The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	357031	481874	4014469	transposase,protease	uncultured_Mediterranean_phage(14.71%)	95	NA	NA
WP_013418003.1|357031_357670_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_013418004.1|357720_358431_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_013418005.1|358598_360482_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.5	6.6e-104
WP_013418006.1|360742_362836_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.2	8.6e-36
WP_013418007.1|363061_363400_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_013418008.1|363478_363715_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155942527.1|363916_365914_-	glycosyltransferase family 2 protein	NA	A0A285PWC6	Cedratvirus	42.4	7.4e-53
WP_155942528.1|366096_366888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418011.1|366951_368748_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_169309498.1|368752_370006_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013418013.1|370121_372395_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.1	1.9e-33
WP_013418014.1|372488_374993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418015.1|375503_376724_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013418016.1|377268_378888_+	methyltransferase domain-containing protein	NA	A0A0N9QZQ5	Chrysochromulina_ericina_virus	39.5	1.3e-07
WP_049779570.1|379823_380438_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	42.7	2.6e-25
WP_013418018.1|380624_381710_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013418019.1|381820_383695_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	35.9	6.1e-17
WP_013418020.1|383920_385438_-	malonyl-CoA synthase	NA	A0A2H4PQM9	Staphylococcus_phage	31.2	4.5e-34
WP_013418021.1|386046_386379_-	EamA family transporter	NA	NA	NA	NA	NA
WP_013418022.1|386375_386804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418023.1|386867_387425_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013418024.1|387662_388352_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013418025.1|388372_389329_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_013418026.1|389595_391056_+	trigger factor	NA	NA	NA	NA	NA
WP_013418027.1|391311_391956_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	58.4	3.4e-60
WP_013418028.1|392236_393505_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.4	8.3e-135
WP_013418030.1|393761_396200_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	48.1	3.0e-197
WP_041787993.1|396274_396736_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	43.2	5.7e-25
WP_041787995.1|397171_398182_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013418033.1|398374_398854_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	40.0	4.7e-22
WP_013418034.1|398880_400212_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_013418035.1|400174_400975_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_013418036.1|401175_401592_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_013418037.1|401753_402362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418038.1|402643_404398_-	SPOR domain-containing protein	NA	B6DZZ7	Stx2-converting_phage	32.4	1.0e-26
WP_037233862.1|404975_405305_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.6	1.3e-15
WP_013418040.1|405313_407674_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.4	1.3e-178
WP_013418041.1|408603_409323_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_013418042.1|409333_409672_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_013418043.1|409836_414633_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_013418044.1|414718_415108_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_013418045.1|415449_415701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942320.1|415801_416296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418047.1|416336_416762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418048.1|417043_419221_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_013418049.1|419411_419741_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.5	1.5e-16
WP_013418050.1|420085_421678_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	1.3e-23
WP_013418051.1|421941_422916_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_013418052.1|423204_424482_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013418053.1|424508_425345_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.3	1.7e-51
WP_013418054.1|425416_427045_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	2.2e-156
WP_013418055.1|427169_427529_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013418056.1|427836_428469_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_013418057.1|428511_429021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418058.1|429102_429885_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_041787192.1|430067_431963_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013418060.1|432035_433553_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	38.3	1.4e-35
WP_013418061.1|433575_434142_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013418062.1|434141_434774_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.1	3.8e-56
WP_013418063.1|434782_435883_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	4.3e-55
WP_013418064.1|435886_436708_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.6	5.2e-61
WP_013418065.1|436704_437175_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_049779172.1|437220_438183_-	cell wall hydrolase	NA	A0A218MLD1	uncultured_virus	42.0	6.8e-20
WP_013418067.1|438467_439430_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041788012.1|439550_442253_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	43.1	2.3e-94
WP_013418069.1|443207_443507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418070.1|443531_443942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418071.1|444020_444569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418072.1|444642_446775_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	28.3	2.0e-48
