The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	30813	68937	2613117	transposase,integrase,tRNA	Bacillus_phage(40.0%)	30	24925:24941	59969:59985
24925:24941	attL	TTAGATTTGACGTAACA	NA	NA	NA	NA
WP_013404629.1|30813_32082_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.6	2.9e-95
WP_013404630.1|32338_32989_+	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_013404631.1|33021_34044_+	sugar kinase	NA	NA	NA	NA	NA
WP_013404632.1|34168_35128_+	sugar kinase	NA	NA	NA	NA	NA
WP_041595848.1|35302_37684_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A7XXH5	Thermus_virus	39.4	4.3e-116
WP_013404634.1|37762_38050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013404635.1|38470_39424_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	33.3	2.0e-32
WP_013404636.1|39848_40085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013404637.1|40153_41296_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	40.5	4.5e-63
WP_013404638.1|41354_41606_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013404639.1|41782_44713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160143031.1|46182_46353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404640.1|46526_47444_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013404641.1|47570_48092_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013404642.1|48266_48812_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	49.7	1.1e-40
WP_013404643.1|48887_50690_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	1.0e-29
WP_013404644.1|50936_52238_+	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_013404645.1|52242_53376_+	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_013404646.1|53375_54101_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_013404647.1|54105_55239_+	phosphonoacetaldehyde reductase	NA	NA	NA	NA	NA
WP_187323464.1|55333_56272_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041595728.1|56259_56547_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013404649.1|56706_58026_+	CDP-glycerol--poly(glycerophosphate) glycerophosphotransferase	NA	NA	NA	NA	NA
WP_013404650.1|59913_61194_+	glycosyltransferase	NA	NA	NA	NA	NA
59969:59985	attR	TTAGATTTGACGTAACA	NA	NA	NA	NA
WP_041595729.1|61439_61739_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013404651.1|62904_63777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083789325.1|64200_64569_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	51.8	8.6e-24
WP_095522090.1|64691_65805_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.7	5.2e-80
WP_013404654.1|65861_66905_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.4	1.6e-51
WP_095522091.1|67766_68937_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.7e-63
>prophage 2
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	79028	124735	2613117	transposase,tRNA,integrase	uncultured_virus(28.57%)	46	80049:80067	118833:118851
WP_013404666.1|79028_79694_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	3.7e-09
80049:80067	attL	TAAATTAAGCGTATTATGA	NA	NA	NA	NA
WP_013404667.1|80164_81019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404668.1|81278_81479_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013404669.1|81544_82003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404670.1|82276_85405_+	DNA primase catalytic core domain	NA	NA	NA	NA	NA
WP_013404671.1|85452_85959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041595734.1|86359_86548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404673.1|86582_86930_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_013404674.1|86994_87339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404675.1|87355_87922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404676.1|87949_88510_+	host-nuclease inhibitor Gam family protein	NA	NA	NA	NA	NA
WP_013404677.1|88568_89420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404678.1|89420_90272_+	phage recombination protein Bet	NA	NA	NA	NA	NA
WP_013404679.1|90317_90482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404680.1|90474_90924_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_049773784.1|91515_91728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049773786.1|91935_92268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404681.1|92400_93282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160143032.1|93559_93796_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013404682.1|94207_94900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404683.1|95284_96478_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	3.4e-29
WP_013404684.1|96623_97865_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_013404685.1|97889_99569_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_013404686.1|99730_101167_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_160143033.1|101566_102145_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_083789271.1|102259_102655_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013404687.1|102830_104336_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	23.7	1.7e-09
WP_013404688.1|104474_106172_-	solute:sodium symporter family transporter	NA	A0A219Y9P9	Aeromonas_phage	30.3	4.8e-45
WP_013404689.1|106467_107640_-	ROK family protein	NA	NA	NA	NA	NA
WP_013404690.1|108015_109008_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_049773793.1|109189_109672_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	41.8	5.4e-26
