The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017506	Marinobacter adhaerens HP15, complete sequence	4421911	671088	721080	4421911	capsid,integrase,plate,terminase,tRNA,tail,portal	Escherichia_phage(28.21%)	66	670740:670788	712476:712524
670740:670788	attL	TGGTAGCAAGGGGCGGAGTCGAACCGCCGACCCCAGCATTATGAGTGCT	NA	NA	NA	NA
WP_014576165.1|671088_672087_-	phage late control D	NA	A0A088FRU7	Escherichia_phage	43.6	1.3e-74
WP_014576166.1|672077_672290_-|tail	phage tail protein	tail	V5YTI6	Pseudomonas_phage	53.7	4.9e-16
WP_014576167.1|672279_672672_-|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	55.2	2.3e-35
WP_014576168.1|672671_674426_-	hypothetical protein	NA	A0A077K8S2	Ralstonia_phage	24.7	1.1e-07
WP_014576169.1|674549_674834_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	52.6	9.2e-18
WP_014576170.1|674884_675391_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	61.3	6.2e-57
WP_014576171.1|675390_676908_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	V5YTI0	Pseudomonas_phage	46.2	7.4e-130
WP_041644982.1|676998_677481_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_014576173.1|677491_677773_-	hypothetical protein	NA	D5LGY9	Escherichia_phage	61.3	4.5e-25
WP_014576174.1|677782_679219_-|tail	phage tail protein	tail	D5LGZ0	Escherichia_phage	59.0	3.1e-146
WP_014576175.1|679215_681789_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014576176.1|681785_682568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041644985.1|682569_683268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014576178.1|683278_684058_-	hypothetical protein	NA	A0A193GYB8	Enterobacter_phage	48.6	3.5e-19
WP_014576179.1|684060_684636_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	45.5	1.4e-44
WP_014576180.1|684628_685549_-|plate	baseplate J/gp47 family protein	plate	A0A088FQL4	Escherichia_phage	61.2	1.3e-92
WP_014576181.1|685548_685887_-	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	68.5	9.6e-38
WP_014576182.1|685938_686724_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	45.9	8.2e-24
WP_014576183.1|686723_687284_-	hypothetical protein	NA	V5YST2	Pseudomonas_phage	45.4	2.7e-37
WP_041646109.1|687259_687766_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.6	2.8e-17
WP_014576185.1|687803_688115_-	hypothetical protein	NA	V5YTH3	Pseudomonas_phage	54.5	7.7e-26
WP_169702206.1|688114_688357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014576187.1|688488_690591_-|capsid	phage major capsid protein	capsid	A0A193GYA3	Enterobacter_phage	60.8	2.0e-218
WP_014576188.1|690568_692146_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.4	1.5e-141
WP_014576189.1|692138_692681_-	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	50.9	3.0e-41
WP_014576190.1|692684_694646_-|terminase	phage terminase large subunit family protein	terminase	D5LH04	Escherichia_phage	63.5	7.1e-234
WP_014576191.1|694635_695154_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	50.9	1.7e-33
WP_014576192.1|695271_695703_-	hypothetical protein	NA	A0A1B1IV19	uncultured_Mediterranean_phage	33.3	7.4e-11
WP_014576193.1|695714_696140_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	52.2	1.1e-35
WP_014576194.1|696143_696452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014576195.1|696543_697077_-	hypothetical protein	NA	A0A1W6JT18	Escherichia_phage	38.8	8.1e-15
WP_049784454.1|697086_697419_-	hypothetical protein	NA	A0A2P9HY19	Yersinia_phage	62.8	4.5e-24
WP_049784455.1|697420_697732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014576198.1|697728_698403_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	39.3	2.0e-39
WP_014576199.1|698392_699406_-	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	45.2	5.3e-23
WP_041644986.1|699402_700149_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	40.4	1.2e-35
WP_041644987.1|700214_700625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041644989.1|701617_701866_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	43.6	2.3e-12
WP_014576202.1|701982_702966_+	helix-turn-helix domain-containing protein	NA	A0A1B0Z078	Pseudomonas_phage	47.5	6.6e-47
WP_014576203.1|703001_703913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169702129.1|703936_704719_-	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	41.4	3.0e-42
WP_081449865.1|704744_705233_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049784456.1|705246_705444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576206.1|705540_705729_+	carbon storage regulator	NA	I3PUZ0	Vibrio_phage	50.0	6.3e-07
WP_014576207.1|705721_706051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576208.1|706031_706253_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	56.2	6.3e-14
WP_014576209.1|706256_706877_+	HNH endonuclease	NA	I6T7L3	Staphylococcus_virus	31.8	2.1e-14