WP_013418073.1|446918_447875_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041788018.1|447879_448623_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.1	9.8e-27
WP_013418075.1|448670_449465_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_155942321.1|449697_450471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787194.1|450549_451569_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013418080.1|453317_454754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418082.1|455343_457635_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_041788024.1|457651_458362_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_013418084.1|458681_460265_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	3.9e-105
WP_041787200.1|460704_461112_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_169309499.1|461964_463431_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_013418088.1|463631_464597_+|transposase	IS481 family transposase	transposase	Q8UM96	Porcine_endogenous_retrovirus	31.0	7.3e-06
WP_013418089.1|464593_465679_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155942322.1|466193_466520_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013418091.1|466790_468293_+	sugar transferase	NA	NA	NA	NA	NA
WP_013418092.1|468575_469853_+	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	29.6	7.3e-22
WP_013418093.1|470169_471105_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013418094.1|471101_472127_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
WP_013418095.1|472304_473231_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_013418096.1|473385_475395_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.7	7.0e-27
WP_013418097.1|475399_476446_+	EpsG family protein	NA	NA	NA	NA	NA
WP_013418098.1|476545_477556_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013418099.1|477581_478526_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_013418100.1|478614_479739_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_169309500.1|479805_480918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041787200.1|481466_481874_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
>prophage 2
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	1371620	1433055	4014469	transposase,integrase	Porcine_endogenous_retrovirus(22.22%)	53	1392377:1392394	1406266:1406283
WP_013418485.1|1371620_1372586_+|transposase	IS481 family transposase	transposase	E2FK51	Porcine_endogenous_retrovirus	30.5	1.6e-05
WP_013418906.1|1373784_1374765_-	FecR family protein	NA	NA	NA	NA	NA
WP_013418907.1|1374809_1375316_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013418909.1|1377386_1378871_+	caspase family protein	NA	NA	NA	NA	NA
WP_013418910.1|1378888_1379656_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_155942360.1|1379834_1380595_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.5	1.4e-12
WP_013418913.1|1380665_1381631_-|transposase	IS481 family transposase	transposase	E2FK51	Porcine_endogenous_retrovirus	30.5	1.6e-05
WP_013418914.1|1381739_1382831_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013418915.1|1382830_1383175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418916.1|1383249_1384464_+	DUF4384 domain-containing protein	NA	NA	NA	NA	NA
WP_013418917.1|1384660_1385878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418918.1|1385903_1386365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418919.1|1386368_1387688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418920.1|1387678_1388665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418921.1|1388734_1389205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942362.1|1389305_1389809_-	caspase family protein	NA	NA	NA	NA	NA
WP_013418922.1|1389805_1390603_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.9	6.1e-59
WP_049779242.1|1391890_1393222_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
1392377:1392394	attL	AGCCTTCCTGTAATCCGC	NA	NA	NA	NA
WP_013418923.1|1393457_1394366_+	OmpA family protein	NA	NA	NA	NA	NA
WP_013418924.1|1394376_1396023_+	caspase family protein	NA	NA	NA	NA	NA
WP_013418925.1|1396019_1397504_+	DUF1986 domain-containing protein	NA	Q6JPG5	Neodiprion_lecontei_nucleopolyhedrovirus	34.3	6.7e-27
WP_013418926.1|1397514_1398702_+	proteinase inhibitor I4 serpin	NA	NA	NA	NA	NA
WP_013418927.1|1398909_1400457_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013418928.1|1400827_1402006_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	35.1	3.4e-66
WP_013418929.1|1402276_1403563_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_013418930.1|1403895_1404876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942364.1|1405233_1405479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418932.1|1405712_1406090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049779243.1|1406786_1407962_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
1406266:1406283	attR	AGCCTTCCTGTAATCCGC	NA	NA	NA	NA
WP_013418934.1|1408224_1408845_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013418935.1|1408841_1410074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418936.1|1410314_1410881_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_013418937.1|1410877_1411753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418938.1|1411899_1412760_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	40.2	9.7e-10
WP_013418939.1|1412956_1413124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013418940.1|1413348_1414248_+	cation transporter	NA	NA	NA	NA	NA
WP_013418941.1|1414281_1415202_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013418942.1|1415256_1416165_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_013418943.1|1416336_1417539_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013418944.1|1417979_1418639_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_013418945.1|1418635_1419814_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_013418946.1|1420017_1420239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418947.1|1420710_1422504_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_155942548.1|1422558_1423239_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081449408.1|1423533_1424778_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_155942366.1|1424909_1426430_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_013418951.1|1426548_1427388_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.8e-22
