.1e-46
WP_000763390.1|519208_519427_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|519474_519753_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|519951_521115_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
528440:528455	attR	CTGCTGGAGCTTATCG	NA	NA	NA	NA
>prophage 3
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	738424	802502	5249232	transposase,protease,holin	Stx2-converting_phage(21.43%)	51	NA	NA
WP_000131044.1|738424_740458_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|740586_741174_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|741187_742660_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|742673_744344_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000370308.1|745467_746163_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023915.1|746155_747583_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|747593_748313_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|748839_749694_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046296.1|749919_751245_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|751353_751590_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299535.1|751601_752192_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|752356_753226_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|753474_754332_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092586.1|754452_758706_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|759821_759923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|760285_760549_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|760548_760689_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|760723_760951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164474067.1|761198_762412_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	6.5e-169
WP_000893255.1|764458_765712_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|765723_766827_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749885.1|767114_768170_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_000174677.1|768208_768610_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|768667_769912_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|770003_770462_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|770722_772180_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000709407.1|772236_772797_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528870.1|772847_773987_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.3e-32
WP_001059855.1|774232_774685_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|774681_775737_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207559.1|775807_776593_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001299551.1|776537_778277_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|778381_778660_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|778652_779009_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543899.1|779065_779839_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|780024_780285_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|780287_780566_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|780721_781462_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|781432_782200_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|782405_782984_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973070.1|783223_785668_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|785710_786184_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118026.1|786337_787108_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000381395.1|789581_791153_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624629.1|791172_791520_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_001299364.1|791519_792197_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001201825.1|792594_793548_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|794060_794822_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|795004_795895_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662362.1|795895_798868_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000420935.1|801365_802502_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	1021294	1082804	5249232	transposase,capsid,tail,head,protease,terminase,holin,integrase	Stx2-converting_phage(33.78%)	77	1009189:1009207	1045353:1045371
1009189:1009207	attL	GCCTGCGGATCTGTTTATT	NA	NA	NA	NA
WP_048818680.1|1021294_1022314_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	98.8	7.3e-190
WP_165899066.1|1022403_1023616_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	1.2e-167
WP_048818682.1|1023619_1023874_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	2.5e-35
WP_000107182.1|1023957_1024590_-	anti-repressor protein	NA	A0A088CD42	Shigella_phage	72.5	4.7e-46
WP_000211518.1|1024844_1025465_-	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	92.2	1.4e-103
WP_000203824.1|1025714_1026002_-	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	81.1	9.9e-36
WP_000247838.1|1026323_1027046_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	70.1	6.3e-87
WP_000208053.1|1027124_1027679_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	68.3	1.4e-62
WP_001014291.1|1027681_1027873_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_001289918.1|1027874_1028645_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	99.6	1.9e-142
WP_000763363.1|1028641_1028863_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001386642.1|1028961_1029243_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548536.1|1029253_1029445_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1029417_1029600_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1029596_1030277_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000100845.1|1030273_1031059_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995409.1|1031064_1031361_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|1031436_1031580_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1031548_1031713_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000167589.1|1031903_1032374_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000198444.1|1032432_1032816_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_015980176.1|1033309_1033960_-	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_048818691.1|1033947_1034214_-	hypothetical protein	NA	K7P7N9	Enterobacteria_phage	98.9	3.8e-42
WP_001274760.1|1034639_1035353_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000437876.1|1035453_1035654_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_000195205.1|1035792_1036089_+	regulatory protein	NA	G9L678	Escherichia_phage	96.9	7.5e-47
WP_000185454.1|1036121_1037060_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788818.1|1037056_1037758_+	Replication protein P	NA	H6WZI3	Escherichia_phage	99.1	3.8e-129
WP_000145935.1|1037754_1038045_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000103679.1|1038130_1038346_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1038356_1038593_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1038549_1038996_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153280.1|1038992_1039520_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1039516_1039699_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211426.1|1039973_1040708_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	94.7	4.2e-115
WP_001004029.1|1040782_1041505_+	DNA-binding protein	NA	Q4A1A3	Enterobacteria_phage	92.9	7.1e-123
WP_001107966.1|1041504_1042110_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	99.0	8.6e-98
WP_000144761.1|1042106_1042307_+	protein ninH	NA	G9L694	Escherichia_phage	92.4	1.2e-27
WP_001204830.1|1042299_1042725_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	72.5	1.0e-52
WP_044809592.1|1043760_1045773_+	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.7	6.4e-81
1045353:1045371	attR	GCCTGCGGATCTGTTTATT	NA	NA	NA	NA
WP_001304085.1|1047188_1047341_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_000735807.1|1047721_1047946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498119.1|1047998_1048208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299632.1|1048397_1048829_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000023194.1|1049307_1051158_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	94.6	0.0e+00
WP_024164617.1|1051442_1051658_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731247.1|1051662_1052007_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	3.8e-58
WP_001092878.1|1052057_1052591_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	1.9e-101
WP_000661716.1|1052864_1053560_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.7	8.1e-124
WP_001280922.1|1053654_1053786_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_012816791.1|1054008_1054194_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095746.1|1054448_1054649_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	93.9	1.5e-27
WP_000829190.1|1054690_1055056_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958372.1|1055344_1055908_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001299644.1|1055904_1057566_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_165899067.1|1057629_1059567_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.4	0.0e+00
WP_001063096.1|1059611_1059833_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125984.1|1062682_1063009_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007889.1|1063019_1063370_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573374.1|1063366_1063813_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133376.1|1063809_1064154_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275461.1|1064219_1064936_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|1064941_1065316_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_122998563.1|1065411_1065621_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.6	4.4e-33
WP_000212875.1|1065672_1068915_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.2	0.0e+00
WP_000807962.1|1068907_1069249_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	2.5e-62
WP_001152217.1|1069248_1069947_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_024184440.1|1069952_1070696_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	1.8e-145
WP_162774118.1|1070641_1071274_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	6.5e-104