WP_014576210.1|706870_707218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576211.1|707217_707478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576212.1|707458_707650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576213.1|707643_707871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041644991.1|707867_708542_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	42.3	7.8e-39
WP_014576215.1|708541_708838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049784515.1|709665_710031_+	hypothetical protein	NA	B2ZY87	Ralstonia_phage	67.3	2.6e-33
WP_014576217.1|710033_710192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576218.1|710188_710449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014576219.1|710722_711118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041644992.1|711338_712454_+|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	44.4	2.8e-78
WP_014576221.1|712644_713736_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
712476:712524	attR	TGGTAGCAAGGGGCGGAGTCGAACCGCCGACCCCAGCATTATGAGTGCT	NA	NA	NA	NA
WP_014576222.1|713773_714361_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_041644993.1|714391_715042_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_008176348.1|715208_716159_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	39.2	5.1e-44
WP_014576225.1|716305_717169_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_014576226.1|717165_717798_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_041646126.1|717794_719543_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_008176344.1|719790_721080_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 2
NC_017506	Marinobacter adhaerens HP15, complete sequence	4421911	2068040	2111972	4421911	capsid,integrase,head,terminase,tail,portal	Marinobacter_phage(84.09%)	59	2066541:2066587	2110037:2110083
2066541:2066587	attL	TTGACATGGTAGAGGTCCCCAGTTCGAATCTGGGTGGTCCTACCAAT	NA	NA	NA	NA
WP_014577303.1|2068040_2070623_-	hypothetical protein	NA	A0A2D1GN28	Marinobacter_phage	36.7	4.5e-135
WP_014577304.1|2070622_2071495_-	hypothetical protein	NA	A0A2D1GMN8	Marinobacter_phage	49.7	7.9e-44
WP_041645258.1|2071569_2071830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041645260.1|2071829_2072237_-	hypothetical protein	NA	A0A2D1GN29	Marinobacter_phage	44.6	1.1e-24
WP_014577307.1|2072233_2072587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041645261.1|2072583_2075331_-|tail	phage tail tape measure protein	tail	A0A2D1GMZ2	Marinobacter_phage	70.1	0.0e+00
WP_014577309.1|2075390_2075807_-	DUF4124 domain-containing protein	NA	A0A2D1GMP1	Marinobacter_phage	36.5	1.7e-12
WP_014577310.1|2075971_2076478_-	hypothetical protein	NA	A0A2D1GMU6	Marinobacter_phage	70.8	7.1e-61
WP_014577311.1|2076474_2077446_-	hypothetical protein	NA	A0A2D1GN10	Marinobacter_phage	89.2	1.4e-158
WP_014577312.1|2077503_2077914_-	hypothetical protein	NA	A0A2D1GMS1	Marinobacter_phage	82.4	1.6e-58
WP_014577313.1|2077913_2078531_-|tail	phage tail protein	tail	A0A2D1GMV8	Marinobacter_phage	87.8	8.9e-82
WP_014577314.1|2078520_2078835_-	hypothetical protein	NA	A0A2D1GN38	Marinobacter_phage	57.8	7.5e-29
WP_041645262.1|2078834_2079098_-	hypothetical protein	NA	A0A2D1GMP7	Marinobacter_phage	80.4	3.7e-13
WP_014577316.1|2079190_2080210_-|capsid	major capsid protein	capsid	A0A2D1GN39	Marinobacter_phage	96.8	9.5e-198
WP_014577317.1|2080271_2080640_-|head	head decoration protein	head	A0A2D1GMY6	Marinobacter_phage	88.5	8.5e-56
WP_014577318.1|2080703_2082029_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	88.0	1.3e-199
WP_041645264.1|2082381_2083974_-|portal	phage portal protein	portal	A0A2D1GMV5	Marinobacter_phage	92.9	1.4e-288
WP_014577320.1|2083976_2084183_-|head,tail	head-tail joining protein	head,tail	A0A2D1GN20	Marinobacter_phage	91.2	8.7e-26
WP_085987851.1|2084179_2086132_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	75.3	1.2e-289
WP_014577322.1|2086091_2086610_-|terminase	terminase small subunit	terminase	A0A2D1GMW4	Marinobacter_phage	84.3	6.5e-70
WP_041645266.1|2086726_2087077_-	hypothetical protein	NA	A0A2D1GN49	Marinobacter_phage	69.0	1.2e-38
WP_014577324.1|2087082_2088630_-	hypothetical protein	NA	A0A2D1GMQ7	Marinobacter_phage	49.8	2.1e-39
WP_041645267.1|2088629_2089769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014577326.1|2089768_2090875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014577328.1|2090985_2091447_-	DUF2570 domain-containing protein	NA	A0A2D1GMW3	Marinobacter_phage	61.2	1.8e-39
WP_041645268.1|2091443_2091689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041645269.1|2091688_2092051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049784478.1|2092081_2092489_-	M23 family metallopeptidase	NA	M4QPX0	Salicola_phage	50.4	2.0e-34