WP_083789326.1|109823_111059_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_013404692.1|111348_111699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404693.1|111788_112526_+	YaaA family protein	NA	NA	NA	NA	NA
WP_013404694.1|112624_114043_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_013404695.1|114189_115371_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	3.4e-29
WP_013404696.1|115534_117253_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_013404697.1|117520_118687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013404698.1|119033_119456_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
118833:118851	attR	TAAATTAAGCGTATTATGA	NA	NA	NA	NA
WP_013404699.1|119484_120174_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_013404700.1|120301_120982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404701.1|121135_121459_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_013404704.1|121810_122038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013404705.1|122340_123702_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_013404706.1|123715_124171_+	cytidine/deoxycytidylate deaminase family protein	NA	A7KUY9	Bacillus_phage	42.1	1.5e-25
WP_013404707.1|124219_124735_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 3
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	259297	298992	2613117	transposase,integrase	Bacillus_phage(33.33%)	29	272973:272992	287133:287152
WP_083789279.1|259297_260425_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	58.0	3.5e-84
WP_013404813.1|260493_265386_+	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
WP_160143036.1|265461_266061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404815.1|266083_267514_+	type II site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_013404816.1|267640_268861_-	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	37.1	5.5e-27
WP_013404817.1|269335_269572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404818.1|270010_271084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404819.1|271070_271607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404820.1|271686_271869_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_013404821.1|272274_273327_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
272973:272992	attL	AATTGAAAATCAAGTAGAAA	NA	NA	NA	NA
WP_013404822.1|273432_274188_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.4	4.6e-40
WP_041595744.1|274202_275369_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5N3F9	Enterobacteria_phage	26.8	7.7e-10
WP_095522092.1|275442_276709_+|transposase	IS3-like element ISHahy4 family transposase	transposase	NA	NA	NA	NA
WP_049773804.1|276742_277258_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013404825.1|277636_278638_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_013404826.1|278682_279396_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_083789280.1|280948_281521_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_013404828.1|282039_284793_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	40.1	1.2e-21
WP_013404829.1|285022_286147_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_013404830.1|286211_286394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160143037.1|288086_288305_+|transposase	IS200/IS605 family transposase	transposase	A0A142F193	Bacillus_phage	50.0	1.8e-13
287133:287152	attR	TTTCTACTTGATTTTCAATT	NA	NA	NA	NA
WP_013404831.1|288626_289316_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_013404832.1|289346_290885_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_013404833.1|291042_292590_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013404834.1|292800_293571_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_041595746.1|293695_295522_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.6	1.9e-63
WP_160143084.1|295542_297339_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.4	2.2e-56
WP_160143085.1|297393_297672_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_013404838.1|297921_298992_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	41.1	1.7e-59
>prophage 4
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	396380	408816	2613117	tRNA	Streptococcus_phage(50.0%)	13	NA	NA
WP_013404917.1|396380_398189_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.7	3.0e-53
WP_013404918.1|398190_398499_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_013404919.1|398498_399098_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_013404920.1|399398_400865_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	43.2	1.8e-101
WP_013404921.1|400978_401929_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	46.1	1.7e-68
WP_013404922.1|402081_402708_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.8	1.5e-39
WP_013404923.1|402707_403067_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_013404924.1|403079_404069_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.2	7.7e-19
WP_013404925.1|404093_404900_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_041595749.1|404914_405235_+	DUF972 family protein	NA	M1PFV3	Streptococcus_phage	30.3	1.2e-05
WP_013404927.1|405239_405965_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013404928.1|405965_406826_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.7	6.0e-52
WP_013404929.1|406857_408816_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.9	4.3e-98