WP_000514698.1|1071514_1074991_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.5	0.0e+00
WP_024184441.1|1075059_1075683_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	2.7e-70
WP_000268978.1|1075747_1077061_+	hypothetical protein	NA	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001023420.1|1077062_1077332_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000491547.1|1077472_1078348_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	94.8	3.8e-155
WP_024184442.1|1078572_1079223_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	74.1	5.5e-90
WP_000767389.1|1080979_1081456_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001389241.1|1081514_1082804_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 5
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	1290256	1357593	5249232	tail,portal,head,capsid,protease,terminase,holin,integrase	Enterobacteria_phage(40.82%)	80	1305338:1305397	1352856:1352920
WP_000156526.1|1290256_1292017_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1292202_1292655_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1292730_1293771_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1294127_1294637_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1294855_1295485_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875015.1|1295447_1297610_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1297619_1298066_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1298188_1300243_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1300274_1300733_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1300828_1301491_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001299688.1|1301663_1302077_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001299702.1|1302121_1302439_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1302496_1303687_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048221.1|1303781_1304060_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1304056_1304386_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1304476_1305136_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1305338:1305397	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001299701.1|1305544_1306564_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000273151.1|1306541_1306784_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_064482952.1|1306851_1309323_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.4	1.0e-59
WP_001090200.1|1309415_1309607_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1309603_1309792_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1310323_1310698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1310709_1310862_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1311134_1311851_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1311900_1312116_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1312112_1312538_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1312609_1313680_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151137.1|1313720_1314143_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.4e-64
WP_001266134.1|1314139_1314436_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1314432_1314894_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1314871_1315228_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1315278_1315491_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1315742_1316006_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1316016_1316886_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1317001_1317106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1317294_1317507_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|1317674_1317953_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001217436.1|1319016_1319388_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1319377_1319749_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1319900_1320719_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1321005_1321203_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1321340_1322054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165899068.1|1322821_1324672_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_024182511.1|1325111_1325327_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000138558.1|1325582_1325855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1326014_1326548_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1326768_1326882_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1327103_1327289_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1327816_1328131_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299691.1|1328212_1328437_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	87.3	1.0e-19
WP_000235436.1|1328839_1329349_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816750.1|1329320_1331249_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000259002.1|1331232_1331439_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|1331435_1333028_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001253992.1|1333017_1334523_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	4.6e-100
WP_000256723.1|1334559_1334907_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522623.1|1334964_1335993_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_001299692.1|1336044_1336428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1336420_1336774_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974985.1|1336789_1337323_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|1337319_1337715_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235020.1|1337722_1338469_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	1.5e-123
WP_001299690.1|1338487_1338919_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|1338945_1339359_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082482.1|1339339_1341919_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.5	0.0e+00
WP_000847304.1|1341915_1342245_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001299699.1|1342244_1342943_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.1e-131
WP_024184450.1|1342948_1343692_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.0e-148
WP_162775851.1|1343637_1344270_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	2.1e-102
WP_000649830.1|1344460_1344988_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_165899069.1|1345121_1348598_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.0	0.0e+00
WP_001230435.1|1348665_1349265_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_000268999.1|1349329_1350637_+	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	89.0	2.8e-77
WP_001023456.1|1350638_1350908_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	3.2e-44
WP_000610783.1|1351034_1351928_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1352373_1352757_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001058323.1|1353374_1354493_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1352856:1352920	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107360.1|1354489_1356283_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1356301_1357009_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1357005_1357593_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	1583650	1599574	5249232	transposase,integrase	Enterobacteria_phage(64.29%)	18	1583914:1583927	1593943:1593956
WP_000612626.1|1583650_1583998_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
1583914:1583927	attL	CACACCGGCACAGC	NA	NA	NA	NA
WP_165899070.1|1584046_1585585_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	2.4e-293
WP_165899070.1|1586665_1588204_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	2.4e-293
WP_000612626.1|1588252_1588600_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001466366.1|1588596_1588977_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_048818784.1|1589070_1590216_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.6	4.2e-202
WP_000220053.1|1590225_1590417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970452.1|1590403_1591081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393065.1|1591082_1592513_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	30.5	1.0e-24
WP_000446128.1|1592731_1593304_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.5e-94
WP_000638629.1|1593377_1593878_-	transactivation protein	NA	NA	NA	NA	NA
WP_001279714.1|1593874_1594609_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.8e-129
1593943:1593956	attR	GCTGTGCCGGTGTG	NA	NA	NA	NA
WP_001149160.1|1595161_1595428_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980234.1|1595424_1596024_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	7.8e-51
WP_001244665.1|1596016_1596304_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459316.1|1596296_1596752_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|1596887_1597208_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783681.1|1597222_1599574_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	96.6	0.0e+00
>prophage 7
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	1622985	1698345	5249232	transposase,lysis,capsid,tail,head,portal,tRNA,protease,terminase,holin,integrase	Enterobacteria_phage(20.9%)	94	1649771:1649791	1685327:1685347
WP_001113310.1|1622985_1623453_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074974.1|1623529_1624648_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1624616_1624886_-	excisionase	NA	NA	NA	NA	NA
WP_001358072.1|1624947_1627419_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_001090200.1|1627511_1627703_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1627699_1627888_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000367376.1|1628377_1628530_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|1628805_1629450_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1629547_1629775_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1629771_1630197_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|1630265_1631303_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|1631334_1631757_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450612.1|1631791_1632490_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000702797.1|1632511_1632736_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1632732_1633089_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001375713.1|1633121_1633274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|1633270_1633582_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137957.1|1633708_1634272_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001278460.1|1634381_1634486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1634672_1634885_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001341388.1|1635052_1635331_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265175.1|1635332_1636382_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_000904098.1|1636394_1636769_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_000762928.1|1636765_1637587_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000917767.1|1637813_1638011_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000248436.1|1638162_1639227_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	90.8	2.6e-190
