The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	1185895	1217862	3532052	plate,tail,tRNA	Bacillus_phage(20.0%)	29	NA	NA
WP_010938378.1|1185895_1187269_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014524310.1|1187443_1188130_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010938380.1|1188126_1189746_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014524311.1|1189865_1190471_+	3'-5' exonuclease domain-containing protein 2	NA	NA	NA	NA	NA
WP_010938382.1|1190644_1191334_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	5.5e-40
WP_010938383.1|1191361_1192129_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	7.5e-14
WP_010938384.1|1192137_1192803_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_010938385.1|1192960_1193710_+	GAK system XXXCH domain-containing protein	NA	NA	NA	NA	NA
WP_011792536.1|1193713_1194916_+	GAK system CofD-like protein	NA	NA	NA	NA	NA
WP_010938388.1|1195295_1197935_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.2	3.2e-80
WP_010938389.1|1198013_1199087_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.6	2.1e-107
WP_010938390.1|1199375_1200482_+	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_010938391.1|1200699_1202061_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_010938392.1|1202250_1202781_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010938393.1|1202913_1204296_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010938394.1|1204299_1205490_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_010938395.1|1205541_1206444_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_014524313.1|1206591_1207335_+	UPF0280 family protein	NA	NA	NA	NA	NA
WP_010938397.1|1207754_1208498_-	DNA methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	48.9	4.8e-58
WP_014524314.1|1208475_1208670_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	65.1	2.4e-09
WP_010938398.1|1208927_1209374_-|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010938399.1|1209387_1210905_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	31.1	4.2e-16
WP_010938400.1|1210906_1211563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524316.1|1211717_1212899_-|plate	baseplate J/gp47 family protein	plate	H7BVM7	unidentified_phage	34.3	4.5e-26
WP_010938402.1|1212876_1213311_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_010938403.1|1213307_1214039_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_010938404.1|1214025_1214826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938405.1|1214971_1215523_-	hypothetical protein	NA	A0A1B1IUE1	uncultured_Mediterranean_phage	27.9	3.2e-06
WP_010938406.1|1215519_1217862_-|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	52.0	8.9e-74
>prophage 2
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	1223948	1248908	3532052	holin,capsid,head,transposase	Pseudomonas_phage(28.57%)	34	NA	NA
WP_010938415.1|1223948_1224944_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_010938416.1|1224952_1225300_-|head	head decoration protein	head	NA	NA	NA	NA
WP_010938417.1|1225315_1226266_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.2	7.9e-21
WP_010938418.1|1226455_1227757_-|capsid	minor capsid protein	capsid	A0A2K9VGX3	Faecalibacterium_phage	41.6	3.1e-36
WP_010938419.1|1227756_1229349_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	28.1	2.3e-25
WP_010938420.1|1229433_1230054_-	OB-fold putative lipoprotein	NA	NA	NA	NA	NA
WP_010938421.1|1230113_1231598_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	51.2	6.8e-128
WP_014524317.1|1231648_1232245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938423.1|1232256_1232499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938424.1|1232495_1232969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938425.1|1232965_1233271_-	lipoprotein	NA	NA	NA	NA	NA
WP_010938426.1|1233224_1233638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938427.1|1233630_1234296_-	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	56.9	7.9e-60
WP_010938428.1|1234295_1234664_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	46.4	1.4e-18
WP_010938429.1|1234737_1235202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010938430.1|1235185_1235551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524318.1|1235547_1236024_-	regulatory protein GemA	NA	A0A2H4J581	uncultured_Caudovirales_phage	30.0	1.4e-05
WP_010938432.1|1236020_1236479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938433.1|1236560_1236848_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_010938434.1|1236861_1237101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938435.1|1237118_1237631_-	host-nuclease inhibitor Gam family protein	NA	B7SDX6	Pseudomonas_virus	27.6	7.3e-05
WP_010938436.1|1237632_1237821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938437.1|1237823_1238456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938438.1|1238448_1239186_-	ATP-binding protein	NA	A0A2H4J809	uncultured_Caudovirales_phage	25.7	3.8e-07