>prophage 5
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	644108	690684	2613117	transposase	Paenibacillus_phage(23.08%)	41	NA	NA
WP_095522093.1|644108_645235_-|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	1.7e-83
WP_083789293.1|645298_645766_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_013405117.1|646823_647534_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_013405118.1|647534_648506_-	flagellin	NA	NA	NA	NA	NA
WP_013405119.1|649323_650739_+	group II intron reverse transcriptase/maturase	NA	D4HTV9	Vibrio_phage	24.2	6.7e-16
WP_013405120.1|650845_651031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041595770.1|651235_651427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041595771.1|651535_651835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049773828.1|651889_652333_+	host-nuclease inhibitor Gam family protein	NA	A0A1B0XTM6	Freshwater_phage	29.2	7.4e-06
WP_013405121.1|652673_655592_+	inverse autotransporter beta-barrel domain-containing protein	NA	H9YQW5	environmental_Halophage	40.7	2.3e-15
WP_095522093.1|655728_656854_+|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	1.7e-83
WP_013405122.1|656886_657600_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_013405123.1|657583_659047_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_013405124.1|659058_660177_-	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_041595772.1|660192_660969_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_013405126.1|661095_661236_+	OmpA/MotB domain-containing protein	NA	NA	NA	NA	NA
WP_013405127.1|661393_662545_+	SEC-C domain-containing protein	NA	V5LQX0	Emiliania_huxleyi_virus	35.9	7.3e-05
WP_013405128.1|662674_663181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405129.1|663376_665302_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_013405130.1|665562_666870_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_041595921.1|666889_667885_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_013405132.1|667901_668759_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_160143048.1|668854_669946_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013405134.1|670025_671030_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013405135.1|671148_671709_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_013405136.1|671743_673030_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_013405137.1|673078_674293_+	MFS transporter	NA	NA	NA	NA	NA
WP_187323462.1|674315_675077_+	glucose 1-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	29.1	5.9e-19
WP_013405139.1|675146_676220_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_095522092.1|676623_677890_+|transposase	IS3-like element ISHahy4 family transposase	transposase	NA	NA	NA	NA
WP_041595733.1|678341_679445_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013404664.1|679461_680079_+	sugar transferase	NA	NA	NA	NA	NA
WP_013405141.1|680099_681275_+	LegC family aminotransferase	NA	E5ES46	Bathycoccus_sp._RCC1105_virus	26.0	9.7e-21
WP_095522093.1|681867_682993_+|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	1.7e-83
WP_013405142.1|683135_684173_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013405143.1|684266_685316_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.4	2.7e-54
WP_013405144.1|685500_686445_+	GDP-mannose 4,6-dehydratase	NA	A0A2K9L4U8	Tupanvirus	36.1	9.5e-43
WP_013405145.1|686487_687564_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	32.0	1.4e-37
WP_187323468.1|688161_689991_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.7	2.8e-14
WP_013405148.1|690039_690384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160143093.1|690516_690684_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	1157357	1215945	2613117	transposase	Paenibacillus_phage(16.67%)	43	NA	NA
WP_083789307.1|1157357_1158485_-|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	2.3e-83
WP_013405558.1|1158818_1159433_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013405559.1|1159521_1160568_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013405560.1|1160939_1161275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404695.1|1161503_1162685_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	3.4e-29
WP_013405561.1|1162730_1164299_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013405162.1|1164298_1165054_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.5	1.5e-35
WP_013405562.1|1165360_1166473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405563.1|1166426_1166957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405564.1|1167010_1167298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405565.1|1167360_1167537_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_013405566.1|1169730_1169961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095522094.1|1170066_1170405_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	51.1	3.8e-18
WP_095522092.1|1170462_1171729_+|transposase	IS3-like element ISHahy4 family transposase	transposase	NA	NA	NA	NA
WP_160143053.1|1171974_1172619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405568.1|1172634_1172811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405569.1|1172831_1175780_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	40.6	9.2e-68
WP_013405570.1|1175795_1179170_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_013405571.1|1179190_1182025_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	24.4	8.3e-34