WP_000573777.1|1639334_1639595_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000798624.1|1639655_1640030_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001299895.1|1640337_1640769_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_000216623.1|1640765_1640933_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_165899071.1|1641340_1643191_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024165672.1|1643483_1643699_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|1643703_1644048_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992129.1|1644098_1644632_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	3.6e-100
WP_001082547.1|1644930_1645425_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_000736096.1|1645421_1645646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095749.1|1646014_1646242_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000829192.1|1646283_1646649_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958403.1|1646938_1647502_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	84.0	2.4e-70
WP_001299891.1|1647498_1649160_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000173042.1|1649223_1651161_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
1649771:1649791	attL	CAACCGTTTTTCATAAGGAAA	NA	NA	NA	NA
WP_001063096.1|1651205_1651427_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125996.1|1653953_1654280_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007905.1|1654290_1654641_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1654637_1655084_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133391.1|1655080_1655425_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275510.1|1655483_1656200_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1656205_1656580_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1656675_1656885_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000526113.1|1657062_1657521_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_165899072.1|1657648_1660891_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	98.0	0.0e+00
WP_000807964.1|1660883_1661225_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152187.1|1661224_1661923_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	8.9e-131
WP_001299901.1|1661933_1662677_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	1.8e-150
WP_165899085.1|1662622_1663255_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	89.5	4.8e-99
WP_000649829.1|1663445_1663973_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515158.1|1664106_1667586_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.1	0.0e+00
WP_001449501.1|1667654_1668278_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
WP_000279071.1|1668342_1669656_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.3e-79
WP_001023427.1|1669657_1669927_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_000950789.1|1670103_1671084_+	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	48.6	8.0e-85
WP_032361506.1|1671163_1671439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938120.1|1671501_1672863_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.4	4.7e-51
WP_000799400.1|1673226_1674090_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1674073_1675210_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359460.1|1675459_1676689_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1676834_1677956_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085261.1|1678204_1679434_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.6	2.3e-134
WP_000953273.1|1679797_1679986_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.2e-13
WP_000022147.1|1680603_1680783_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	56.9	4.4e-10
WP_048818849.1|1680912_1681110_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001230912.1|1681102_1681564_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076669.1|1681560_1681791_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	47.4	5.0e-06
WP_000336144.1|1681780_1682011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549007.1|1682003_1682231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770154.1|1682236_1682536_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024184495.1|1684167_1684419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|1684415_1684826_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233308.1|1684836_1685109_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137345.1|1685396_1686554_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
1685327:1685347	attR	TTTCCTTATGAAAAACGGTTG	NA	NA	NA	NA
WP_165899073.1|1686593_1687154_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.4	9.6e-59
WP_000267608.1|1687166_1688378_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020673.1|1688374_1688713_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	2.5e-30
WP_000134113.1|1688709_1689006_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|1689005_1689446_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174067.1|1689429_1689612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1689735_1690092_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127875.1|1690075_1691737_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	1.7e-276
WP_000133425.1|1691750_1692032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1692888_1694349_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265473.1|1694348_1695020_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1695187_1696558_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1696561_1697203_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1697238_1698345_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2003357	2192292	5249232	transposase,portal,tail,protease,terminase	Enterobacteria_phage(32.43%)	167	NA	NA
WP_000420786.1|2003357_2004494_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000960010.1|2004523_2004976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071524591.1|2005193_2005436_+	DUF3969 family protein	NA	NA	NA	NA	NA
WP_001077737.1|2010017_2010395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420784.1|2010863_2012000_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001120139.1|2012099_2012327_+	tautomerase PptA	NA	NA	NA	NA	NA
WP_000085912.1|2012330_2012900_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000187896.1|2013072_2013918_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000804407.1|2014013_2014907_-	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000617115.1|2014985_2015666_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001166353.1|2015662_2016358_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702547.1|2016357_2017902_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
WP_000040452.1|2017898_2021639_-	nitrate reductase Z subunit alpha	NA	NA	NA	NA	NA
WP_001207919.1|2021720_2023109_-	nitrate/nitrite transporter NarU	NA	NA	NA	NA	NA
WP_000627113.1|2023432_2024764_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001295648.1|2024787_2025078_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
WP_000198214.1|2025336_2026218_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_012817776.1|2026449_2029497_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240582.1|2029509_2030394_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000045648.1|2030386_2031040_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_000781370.1|2031090_2031375_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642402.1|2031520_2032531_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	1.2e-24
WP_000433464.1|2032664_2034362_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000841554.1|2034518_2034656_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495766.1|2034757_2034973_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000152305.1|2035318_2035750_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285539.1|2035805_2036732_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193558.1|2036724_2037711_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	8.5e-18
WP_000979613.1|2037707_2038604_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000145123.1|2038600_2039623_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000830515.1|2039624_2041175_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001285823.1|2041188_2041770_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_024184401.1|2042027_2044427_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426277.1|2044451_2045834_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_000350395.1|2046210_2047530_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246019.1|2047660_2049196_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358930.1|2049351_2050752_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_072128011.1|2051113_2053909_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_000832445.1|2053953_2056326_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001296749.1|2056363_2058049_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
WP_120795387.1|2058251_2058374_+	protein YneP	NA	NA	NA	NA	NA
WP_001295683.1|2058339_2059497_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_001295684.1|2059548_2061231_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_000060498.1|2061632_2062394_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543389.1|2062467_2062665_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726674.1|2062912_2065192_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000520672.1|2065525_2066440_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|2066498_2067002_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|2067014_2067545_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001569862.1|2067558_2070210_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|2070251_2070962_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|2071322_2071886_-	fimbrial protein	NA	NA	NA	NA	NA