WP_010938439.1|1239182_1241336_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A125RN39	Pseudomonas_phage	24.9	4.0e-20
WP_014524319.1|1241559_1242048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938441.1|1242047_1242317_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010938442.1|1242313_1242739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938443.1|1243000_1243768_+	helix-turn-helix domain-containing protein	NA	A7Y8H7	Pseudomonas_virus	32.5	6.6e-18
WP_010938445.1|1245353_1246733_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	35.8	4.2e-55
WP_010938446.1|1246734_1247781_+	hypothetical protein	NA	A0A125RNN9	Pseudomonas_phage	28.2	1.3e-16
WP_081448120.1|1247808_1248036_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	55.6	4.3e-10
WP_081448121.1|1248374_1248593_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081448122.1|1248674_1248908_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	1285436	1301624	3532052	tRNA	Staphylococcus_phage(36.36%)	16	NA	NA
WP_010938487.1|1285436_1288007_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	5.9e-172
WP_010938488.1|1288003_1288306_-	acylphosphatase	NA	NA	NA	NA	NA
WP_010938489.1|1288314_1288992_-	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	32.4	2.4e-24
WP_014524331.1|1289027_1290017_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010938491.1|1290099_1290618_-	lipoprotein	NA	NA	NA	NA	NA
WP_010938492.1|1290601_1293091_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.1	7.4e-204
WP_010938493.1|1293133_1293595_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_010938494.1|1293598_1294069_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	54.4	4.4e-33
WP_010938495.1|1294200_1295430_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.0	5.9e-93
WP_010938496.1|1295461_1296124_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.6	4.2e-29
WP_010938497.1|1296129_1297263_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.8	9.4e-37
WP_010938498.1|1297265_1297796_-	cytidine/deoxycytidylate deaminase family protein	NA	S5YN57	Mycobacterium_phage	37.8	7.2e-24
WP_010938499.1|1297861_1299100_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	55.3	3.9e-97
WP_010938500.1|1299158_1300406_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_010938501.1|1300593_1300824_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.2	5.9e-07
WP_010938502.1|1300880_1301624_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0M4JSW6	Mollivirus	32.5	5.1e-07
>prophage 4
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	1470539	1500365	3532052	integrase,transposase,protease	Shigella_phage(20.0%)	21	1479714:1479730	1510676:1510692
WP_150103616.1|1470539_1471777_-|transposase	IS3-like element ISDvu2 family transposase	transposase	Q9ZXG3	Shigella_phage	48.0	2.0e-64
WP_014524351.1|1472131_1472743_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_010939308.1|1472763_1473354_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_014524353.1|1473368_1476917_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_010939306.1|1476913_1477978_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_010939305.1|1477974_1478514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939304.1|1478518_1481995_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	25.2	7.6e-05
1479714:1479730	attL	CCCTGCGCCAGTTCGAA	NA	NA	NA	NA
WP_010939303.1|1481994_1482462_+	GxxExxY protein	NA	NA	NA	NA	NA
WP_010939302.1|1482458_1484957_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_010939301.1|1484971_1487041_+|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_014524354.1|1487030_1487246_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010939300.1|1487286_1488528_+|transposase	ISL3-like element ISDvu5 family transposase	transposase	NA	NA	NA	NA
WP_010939299.1|1488571_1489453_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.0e-10
WP_081448124.1|1489392_1489641_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_010939297.1|1489637_1490813_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_010939296.1|1490887_1492549_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_150103618.1|1492986_1494097_+|transposase	IS3-like element ISD1 family transposase	transposase	NA	NA	NA	NA
WP_010939293.1|1494078_1494462_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_010939290.1|1495349_1495505_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010937781.1|1495810_1496860_-|transposase	IS481-like element ISDvu4 family transposase	transposase	A0A077SLK2	Escherichia_phage	43.5	5.0e-77
WP_014524356.1|1499177_1500365_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	28.2	8.6e-17
1510676:1510692	attR	TTCGAACTGGCGCAGGG	NA	NA	NA	NA
>prophage 5