WP_013405572.1|1182134_1184174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013404695.1|1184296_1185478_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	3.4e-29
WP_013405573.1|1185555_1186557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405574.1|1187719_1188346_+	DUF2225 domain-containing protein	NA	NA	NA	NA	NA
WP_013405575.1|1188403_1188703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405576.1|1189232_1191074_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.5	5.1e-16
WP_013405577.1|1191066_1191465_+	response regulator	NA	NA	NA	NA	NA
WP_013405578.1|1191454_1192150_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.0	5.2e-06
WP_013405579.1|1192150_1192549_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013405580.1|1192566_1193229_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013405581.1|1193230_1194715_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_013405582.1|1195117_1195630_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_013405583.1|1195648_1196185_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_013405584.1|1196186_1197980_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_013405585.1|1198014_1198596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013405586.1|1198898_1201544_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_160143054.1|1202751_1202928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405587.1|1203176_1203362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013405588.1|1203649_1207051_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.5	2.1e-15
WP_013405589.1|1207099_1208548_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013405590.1|1208584_1210351_+	diguanylate cyclase	NA	A0A2D0W9B6	Bordetella_phage	35.1	8.6e-05
WP_013405591.1|1210522_1211833_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_013405592.1|1211996_1214477_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095522093.1|1214819_1215945_+|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	1.7e-83
>prophage 7
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	1543257	1551676	2613117	protease,tRNA	uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_013405881.1|1543257_1543518_-	stage V sporulation protein S	NA	A0A1J0GVV0	Streptomyces_phage	40.8	3.3e-06
WP_013405882.1|1543683_1544394_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013405883.1|1544415_1545072_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	38.6	9.3e-13
WP_013405884.1|1545077_1545803_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	32.4	1.1e-09
WP_013405885.1|1545818_1546460_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013405886.1|1546486_1548133_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A0S2MWE1	Cellulophaga_phage	33.6	5.9e-16
WP_013405887.1|1548193_1549522_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013405888.1|1549543_1550848_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	57.6	2.5e-126
WP_013405889.1|1550863_1551676_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	42.6	4.0e-58
>prophage 8
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	1836307	1846177	2613117		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_013406142.1|1836307_1838455_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	6.1e-13
WP_013406143.1|1838496_1839009_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	4.2e-29
WP_013406144.1|1838998_1841416_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	8.0e-70
WP_013406145.1|1841440_1843105_-	AarF/ABC1/UbiB kinase family protein	NA	E5ERK4	Ostreococcus_lucimarinus_virus	29.7	2.4e-41
WP_013406146.1|1843198_1844059_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.6	3.3e-42
WP_013406147.1|1844064_1845273_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013406148.1|1845302_1845848_-	signal peptidase I	NA	NA	NA	NA	NA
WP_013406149.1|1845880_1846177_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.1	1.8e-11
>prophage 9
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	1946916	1956664	2613117		Planktothrix_phage(16.67%)	8	NA	NA
WP_013406243.1|1946916_1947954_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	4.7e-19
WP_160143118.1|1948038_1948611_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_013406245.1|1948643_1949621_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_013406246.1|1949643_1950474_-	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	33.1	3.5e-33
WP_013406247.1|1950466_1953109_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.6	1.5e-48
WP_013406248.1|1953144_1954524_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.1	1.7e-19
WP_013406249.1|1954516_1955206_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.0e-41
WP_013406250.1|1955521_1956664_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.6	1.6e-20
>prophage 10
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	1983252	2006179	2613117	transposase,holin,integrase	unidentified_phage(22.22%)	23	1983054:1983069	1996150:1996165
1983054:1983069	attL	ATTTTTGAATTCATTA	NA	NA	NA	NA
WP_013404750.1|1983252_1984614_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	32.9	8.7e-13
WP_013406273.1|1984945_1985149_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.9	2.2e-13