WP_014577332.1|2092757_2093078_-	phage antitermination Q type 1 family-like protein	NA	A0A2D1GMX6	Marinobacter_phage	65.1	2.0e-37
WP_049784479.1|2093413_2095027_-	hypothetical protein	NA	A0A2H4JF22	uncultured_Caudovirales_phage	41.9	2.8e-103
WP_014577334.1|2095013_2095910_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	34.7	3.1e-35
WP_014577335.1|2095976_2096213_-	helix-turn-helix domain-containing protein	NA	A0A2D1GMR4	Marinobacter_phage	50.7	2.7e-15
WP_169702115.1|2096174_2096717_+	hypothetical protein	NA	A0A2D1GN58	Marinobacter_phage	43.6	1.1e-24
WP_014577337.1|2096906_2097542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014577338.1|2097634_2098078_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GN22	Marinobacter_phage	49.2	1.1e-22
WP_014577339.1|2098074_2098377_+	phage antirepressor KilAC domain-containing protein	NA	A0A2D1GMX3	Marinobacter_phage	69.3	8.3e-33
WP_014577340.1|2098376_2098625_+	hypothetical protein	NA	A0A2D1GN40	Marinobacter_phage	58.0	3.3e-19
WP_041645270.1|2098635_2098833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014577342.1|2098934_2099276_+	hypothetical protein	NA	A0A2D1GMU7	Marinobacter_phage	64.5	3.4e-35
WP_014577343.1|2099272_2099584_+	hypothetical protein	NA	A0A2D1GMY4	Marinobacter_phage	59.6	4.7e-23
WP_014577344.1|2099583_2099829_+	hypothetical protein	NA	A0A2D1GN68	Marinobacter_phage	71.1	6.9e-22
WP_014577346.1|2100194_2101061_+	DUF2303 family protein	NA	A5LH63	Enterobacteria_phage	41.4	3.2e-53
WP_014577347.1|2101138_2101711_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	53.1	1.8e-44
WP_014577348.1|2101728_2102124_+	hypothetical protein	NA	A0A2D1GMQ4	Marinobacter_phage	62.3	1.8e-40
WP_014577349.1|2102126_2102468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014577350.1|2102445_2103525_+	phage Gp37/Gp68 family protein	NA	A0A0A7RVQ8	Mycobacterium_phage	46.3	4.7e-78
WP_014577351.1|2103521_2104019_+	hypothetical protein	NA	A0A2D1GN19	Marinobacter_phage	73.6	1.4e-29
WP_041646249.1|2104315_2104771_+	hypothetical protein	NA	A0A2D1GMW7	Marinobacter_phage	79.3	2.7e-72
WP_014577353.1|2104767_2105268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014577354.1|2105427_2105706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645271.1|2105698_2106061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014577356.1|2106073_2106415_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	43.0	3.1e-20
WP_014577357.1|2106411_2106843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645272.1|2106963_2107449_+	hypothetical protein	NA	A0A2D1GMN2	Marinobacter_phage	46.9	5.6e-23
WP_014577360.1|2107462_2107666_+	hypothetical protein	NA	A0A2D1GMT6	Marinobacter_phage	83.3	5.9e-27
WP_014577361.1|2107665_2108787_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	83.9	2.7e-185
WP_014577362.1|2108918_2109446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014577363.1|2109445_2109859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645273.1|2110232_2111972_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.9	2.0e-09
2110037:2110083	attR	TTGACATGGTAGAGGTCCCCAGTTCGAATCTGGGTGGTCCTACCAAT	NA	NA	NA	NA
>prophage 3
NC_017506	Marinobacter adhaerens HP15, complete sequence	4421911	2142347	2155018	4421911	tRNA	Hokovirus(25.0%)	10	NA	NA
WP_014577395.1|2142347_2144156_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	26.8	1.6e-14
WP_008169141.1|2144364_2144982_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_041645278.1|2144995_2145430_-	HIT family protein	NA	NA	NA	NA	NA
WP_014577397.1|2145453_2146797_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.9	5.8e-78
WP_014577398.1|2146793_2147822_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.2	1.7e-53
WP_014577399.1|2147831_2148335_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	44.0	5.8e-07
WP_014577400.1|2148355_2149933_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.0	5.5e-19
WP_008169151.1|2149995_2151459_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.1	2.0e-92
WP_014577401.1|2151651_2153040_+	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	39.2	2.2e-27
WP_014577402.1|2153143_2155018_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	34.9	1.9e-66
>prophage 4
NC_017506	Marinobacter adhaerens HP15, complete sequence	4421911	3592299	3666452	4421911	plate,protease,tRNA,integrase	Bacillus_phage(25.0%)	60	3622425:3622440	3669230:3669245
WP_014578595.1|3592299_3593028_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_014578596.1|3593153_3594425_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_014578597.1|3594442_3595276_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_014578598.1|3595404_3596214_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014578599.1|3596210_3597419_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_014578600.1|3597470_3599750_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	G3MA91	Bacillus_virus	33.3	1.5e-22