WP_085961169.1|2073141_2074252_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.3	5.4e-05
WP_000013397.1|2074570_2075170_+	protein kinase	NA	A0A2I2L647	Orpheovirus	27.5	4.4e-09
WP_001282176.1|2075598_2077161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|2079948_2081161_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_085961168.1|2081685_2082847_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	6.8e-51
WP_000526113.1|2083016_2083475_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_164474067.1|2086132_2087345_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	6.5e-169
WP_001125460.1|2087873_2089196_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|2089195_2089462_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000168144.1|2089670_2091221_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	48.8	2.4e-104
WP_071779435.1|2091181_2095090_-	autotransporter barrel domain-containing lipoprotein	NA	NA	NA	NA	NA
WP_000113128.1|2095620_2097213_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154340.1|2097291_2098245_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194882.1|2098493_2100029_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000911171.1|2100022_2101051_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|2101050_2102043_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000774189.1|2103102_2103978_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558520.1|2104001_2104292_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286554.1|2104348_2105107_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000637082.1|2105110_2106025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854624.1|2106231_2107683_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558044.1|2107909_2109328_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|2109466_2109826_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2109825_2110752_-	glutaminase B	NA	NA	NA	NA	NA
WP_001299378.1|2110815_2112204_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366463.1|2112304_2113186_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258555.1|2113263_2114379_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|2114528_2115719_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|2115743_2116409_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|2116620_2117055_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2117074_2117458_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|2117489_2117708_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012621.1|2117764_2119204_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	4.1e-29
WP_001022772.1|2119228_2120902_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|2120957_2121269_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000523802.1|2121296_2122619_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|2122733_2123045_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|2123243_2123942_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|2123986_2124886_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054162.1|2125080_2126268_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2126394_2126490_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592826.1|2126708_2127599_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000671731.1|2127853_2128246_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024561.1|2128521_2129040_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001299399.1|2129084_2131130_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|2131266_2132013_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2132101_2132788_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|2132965_2133169_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527753.1|2133204_2134665_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_000347482.1|2134753_2136037_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2136640_2136754_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2136822_2137056_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2137372_2137963_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2138059_2138635_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279077.1|2138634_2141595_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.2	9.6e-57
WP_001230288.1|2141659_2142259_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	5.7e-110
WP_000515310.1|2142328_2145742_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
WP_000090847.1|2145802_2146405_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_000946204.1|2146341_2147013_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-131
WP_000839179.1|2147075_2147480_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2147476_2147824_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099198.1|2147872_2149411_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	3.7e-294
WP_001152402.1|2149552_2150251_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.1e-134
WP_000447246.1|2150260_2150590_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	2.5e-59
WP_000372060.1|2150589_2153655_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	96.8	0.0e+00
WP_001161009.1|2153626_2153956_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001299384.1|2153964_2154351_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	4.7e-65
WP_000211114.1|2154411_2155155_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_001079419.1|2155165_2155567_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677102.1|2155563_2156142_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|2156153_2156429_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097039.1|2156421_2156745_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_085961166.1|2156831_2158859_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_000985929.1|2158803_2160312_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|2160311_2160524_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|2160520_2162620_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421823.1|2162628_2163168_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_001031431.1|2163728_2163935_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035576.1|2164235_2164667_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_001019139.1|2164818_2164992_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2165163_2165319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2165398_2165464_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2165466_2165655_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2165665_2165878_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_165899066.1|2166468_2167681_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	1.2e-167
WP_016236744.1|2168006_2169620_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	8.8e-182
WP_000624722.1|2169650_2170001_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2169997_2170423_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001326990.1|2170695_2171001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2171025_2171265_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2171264_2171552_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2171623_2171779_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2171995_2172247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2172313_2172592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2172593_2173643_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047137.1|2173656_2174409_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	6.2e-130
WP_120795389.1|2174686_2174776_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2174830_2175043_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2175343_2175559_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_165899066.1|2176164_2177378_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	1.2e-167
WP_048818664.1|2177450_2177594_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048323.1|2177687_2180159_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2180231_2180483_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000381395.1|2181719_2183291_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624629.1|2183310_2183658_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_001299364.1|2183657_2184335_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001360138.1|2184524_2184635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836059.1|2184692_2185712_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2185723_2186938_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2187143_2187470_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2187604_2187946_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2187980_2188541_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2188543_2189254_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001299371.1|2189361_2189667_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041553.1|2189865_2192292_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	4.5e-214
>prophage 9
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2203756	2263745	5249232	portal,capsid,head,tRNA,protease,terminase,integrase	uncultured_Caudovirales_phage(71.43%)	59	2209340:2209355	2231742:2231757
WP_001260855.1|2203756_2204578_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|2204616_2204946_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|2204932_2205298_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118255.1|2205709_2205874_+	membrane protein	NA	NA	NA	NA	NA
WP_000133423.1|2206572_2206854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560954.1|2206867_2208529_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000113645.1|2208512_2208869_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|2209156_2209597_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