WP_013406274.1|1985475_1986741_+	NADH-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_013406275.1|1986805_1987750_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013406276.1|1987766_1988387_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013406277.1|1988390_1989053_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013406278.1|1989070_1990180_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	27.9	1.4e-13
WP_013406279.1|1990452_1990932_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.3	9.1e-42
WP_013406280.1|1991027_1991981_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	34.9	1.2e-40
WP_013406281.1|1992006_1992330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013406282.1|1992354_1992933_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013406283.1|1993274_1994495_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_083789336.1|1994969_1995245_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_095522093.1|1995308_1996434_+|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	1.7e-83
1996150:1996165	attR	TAATGAATTCAAAAAT	NA	NA	NA	NA
WP_013406284.1|1996505_1998128_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_013405143.1|1998334_1999384_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.4	2.7e-54
WP_013406285.1|1999615_1999807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013406286.1|1999877_2000135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013404838.1|2000517_2001588_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	41.1	1.7e-59
WP_013406287.1|2001711_2002851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013406288.1|2002985_2004410_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013406289.1|2004569_2004815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013404695.1|2004997_2006179_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	3.4e-29
>prophage 11
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	2466319	2473810	2613117		Synechococcus_phage(42.86%)	7	NA	NA
WP_013406719.1|2466319_2467897_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	44.8	1.9e-64
WP_013406720.1|2467898_2468513_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	42.5	4.3e-28
WP_013406721.1|2468517_2469582_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	45.0	3.1e-66
WP_013406722.1|2469581_2471093_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.8	6.4e-57
WP_013406723.1|2471149_2471869_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	39.7	2.1e-42
WP_013406724.1|2471898_2473290_-	adenylosuccinate lyase	NA	A0A1B1ISB0	uncultured_Mediterranean_phage	27.3	9.1e-26
WP_013406725.1|2473279_2473810_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	50.7	1.2e-26
>prophage 12
NC_014654	Halanaerobium hydrogeniformans, complete sequence	2613117	2541704	2568775	2613117	transposase,holin,integrase	Clostridioides_phage(28.57%)	27	2544248:2544305	2554994:2555051
WP_013406786.1|2541704_2543024_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_013406787.1|2543211_2543649_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_160143076.1|2543750_2543924_-	hypothetical protein	NA	NA	NA	NA	NA
2544248:2544305	attL	ATTTTAAATGGCGCGCTCGGAAGGATTCGAACCCTCAGCCTACTGATCCGTAGTCAGT	NA	NA	NA	NA
WP_041595842.1|2544508_2545225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013404838.1|2545277_2546348_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	41.1	1.7e-59
WP_049773906.1|2546425_2549116_-	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	35.1	2.0e-133
WP_013406789.1|2549244_2549691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013406790.1|2549702_2550503_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_095522092.1|2550618_2551885_+|transposase	IS3-like element ISHahy4 family transposase	transposase	NA	NA	NA	NA
WP_013406791.1|2551918_2552191_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	56.3	3.0e-18
WP_095522093.1|2552595_2553721_+|transposase	IS3-like element ISHahy2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.2	1.7e-83
WP_160143077.1|2553627_2554596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083789322.1|2554654_2554903_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	43.6	3.5e-13
WP_013406792.1|2555163_2555658_-	intracellular proteinase inhibitor	NA	NA	NA	NA	NA
2554994:2555051	attR	ATTTTAAATGGCGCGCTCGGAAGGATTCGAACCCTCAGCCTACTGATCCGTAGTCAGT	NA	NA	NA	NA
WP_013406793.1|2555714_2556131_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_013406794.1|2556155_2556581_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.9	3.8e-23
WP_013406795.1|2556599_2557106_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_013406796.1|2557230_2557890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013406797.1|2558014_2561551_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_013406798.1|2561710_2562331_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013406799.1|2562499_2563609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013406800.1|2563633_2564119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013406801.1|2564162_2565329_-	nucleotide sugar dehydrogenase	NA	M1HIV9	Acanthocystis_turfacea_Chlorella_virus	50.5	3.2e-109
WP_013406802.1|2565485_2566136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013406803.1|2566365_2567646_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_160143134.1|2567742_2568381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013406805.1|2568424_2568775_-|holin	phage holin family protein	holin	NA	NA	NA	NA