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	1721343	1732217	3532052		Streptococcus_phage(16.67%)	10	NA	NA
WP_010939087.1|1721343_1723392_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	3.0e-57
WP_010939086.1|1723398_1723914_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_164562208.1|1723954_1724806_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010939083.1|1725007_1725280_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.1	5.2e-18
WP_010939082.1|1725290_1725494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939080.1|1725610_1725814_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010939079.1|1725929_1726379_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	42.2	6.8e-23
WP_010939078.1|1726385_1728701_+	Smr/MutS family protein	NA	Q94M10	Lactobacillus_phage	45.9	6.2e-11
WP_010939077.1|1728733_1730452_+	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	29.1	5.2e-39
WP_010939076.1|1730444_1732217_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.3	7.3e-36
>prophage 6
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	1981432	2052956	3532052	integrase,tail,capsid,head,tRNA,portal,terminase,protease	Burkholderia_phage(15.38%)	76	1977938:1977954	2007146:2007162
1977938:1977954	attL	CTCGCCCGCCCGACATG	NA	NA	NA	NA
WP_010938825.1|1981432_1982362_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_010938824.1|1982358_1982919_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.6	8.4e-31
WP_010938823.1|1982894_1983467_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_010938822.1|1983592_1985203_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010938821.1|1985339_1985996_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	32.5	9.0e-16
WP_010938820.1|1986216_1986702_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	36.5	9.0e-05
WP_010938819.1|1987315_1988509_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	47.1	6.5e-97
WP_010938818.1|1988505_1988724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938817.1|1989087_1990080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938816.1|1990099_1990996_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_010938815.1|1990998_1992027_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	29.3	3.7e-16
WP_014524426.1|1992072_1992369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938812.1|1993066_1994053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164928128.1|1994110_1994722_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHY1	Moraxella_phage	25.8	1.5e-12
WP_081448130.1|1994799_1995111_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010938809.1|1995321_1995735_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014524429.1|1995734_1996091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938807.1|1996293_1997757_+	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	40.0	1.2e-73
WP_041722649.1|1997789_1997975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524431.1|1998735_1999143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938805.1|1999139_1999634_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	57.8	2.6e-28
WP_010938804.1|1999620_1999881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938802.1|2000222_2000786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190275550.1|2000844_2001168_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_010938800.1|2001331_2001739_+	hypothetical protein	NA	A0A0M4TU77	Ralstonia_phage	50.7	1.0e-33
WP_010938799.1|2001738_2002089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938798.1|2002085_2002334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938797.1|2002353_2002752_+	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	49.6	5.4e-24
WP_010938796.1|2002835_2003303_+|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	38.7	1.6e-19
WP_010938795.1|2003307_2005005_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	52.3	1.4e-161
WP_010938794.1|2005004_2006264_+|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	34.0	1.3e-55
WP_010938793.1|2006256_2006991_+|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	58.3	1.4e-57
WP_010938792.1|2007195_2008392_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	39.3	9.5e-64
2007146:2007162	attR	CTCGCCCGCCCGACATG	NA	NA	NA	NA
WP_010938791.1|2008437_2008707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938790.1|2008710_2009268_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_010938789.1|2009267_2009594_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	45.0	9.9e-16
WP_010938788.1|2009586_2010084_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014524433.1|2010086_2010473_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_010938786.1|2010484_2011648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938785.1|2011656_2012040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940652.1|2012459_2012864_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	49.3	1.7e-09