WP_041645704.1|3599746_3600706_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014578602.1|3600809_3601718_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_041645707.1|3601745_3602114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014578604.1|3602126_3602447_-	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_014578605.1|3602543_3602945_-	response regulator	NA	W8CYM9	Bacillus_phage	33.1	1.3e-09
WP_041645709.1|3602949_3604080_-	response regulator	NA	NA	NA	NA	NA
WP_014578607.1|3604110_3605814_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_014578608.1|3605921_3607715_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.7	4.3e-20
WP_081449848.1|3607629_3609765_+	GAF domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.6e-19
WP_008173036.1|3609805_3610345_-	bacterioferritin	NA	NA	NA	NA	NA
WP_014578610.1|3610423_3613183_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_014578612.1|3613443_3614964_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_081449849.1|3614960_3615548_-	SCO family protein	NA	NA	NA	NA	NA
WP_014578615.1|3615717_3617541_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	2.9e-32
WP_169702232.1|3617826_3619140_+	DUF4013 domain-containing protein	NA	NA	NA	NA	NA
WP_014578617.1|3619261_3620710_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014578618.1|3621032_3621473_+	OmpA family protein	NA	NA	NA	NA	NA
WP_041645712.1|3621555_3621957_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_008175780.1|3621959_3622202_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014578620.1|3622297_3622996_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
3622425:3622440	attL	CCGGTCCAGCCGACGG	NA	NA	NA	NA
WP_014578621.1|3623044_3623635_-	class GN sortase	NA	NA	NA	NA	NA
WP_014578622.1|3623631_3625746_-	marine proteobacterial sortase target protein	NA	A0A2K9L1J5	Tupanvirus	22.9	5.8e-16
WP_014578623.1|3625939_3626641_+	proteobacterial dedicated sortase system response regulator	NA	NA	NA	NA	NA
WP_014578624.1|3626644_3628675_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_014578625.1|3628693_3630001_+	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_008175767.1|3630001_3630793_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_008175765.1|3630876_3631320_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_014578626.1|3631483_3634303_+	transporter substrate-binding domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.7	1.8e-12
WP_014578627.1|3634345_3635317_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	47.4	5.1e-68
WP_014578628.1|3635356_3635935_-	porin family protein	NA	NA	NA	NA	NA
WP_014578629.1|3636096_3637371_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014578630.1|3637471_3637729_-	YdcH family protein	NA	NA	NA	NA	NA
WP_014578631.1|3637844_3638699_-	DNA ligase	NA	F2Y2Y2	Organic_Lake_phycodnavirus	34.9	1.1e-34
WP_014578632.1|3638776_3639205_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_041645715.1|3639246_3640119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041645717.1|3640093_3642961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014578635.1|3642953_3643820_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041646395.1|3643819_3645898_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.3	6.3e-31
WP_014578637.1|3646014_3649608_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_041645721.1|3649640_3651077_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041645726.1|3651111_3651759_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_014578640.1|3651755_3653327_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_014578641.1|3653407_3656041_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.5	3.0e-94
WP_014578642.1|3656051_3656879_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014578643.1|3656882_3658217_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014578644.1|3658216_3658750_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_041645729.1|3658746_3660063_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_008175716.1|3660083_3661100_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014578647.1|3661063_3662836_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014578648.1|3662982_3663423_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014578649.1|3663426_3664908_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_008175709.1|3664964_3665462_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_008175707.1|3665740_3666001_+	acyl-CoA-binding protein	NA	A0A1V0S9E7	Catovirus	37.8	1.9e-09
WP_008175705.1|3666134_3666452_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
3669230:3669245	attR	CCGGTCCAGCCGACGG	NA	NA	NA	NA