2209340:2209355	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134114.1|2209596_2209893_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001020674.1|2209889_2210228_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000267608.1|2210224_2211436_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504054.1|2211437_2212010_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_021548062.1|2212049_2213207_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	4.8e-137
WP_000233302.1|2213494_2213767_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126690.1|2213777_2214188_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198853.1|2214184_2214436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710166.1|2214806_2216930_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.8	1.2e-173
WP_001261503.1|2216926_2217226_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000543812.1|2217232_2217553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165899074.1|2217545_2218712_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953271.1|2218769_2218958_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085275.1|2219332_2220562_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	4.6e-130
WP_000014040.1|2221668_2223057_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001295398.1|2223067_2224600_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769314.1|2225123_2226068_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000412379.1|2226253_2227636_+	amino acid permease	NA	NA	NA	NA	NA
WP_000513682.1|2227672_2228395_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000524868.1|2228391_2228727_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001092508.1|2228855_2229575_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000732497.1|2229578_2230880_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
WP_000135186.1|2230955_2231885_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
2231742:2231757	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_001099108.1|2231881_2233285_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066628.1|2233427_2235074_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170683.1|2235272_2236448_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001043342.1|2236548_2238057_+	YdgA family protein	NA	NA	NA	NA	NA
WP_001227023.1|2238101_2239367_-	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001075858.1|2239405_2240779_-	glucuronide transporter	NA	NA	NA	NA	NA
WP_000945878.1|2240775_2242587_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
WP_000969095.1|2242975_2243566_-	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000483362.1|2243794_2244562_-	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000179497.1|2244673_2245702_-	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000125593.1|2245876_2247469_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000459406.1|2247478_2248651_+	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000567490.1|2248754_2249756_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001282516.1|2249790_2250831_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001300888.1|2251073_2251199_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217950.1|2251471_2251687_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214176.1|2251772_2252213_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133193.1|2252289_2252871_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000991805.1|2252870_2253449_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915763.1|2253441_2255664_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231922.1|2255664_2256723_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920805.1|2256726_2257347_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289657.1|2257350_2258046_+	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_001030348.1|2258045_2258681_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100931.1|2259291_2260794_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765749.1|2260899_2261505_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000789759.1|2261548_2262409_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_001295400.1|2262470_2263745_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 10
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2337287	2354444	5249232	transposase,plate,tail	Enterobacteria_phage(80.0%)	20	NA	NA
WP_000029466.1|2337287_2338037_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|2338036_2338588_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|2338650_2339631_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000997174.1|2339839_2340169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048818678.1|2340276_2340609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961173.1|2340659_2341873_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.1e-99
WP_001271436.1|2341919_2342081_+	hypothetical protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.9e-21
WP_001111960.1|2342084_2342981_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_000071720.1|2342973_2343504_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108498.1|2343506_2345333_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	1.3e-109
WP_000631340.1|2345329_2346232_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	68.1	1.4e-96
WP_001299562.1|2346240_2346819_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954197.1|2346862_2347435_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979955.1|2347591_2348080_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000853408.1|2348092_2350900_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.2	0.0e+00
WP_000333503.1|2350886_2351042_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651570.1|2351050_2351425_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	5.8e-36
WP_000290444.1|2351480_2351993_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.6	3.0e-91
WP_000005398.1|2351992_2353177_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	1.8e-224
WP_000132832.1|2353334_2354444_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.2e-195
>prophage 11
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2611688	2663053	5249232	transposase,tail,capsid,head,terminase,holin,integrase	Enterobacteria_phage(33.33%)	59	2648984:2649000	2681236:2681252
WP_001023421.1|2611688_2611958_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	2.4e-44
WP_000279031.1|2611959_2613273_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	97.3	1.7e-77
WP_001230428.1|2613337_2613937_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000514855.1|2614004_2617478_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.2	0.0e+00
WP_162776133.1|2617712_2618345_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	6.5e-104
WP_001299874.1|2618290_2619034_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	2.3e-148
WP_001299882.1|2619039_2619738_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000807964.1|2619737_2620079_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212973.1|2620071_2623314_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_165899086.1|2623361_2623571_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.7e-32
WP_000710949.1|2623666_2624041_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275440.1|2624055_2624772_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	2.0e-125
WP_000133388.1|2624838_2625183_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2625179_2625626_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2625622_2625973_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2625982_2626309_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2628672_2628894_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173085.1|2628938_2630876_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.6	0.0e+00
WP_000958399.1|2632597_2633161_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.8	2.6e-88
WP_000279786.1|2633450_2633816_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001299919.1|2633857_2634043_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.9e-19
WP_000347013.1|2634172_2634313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2634669_2634894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2634958_2635165_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2635392_2635539_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2635538_2636108_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|2636378_2636912_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|2636962_2637307_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2637311_2637527_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_165899076.1|2637677_2639531_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.3	0.0e+00
WP_001443281.1|2639830_2640157_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000935532.1|2640750_2641827_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.4	1.0e-181
WP_000917767.1|2641977_2642175_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640045.1|2642399_2642951_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.6	3.2e-67
WP_000904364.1|2642959_2643319_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	5.6e-36
WP_001299934.1|2643331_2644381_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_001447823.1|2644382_2644655_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	9.4e-12
WP_001012717.1|2644825_2645704_-	type II restriction endonuclease NgoMIV	NA	NA	NA	NA	NA
WP_024184491.1|2645717_2646836_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	1.3e-35
WP_000150294.1|2647020_2647686_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151228.1|2647860_2648286_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.3	2.7e-61
WP_052909947.1|2648301_2649072_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	8.2e-77
2648984:2649000	attL	GCCTCTTCACGACTGAT	NA	NA	NA	NA
WP_000788943.1|2649093_2649840_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_001262346.1|2649846_2650917_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	69.1	3.1e-66
WP_000693834.1|2650988_2651414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391950.1|2651397_2651679_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362155.1|2651779_2652199_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|2652464_2652620_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2652779_2652998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|2653001_2653166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165899066.1|2653305_2654518_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	1.2e-167