WP_010938784.1|2012912_2013095_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_010938783.1|2013267_2016066_+	tape measure protein	NA	A5A3Q5	Burkholderia_phage	25.1	4.1e-33
WP_010938781.1|2016422_2017328_+|tail	tail protein	tail	NA	NA	NA	NA
WP_014524435.1|2017732_2020480_+	hypothetical protein	NA	A0A2H4P6Z2	Pseudomonas_phage	27.9	2.3e-41
WP_014524436.1|2020479_2021112_+	hypothetical protein	NA	Q5DN32	Alphaproteobacteria_virus	28.0	1.1e-07
WP_010938777.1|2021114_2021453_+	hypothetical protein	NA	Q58MX5	Prochlorococcus_phage	43.5	2.4e-17
WP_010938776.1|2021445_2021955_+|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_014524437.1|2022587_2023088_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	34.9	9.3e-05
WP_010938773.1|2023146_2023506_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_010938772.1|2023546_2024554_-	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
WP_010938771.1|2024562_2025459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524439.1|2025484_2026105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938768.1|2026976_2027654_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_014524440.1|2028093_2028342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011792370.1|2028663_2031111_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_010938764.1|2031125_2031554_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_010938763.1|2031626_2031911_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_010938762.1|2032064_2033528_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_010938761.1|2033688_2035137_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.4	2.0e-20
WP_010938760.1|2035248_2036574_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.4	1.8e-39
WP_010938759.1|2036589_2037516_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010938758.1|2037622_2038951_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010938757.1|2038994_2040230_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_010938756.1|2040352_2041030_+	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_011792376.1|2041016_2041847_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_010938754.1|2041848_2043171_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_010938753.1|2043188_2043524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938752.1|2043559_2044732_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010938751.1|2044994_2045741_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010938750.1|2046041_2046971_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	28.5	2.2e-20
WP_010938749.1|2047214_2048225_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010938748.1|2048265_2049009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938747.1|2049423_2050611_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011792381.1|2050741_2052463_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.6	7.5e-38
WP_010938745.1|2052467_2052956_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 7
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	2255735	2273298	3532052	tail,capsid,head,portal,holin	Rhodovulum_phage(25.0%)	20	NA	NA
WP_010939430.1|2255735_2259776_-|tail	tail fiber protein	tail	A0A1B1P733	Rhodovulum_phage	35.0	3.3e-60
WP_010939431.1|2259765_2260191_-	C40 family peptidase	NA	A0A1B0T6D9	Thiobacimonas_phage	45.0	5.8e-24
WP_014524470.1|2260190_2260700_-	DUF1833 family protein	NA	M4ST87	Rhodobacter_phage	29.7	2.7e-12
WP_010939433.1|2260696_2261062_-	hypothetical protein	NA	A0A1B1P748	Rhodovulum_phage	36.6	1.0e-05
WP_010939434.1|2261061_2263983_-|tail	tail protein	tail	G9BW49	Planktothrix_phage	24.3	2.5e-17
WP_041722685.1|2263985_2264198_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_010939435.1|2264281_2264632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939436.1|2264640_2265585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939437.1|2265602_2266070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939438.1|2266066_2266777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524471.1|2266776_2267127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939440.1|2267126_2267291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939441.1|2267283_2267694_-	lipoprotein	NA	NA	NA	NA	NA
WP_014524473.1|2267836_2268352_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_014524474.1|2268359_2268815_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010939444.1|2268887_2269097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939445.1|2269099_2270125_-|capsid	major capsid protein	capsid	A0A248XCX5	Klebsiella_phage	23.4	2.5e-12
WP_010939446.1|2270135_2270504_-|head	head decoration protein	head	NA	NA	NA	NA
WP_010939447.1|2270507_2271728_-	S49 family peptidase	NA	A0A2I7QY56	Vibrio_phage	28.6	3.1e-09