WP_000854559.1|2654878_2655067_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083296.1|2655063_2655225_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_165899077.1|2655348_2657820_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	1.2e-52
WP_164474067.1|2657825_2659038_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	6.5e-169
WP_000067202.1|2659191_2659395_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|2659394_2660420_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001300801.1|2660655_2661453_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480163.1|2661790_2663053_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
2681236:2681252	attR	GCCTCTTCACGACTGAT	NA	NA	NA	NA
>prophage 12
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2721906	2726781	5249232	transposase	Stx2-converting_phage(100.0%)	6	NA	NA
WP_000998071.1|2721906_2723445_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	8.4e-299
WP_000612599.1|2723494_2723842_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_072128014.1|2723838_2724123_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.9	2.3e-45
WP_000381395.1|2724165_2725737_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624629.1|2725756_2726104_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_001299364.1|2726103_2726781_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 13
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2733378	2739994	5249232	transposase	Stx2-converting_phage(33.33%)	11	NA	NA
WP_001234716.1|2733378_2734197_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	8.0e-46
WP_000844095.1|2734278_2734758_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186770.1|2734773_2735250_+	RadC family protein	NA	NA	NA	NA	NA
WP_000584198.1|2735318_2735540_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	47.8	1.2e-09
WP_024184487.1|2735702_2736071_+	antitoxin	NA	NA	NA	NA	NA
WP_000854757.1|2736160_2736538_+	toxin	NA	NA	NA	NA	NA
WP_000761705.1|2736534_2736738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140621.1|2736750_2736864_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000422741.1|2737577_2738003_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2737999_2738350_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_016236744.1|2738380_2739994_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	8.8e-182
>prophage 14
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	2821040	2926498	5249232	transposase,tail,capsid,head,tRNA,protease,terminase,holin,integrase	Enterobacteria_phage(32.53%)	114	2869273:2869293	2924013:2924033
WP_000476011.1|2821040_2822402_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|2822732_2823050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2823455_2824355_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2824436_2825216_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844217.1|2825315_2826356_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2826403_2827759_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|2827762_2828047_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182914.1|2828077_2828530_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000645447.1|2828539_2829802_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001299608.1|2829830_2830685_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129563.1|2830994_2832047_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2832303_2833581_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2833577_2834582_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2834578_2835544_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2835517_2836264_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|2836315_2837134_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2837198_2837999_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2837995_2838784_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2839006_2839279_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2839398_2840223_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|2840441_2840780_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405687.1|2840861_2841896_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945351.1|2841911_2844392_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024184427.1|2844407_2845082_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2845161_2845704_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001307891.1|2845996_2846278_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005444.1|2846540_2847650_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2847781_2849815_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001215575.1|2849955_2853750_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356758.1|2853759_2857392_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|2857452_2857773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184428.1|2858955_2860044_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001292748.1|2862325_2863462_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001299605.1|2863458_2865459_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2865583_2866045_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2866085_2866556_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2866602_2867322_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2867318_2869004_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2869273:2869293	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261971.1|2869518_2869767_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_024184430.1|2869971_2871180_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.5	1.0e-230
WP_001025674.1|2871831_2873073_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	91.3	1.4e-230
WP_001023421.1|2874065_2874335_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	2.4e-44
WP_000279031.1|2874336_2875650_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	97.3	1.7e-77
WP_001230428.1|2875714_2876314_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000514855.1|2876381_2879855_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.2	0.0e+00
WP_064760920.1|2880089_2880722_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	8.4e-104
WP_024184470.1|2880667_2881411_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	2.9e-148
WP_001299791.1|2881416_2882115_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000807924.1|2882114_2882456_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_000212856.1|2882448_2885691_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.8	0.0e+00
WP_001513217.1|2885738_2885948_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030043.1|2886043_2886418_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275475.1|2886423_2887140_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	5.6e-128
WP_000133388.1|2887206_2887551_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2887547_2887994_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2887990_2888341_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2888350_2888677_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063111.1|2891203_2891425_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	90.4	1.5e-31
WP_000173075.1|2891469_2893407_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.9	0.0e+00
WP_001299789.1|2893470_2895132_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958360.1|2895128_2895692_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_000829192.1|2895981_2896347_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2896388_2896589_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828072.1|2896720_2897047_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000736380.1|2897391_2897616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2897701_2897887_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|2898109_2898241_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_165899079.1|2898335_2899031_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.3	1.1e-123
WP_032263679.1|2899304_2899838_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	2.5e-101
WP_000731235.1|2899888_2900233_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	5.0e-58
WP_024164617.1|2900237_2900453_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_165899080.1|2900738_2902589_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	93.3	0.0e+00
WP_001299793.1|2903075_2903504_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.6	5.4e-62
WP_000512807.1|2904145_2904634_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2904624_2905296_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108008.1|2905292_2905898_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	98.5	1.8e-95
WP_001004026.1|2905897_2906620_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	99.2	6.6e-129
WP_000290548.1|2906694_2907372_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	99.6	1.3e-129
WP_001254214.1|2907647_2907830_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.3	2.2e-28
WP_000153279.1|2907826_2908354_-	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	100.0	1.2e-100
WP_001484314.1|2908350_2908797_-	recombination protein NinB	NA	H6WZI6	Escherichia_phage	100.0	3.2e-81
WP_001484315.1|2908753_2908990_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	98.7	6.0e-39
WP_052910014.1|2909000_2909216_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	98.6	2.9e-32
WP_001000124.1|2909348_2909627_-	hypothetical protein	NA	H6WZI5	Escherichia_phage	98.9	2.9e-48
WP_000145935.1|2909697_2909988_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788818.1|2909984_2910686_-	Replication protein P	NA	H6WZI3	Escherichia_phage	99.1	3.8e-129
WP_000035950.1|2911586_2911883_-	Regulatory protein CII from phage origin	NA	Q9EYB4	Enterobacteria_phage	98.0	3.4e-47
WP_001033078.1|2912000_2912219_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001299796.1|2912327_2912975_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001280993.1|2913097_2913379_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_000990548.1|2913385_2913937_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_000256574.1|2914449_2914722_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_001066169.1|2914738_2915320_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065377.1|2915580_2915949_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198866.1|2916020_2916161_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000361829.1|2916153_2916297_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	3.5e-18