WP_010939448.1|2271744_2273298_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	29.3	3.4e-37
>prophage 8
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	2804456	2837468	3532052	plate,tail,capsid,head,transposase,terminase,protease	uncultured_Caudovirales_phage(23.08%)	45	NA	NA
WP_014524552.1|2804456_2806652_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	Q38013	Pseudomonas_phage	38.0	6.8e-100
WP_010939958.1|2806660_2807446_+	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	25.0	2.3e-10
WP_010939959.1|2807448_2808036_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014524553.1|2808028_2808358_+	helix-turn-helix domain-containing protein	NA	G8GWC3	Rhodobacter_phage	39.5	1.1e-14
WP_014524554.1|2808360_2808843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939961.1|2808852_2809089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939962.1|2809174_2809414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939963.1|2809495_2809930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939964.1|2809938_2810355_+	regulatory protein GemA	NA	A0A2H4J581	uncultured_Caudovirales_phage	49.6	9.3e-27
WP_164928143.1|2810381_2810840_+	DNA transposition protein	NA	A0A0M3VI83	Ralstonia_phage	42.3	2.0e-14
WP_010939966.1|2810852_2811191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939967.1|2811303_2811666_+	lipoprotein	NA	Q6QIC8	Burkholderia_phage	46.4	8.1e-19
WP_010939968.1|2811665_2812313_+	transglycosylase SLT domain-containing protein	NA	A4JWP4	Burkholderia_virus	56.4	1.0e-59
WP_010939969.1|2812305_2812725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014524556.1|2812678_2812972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939971.1|2812975_2813257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939972.1|2813243_2813459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939973.1|2813460_2813979_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.3	1.5e-37
WP_010939974.1|2813975_2815652_+|terminase	phage terminase large subunit	terminase	A0SMN6	Pseudomonas_virus	60.3	3.5e-189
WP_010939975.1|2815638_2817357_+	DUF935 domain-containing protein	NA	A0A1C6ZDK1	Pseudomonas_phage	43.0	1.0e-106
WP_010939976.1|2817359_2818610_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	50.2	5.1e-68
WP_010939977.1|2818774_2819263_+	phage virion morphogenesis protein	NA	F8TVC6	EBPR_siphovirus	41.8	3.5e-17
WP_010940676.1|2819397_2819934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014524557.1|2819969_2821151_+|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	42.5	4.7e-55
WP_010939979.1|2821151_2822081_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A1C6ZDN1	Pseudomonas_phage	55.8	2.8e-95
WP_010939980.1|2822092_2822422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939981.1|2822421_2822853_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_010939982.1|2822849_2823479_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_010939983.1|2823481_2823667_+	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	52.7	6.6e-09
WP_010939984.1|2823653_2825075_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	46.2	1.0e-96
WP_010939985.1|2825153_2825981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939987.1|2826116_2826491_+	hypothetical protein	NA	A0A2H4J9F8	uncultured_Caudovirales_phage	46.1	1.1e-23
WP_010939988.1|2826688_2827018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939989.1|2827176_2829117_+|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	42.1	9.3e-69
WP_010939990.1|2829136_2830477_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.3	4.5e-38
WP_010939991.1|2830496_2831621_+|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.4	5.9e-76
WP_010939992.1|2831617_2832244_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	41.7	5.5e-31
WP_010939993.1|2832182_2832632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939994.1|2832704_2833061_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	58.1	1.2e-27
WP_010939995.1|2833070_2834132_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.9	6.6e-69
WP_010939996.1|2834128_2834722_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_010939997.1|2834805_2835696_+|tail	tail protein	tail	Q9MCR6	Enterobacteria_phage	43.7	1.3e-14
WP_010939998.1|2835705_2836245_+|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010939999.1|2836545_2836746_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	48.2	9.7e-06
WP_010940000.1|2836718_2837468_+	DNA methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	48.1	1.1e-54
>prophage 9
NC_017310	Desulfovibrio vulgaris RCH1, complete sequence	3532052	2939492	2984428	3532052	integrase,plate,tail,capsid,head,tRNA,portal,holin	Alteromonadaceae_phage(18.18%)	55	2939318:2939362	2980790:2980834
2939318:2939362	attL	TGGCGCGCCCGGGAGGATTCGAACCCCCGGCCAAGAGCTTAGAAG	NA	NA	NA	NA