WP_000995422.1|2916370_2916667_+	host-nuclease inhibitor protein Gam	NA	A0A1U9AJD6	Stx1_converting_phage	100.0	2.1e-49
WP_165899081.1|2916672_2917458_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186755.1|2917454_2918135_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.0e-131
WP_000682316.1|2918131_2918314_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|2918286_2918478_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|2918488_2918770_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|2918868_2919090_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_165899082.1|2919086_2919857_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	99.2	3.6e-141
WP_001014291.1|2919858_2920050_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_000208052.1|2920052_2920601_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	67.6	4.5e-61
WP_165899066.1|2920971_2922185_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	1.2e-167
WP_000556584.1|2922247_2922382_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	9.3e-21
WP_001193440.1|2922400_2922655_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	98.8	6.7e-44
WP_000063645.1|2922688_2923975_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.8	2.9e-252
WP_048818757.1|2924010_2924688_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.8	1.3e-99
2924013:2924033	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2924747_2924855_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2924835_2925567_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|2925571_2926498_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 15
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	3127683	3174325	5249232	capsid,portal,tRNA,head,tail,plate,terminase,integrase	Enterobacteria_phage(80.95%)	53	3123845:3123868	3170874:3170897
3123845:3123868	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_001283578.1|3127683_3128496_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3128495_3129509_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|3129574_3130732_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_000023397.1|3130890_3131895_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.4	2.9e-98
WP_000581442.1|3131991_3132312_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	46.2	9.1e-14
WP_000004248.1|3132427_3132715_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000203254.1|3132721_3132928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|3133180_3133522_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000158971.1|3133532_3133820_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|3133831_3134074_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|3134070_3134184_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|3134269_3134473_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153677.1|3134469_3134715_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	97.5	4.8e-39
WP_001274220.1|3134711_3135011_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
WP_001326016.1|3135022_3135640_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_000599382.1|3135636_3136002_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123446.1|3136008_3138834_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.5	0.0e+00
WP_000165750.1|3139019_3139865_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	26.6	2.8e-09
WP_000588792.1|3139882_3141580_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000087812.1|3142270_3143317_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613769.1|3143316_3145068_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.3	0.0e+00
WP_001262673.1|3145222_3146059_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|3146081_3147134_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632339.1|3147179_3147980_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	4.9e-125
WP_000063082.1|3148082_3148577_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864897.1|3148576_3148777_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000072328.1|3149098_3149491_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000780541.1|3149487_3149895_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	5.5e-64
WP_000920586.1|3150032_3150500_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000356346.1|3150492_3151128_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.4e-114
WP_001271886.1|3151124_3151706_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.9e-102
WP_000213447.1|3151702_3152053_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111924.1|3152056_3152953_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	3.5e-156
WP_000071739.1|3152945_3153476_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001164111.1|3155775_3156303_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	100.0	2.7e-95
WP_000972135.1|3156331_3156865_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	9.3e-96
WP_000905060.1|3157892_3158480_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	100.0	2.4e-105
WP_000979954.1|3158515_3159004_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853456.1|3159016_3161824_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.5	0.0e+00
WP_000333503.1|3161810_3161966_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|3161974_3162349_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|3162404_3162917_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005386.1|3162916_3164101_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000132855.1|3164258_3165368_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000604994.1|3165490_3166276_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|3166471_3166732_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032140709.1|3166923_3167064_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_001353016.1|3167313_3167511_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215754.1|3167455_3168247_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.6	5.1e-66
WP_000615813.1|3168476_3169472_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|3169468_3170647_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3170939_3172160_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
3170874:3170897	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000683808.1|3172318_3174325_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	3422362	3514204	5249232	transposase,lysis,tail,capsid,head,tRNA,terminase,holin	Enterobacteria_phage(33.33%)	92	NA	NA
WP_001298974.1|3422362_3423100_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219198.1|3423231_3424566_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	3.8e-45
WP_000365855.1|3424774_3425656_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3425758_3426346_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3426401_3426785_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262703.1|3427089_3427779_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.7e-55
WP_000997403.1|3427826_3428864_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3429070_3429490_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3429558_3430257_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082969.1|3430288_3432949_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949261.1|3433062_3434418_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3434442_3434787_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3434783_3436082_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3441938_3444512_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3444641_3445373_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3445369_3446350_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3446484_3447222_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3447492_3447834_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3447937_3447985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3448083_3449244_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3449286_3450408_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3450418_3451489_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3451698_3452064_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3452213_3452732_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969042.1|3452721_3453948_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000065253.1|3454520_3454868_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3454909_3455677_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3455707_3456256_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3456274_3456523_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3456659_3458021_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3458112_3458979_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077628106.1|3458999_3460286_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3460340_3460934_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059168.1|3461056_3461935_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3462020_3463682_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3463830_3464172_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3464233_3464524_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3464513_3464990_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162570.1|3465121_3465604_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	4.4e-28
WP_001217542.1|3466452_3466701_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132153.1|3467202_3467793_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_165899083.1|3467975_3468626_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	36.6	4.0e-24
WP_001299878.1|3468704_3469763_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3469894_3470317_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023417.1|3470477_3470747_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279090.1|3470748_3472062_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.5e-81
WP_001216293.1|3472126_3472750_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_115197881.1|3472818_3476295_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_000649829.1|3476428_3476956_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_165899087.1|3477146_3477779_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	4.9e-104