WP_041722798.1|2939492_2940788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1U9WS15	Gordonia_phage	25.4	1.9e-09
WP_010940095.1|2940789_2941032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940096.1|2941096_2941462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524576.1|2941546_2941759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940097.1|2941844_2942039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940098.1|2942025_2942487_-	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_010940099.1|2942644_2942974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940100.1|2942963_2943302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940101.1|2943371_2943644_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014524577.1|2943761_2944187_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010940103.1|2944299_2945373_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	39.3	1.7e-56
WP_010940104.1|2945444_2946782_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.0	4.1e-23
WP_010940105.1|2946782_2947307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940106.1|2947415_2948117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940107.1|2948116_2949316_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	44.5	1.2e-87
WP_010940108.1|2949455_2950532_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.8	3.2e-87
WP_010940109.1|2950540_2950951_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	60.3	1.6e-42
WP_010940110.1|2950967_2951831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940111.1|2951838_2952267_+	HIT family protein	NA	D7NW73	Streptomyces_phage	51.5	2.1e-21
WP_010940113.1|2952572_2952902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940114.1|2952913_2953453_-|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010940115.1|2953462_2954278_-|tail	tail protein	tail	A0A2P1A4E8	Alteromonadaceae_phage	59.0	5.2e-13
WP_010940116.1|2954270_2954897_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	45.1	2.2e-35
WP_010940117.1|2954905_2955967_-|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	42.3	6.2e-67
WP_010940118.1|2955975_2956452_-	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	52.3	1.1e-23
WP_010940119.1|2956453_2957092_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	46.6	7.1e-26
WP_010940120.1|2957093_2958227_-|tail	tail protein	tail	B5TK72	Pseudomonas_phage	34.8	2.7e-52
WP_014524578.1|2958219_2958357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940121.1|2958349_2959549_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	28.6	3.8e-28
WP_010940122.1|2959557_2961048_-	hypothetical protein	NA	R9U4C6	Rhizobium_phage	49.7	4.6e-76
WP_150103629.1|2961128_2961236_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_010940123.1|2961247_2961508_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_010937521.1|2961507_2961873_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_010940124.1|2961922_2963386_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	42.5	3.0e-104
WP_010937519.1|2963389_2963581_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_010940125.1|2963564_2964122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937517.1|2964118_2964445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937516.1|2964441_2965035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937515.1|2965037_2965205_-	peptidase M16	NA	NA	NA	NA	NA
WP_010940127.1|2965197_2965608_-	lipoprotein	NA	NA	NA	NA	NA
WP_010940128.1|2965625_2966174_-	hypothetical protein	NA	K4PXD6	Edwardsiella_phage	33.7	1.2e-10
WP_010940129.1|2966194_2966683_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010940130.1|2966685_2967033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937510.1|2967041_2968046_-|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	42.6	1.5e-06
WP_010937509.1|2968057_2968441_-|head	head decoration protein	head	NA	NA	NA	NA
WP_010940131.1|2968450_2969770_-	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	32.5	1.1e-25
WP_010940132.1|2969753_2971454_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	27.5	2.2e-34
WP_010940133.1|2971457_2971733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940135.1|2972380_2972599_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010940137.1|2974573_2975296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940138.1|2975288_2976647_-	DNA modification methylase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	40.7	2.3e-82
WP_010940139.1|2976773_2978330_-	primase	NA	NA	NA	NA	NA
WP_010940141.1|2978596_2980282_-	primase	NA	K4I341	Streptomyces_virus	30.7	4.2e-41
WP_010940142.1|2981350_2982847_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
2980790:2980834	attR	TGGCGCGCCCGGGAGGATTCGAACCCCCGGCCAAGAGCTTAGAAG	NA	NA	NA	NA
WP_010940143.1|2983018_2984428_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