WP_001299874.1|3477724_3478468_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	2.3e-148
WP_001152200.1|3478478_3479177_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.2e-131
WP_000807964.1|3479176_3479518_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212973.1|3479510_3482753_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_165899086.1|3482800_3483010_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.7e-32
WP_000710949.1|3483105_3483480_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275440.1|3483494_3484211_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	2.0e-125
WP_000133388.1|3484277_3484622_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3484618_3485065_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3485061_3485412_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3485421_3485748_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|3488112_3488334_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173085.1|3488378_3490316_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.6	0.0e+00
WP_000958399.1|3492037_3492601_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.8	2.6e-88
WP_000279787.1|3492890_3493256_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	1.2e-65
WP_000095736.1|3493297_3493525_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|3493893_3494118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082547.1|3494114_3494609_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_000992120.1|3494906_3495440_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.1e-99
WP_000731228.1|3495490_3495835_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_024164617.1|3495839_3496055_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_165899084.1|3496494_3498345_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001258397.1|3499887_3500745_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000844628.1|3500744_3501713_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.7	1.9e-187
WP_000424041.1|3501714_3503373_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	96.0	0.0e+00
WP_000680719.1|3504057_3504345_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	51.4	2.6e-12
WP_000144248.1|3504464_3505157_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	47.2	1.3e-49
WP_000100523.1|3505301_3505712_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	64.2	4.6e-34
WP_000781553.1|3505713_3505905_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	98.4	1.7e-28
WP_000856704.1|3505901_3506093_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	92.1	1.6e-26
WP_000148631.1|3506277_3506637_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	77.3	8.0e-43
WP_000002323.1|3506636_3506852_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	62.0	5.0e-16
WP_160392285.1|3506919_3507042_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	82.5	1.6e-11
WP_000566778.1|3507038_3507431_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	55.6	1.7e-33
WP_000734576.1|3507676_3508504_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.8	9.0e-130
WP_001028555.1|3508547_3509297_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	83.1	6.0e-117
WP_165899066.1|3510076_3511290_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	1.2e-167
WP_000237181.1|3511352_3511541_+	hypothetical protein	NA	Q6H9Z8	Enterobacteria_phage	82.3	1.3e-20
WP_001030146.1|3511544_3511691_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	4.9e-23
WP_000516614.1|3511863_3513042_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	88.7	1.9e-202
WP_000035091.1|3513083_3513851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261060.1|3513862_3514204_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	33.6	2.1e-08
>prophage 17
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	3594049	3601189	5249232		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3594049_3596611_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3596716_3597373_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3597423_3598191_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847957.1|3598386_3599295_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	8.6e-118
WP_000590409.1|3599291_3600554_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_001278994.1|3600550_3601189_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 18
NZ_CP035751	Escherichia coli E110019 chromosome, complete genome	5249232	4699012	4707200	5249232	transposase	Stx2-converting_phage(85.71%)	9	NA	NA
WP_001299598.1|4699012_4700350_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
WP_000078043.1|4700516_4701182_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000116772.1|4701248_4701722_+	protein CbrB	NA	NA	NA	NA	NA
WP_000099198.1|4702106_4703645_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	3.7e-294
WP_000612626.1|4703693_4704041_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4704037_4704442_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001299364.1|4704584_4705262_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624629.1|4705261_4705609_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_000381395.1|4705628_4707200_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 1
NZ_CP035753	Escherichia coli E110019 plasmid pE110019_65, complete sequence	65378	46514	52568	65378	transposase,integrase	Stx2-converting_phage(50.0%)	6	44903:44962	61169:61235
44903:44962	attL	ACGGAAGCCGCAGGATATCGCTGTCTGACCTGCGATTTTTCATGCCGTCCCTGACCGCAG	NA	NA	NA	NA
WP_165899070.1|46514_48053_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	2.4e-293
WP_000612626.1|48101_48449_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_077136941.1|48445_48730_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.9	5.2e-45
WP_164474067.1|48805_50019_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	6.5e-169
WP_000361612.1|50565_51543_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066950.1|51827_52568_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
61169:61235	attR	CTGCGGTCAGGGACGGCATGAAAAATCGCAGGTCAGACAGCGATATCCTGCGGCTTCCGTCTCCGCC	NA	NA	NA	NA
>prophage 1
NZ_CP035752	Escherichia coli E110019 plasmid pE110019_66, complete sequence	66171	0	8009	66171		Xanthomonas_phage(33.33%)	11	NA	NA
WP_001486786.1|936_1131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290791.1|1358_1898_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.8	6.8e-46
WP_000005990.1|1960_2194_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117175.1|2259_4218_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	2.3e-19
WP_000845934.1|4272_4707_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|4703_5423_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|5702_5861_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_162817365.1|6214_6427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141200.1|6361_6550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|6782_7070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|7187_8009_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
>prophage 2
NZ_CP035752	Escherichia coli E110019 plasmid pE110019_66, complete sequence	66171	15953	16175	66171		Vibrio_virus(100.0%)	1	NA	NA
WP_001278692.1|15953_16175_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
>prophage 3
NZ_CP035752	Escherichia coli E110019 plasmid pE110019_66, complete sequence	66171	38917	41332	66171		Xanthomonas_phage(50.0%)	4	NA	NA
WP_000205704.1|38917_39661_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.1e-09
WP_024184455.1|39715_40276_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|40411_40624_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978818.1|40870_41332_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	1.2e-19
>prophage 4
NZ_CP035752	Escherichia coli E110019 plasmid pE110019_66, complete sequence	66171	47071	47776	66171	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067859.1|47071_47776_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.7	8.4e-137
>prophage 5
NZ_CP035752	Escherichia coli E110019 plasmid pE110019_66, complete sequence	66171	58211	60376	66171		Escherichia_phage(50.0%)	3	NA	NA
WP_000959874.1|58211_59174_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	2.4e-94
WP_032146011.1|59322_59616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085886.1|59692_60376_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	9.6e-29
>prophage 1
NZ_CP035755	Escherichia coli E110019 extrachromosomal	25421	1225	19244	25421	plate,tail,holin,capsid,head	Enterobacteria_phage(95.45%)	22	NA	NA
WP_001055118.1|1225_2278_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000063082.1|3225_3720_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864897.1|3719_3920_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|3922_4246_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072328.1|4242_4635_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_115194622.1|4631_5189_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	1.3e-63
WP_000920586.1|5175_5643_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000356346.1|5635_6271_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.4e-114
WP_001271886.1|6267_6849_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.9e-102
WP_000213447.1|6845_7196_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111924.1|7199_8096_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	3.5e-156
WP_000071739.1|8088_8619_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001560644.1|8621_10856_+|tail	phage tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	63.4	5.8e-216
WP_000972135.1|10858_11392_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	9.3e-96
WP_001164111.1|11420_11948_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	100.0	2.7e-95
WP_001372409.1|11951_12932_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	99.7	4.4e-192
WP_000905060.1|13036_13624_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	100.0	2.4e-105
WP_000979954.1|13659_14148_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853456.1|14160_16968_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.5	0.0e+00
WP_000333503.1|16954_17110_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|17118_17493_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000005386.1|18059_19244_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