WP_013418952.1|1427426_1428179_-	OstA family protein	NA	NA	NA	NA	NA
WP_013418953.1|1428175_1428991_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_013418954.1|1429055_1429670_-	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	36.4	1.0e-13
WP_013418955.1|1429857_1431414_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_155942367.1|1431423_1431660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013417725.1|1431969_1433055_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	1559408	1642295	4014469	transposase,protease,integrase	Stx2-converting_phage(23.08%)	84	1555637:1555651	1609390:1609405
1555637:1555651	attL	GGAGCGCCAGCGCAA	NA	NA	NA	NA
WP_013419072.1|1559408_1560833_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
1555637:1555651	attL	GGAGCGCCAGCGCAA	NA	NA	NA	NA
WP_013419073.1|1560925_1561507_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_013419074.1|1561871_1562216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419075.1|1562216_1562786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942375.1|1562800_1563328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942377.1|1563648_1567158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419078.1|1567230_1567992_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_013419079.1|1568505_1569408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041787329.1|1569518_1569917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419080.1|1569913_1570396_+	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	35.3	9.5e-15
WP_013419081.1|1570392_1571304_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013419082.1|1571296_1572325_-	P63C domain-containing protein	NA	A0A0M4S6X1	Salmonella_phage	36.0	1.7e-53
WP_013419083.1|1572411_1572654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419084.1|1572663_1572957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419086.1|1573636_1573849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081449409.1|1573955_1574366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013419089.1|1575682_1579648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081449410.1|1579678_1580077_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013419090.1|1580034_1581642_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.0	1.1e-102
WP_169309586.1|1581701_1582052_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013419092.1|1582051_1582495_-	IS66 family insertion sequence hypothetical protein	NA	Q76S41	Shigella_phage	53.1	1.7e-05
WP_081449411.1|1582506_1583190_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013419093.1|1583186_1583633_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013419094.1|1583629_1583911_-	hypothetical protein	NA	NA	NA	NA	NA
1583763:1583777	attR	TTGCGCTGGCGCTCC	NA	NA	NA	NA
WP_041787332.1|1584395_1585442_+	hypothetical protein	NA	NA	NA	NA	NA
1583763:1583777	attR	TTGCGCTGGCGCTCC	NA	NA	NA	NA
WP_013419096.1|1585667_1587452_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_041787200.1|1587933_1588341_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_013419097.1|1588337_1588685_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	56.1	3.9e-34
WP_013419098.1|1588781_1590365_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.8	1.9e-104
WP_013419099.1|1590677_1591562_+	DUF1738 domain-containing protein	NA	D6PF71	uncultured_phage	32.6	1.6e-36
WP_013419100.1|1591687_1592653_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013419101.1|1592684_1593596_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_081449413.1|1593660_1593990_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_041788568.1|1594032_1594293_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_041788570.1|1594864_1595089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419105.1|1595085_1595253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419106.1|1595249_1595447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419107.1|1595443_1595653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419108.1|1595649_1596303_+	hypothetical protein	NA	A0A1W6DX30	Sphingobium_phage	38.0	2.9e-22
WP_013419110.1|1596663_1597116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419111.1|1597099_1597807_-	ParA family protein	NA	NA	NA	NA	NA
WP_013419112.1|1598150_1599206_+	plasmid encoded RepA protein	NA	NA	NA	NA	NA
WP_155942378.1|1599636_1600782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419114.1|1600762_1601173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155942379.1|1601461_1601623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419116.1|1601632_1602286_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_013419117.1|1602272_1603544_-	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	32.4	2.4e-09
WP_013419118.1|1603895_1605017_+	Fic family protein	NA	NA	NA	NA	NA
WP_013419120.1|1605388_1606570_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	33.2	5.3e-43
WP_013419121.1|1606962_1607367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419122.1|1607350_1607635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419123.1|1607631_1608102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013419124.1|1608098_1608608_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_013419125.1|1608611_1608815_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013419126.1|1608827_1609751_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	44.7	8.1e-47
WP_013419127.1|1609747_1610743_-	YqaJ viral recombinase family protein	NA	I6NV42	Burkholderia_virus	36.8	9.1e-44
WP_013419128.1|1610920_1611550_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013419130.1|1612451_1613873_+	DEAD/DEAH box helicase	NA	A0A193GYQ8	Enterobacter_phage	42.6	5.5e-95
WP_041787342.1|1613921_1614152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419132.1|1614151_1614571_+	VRR-NUC domain-containing protein	NA	A0A193GYR3	Enterobacter_phage	43.4	8.8e-17
WP_013419133.1|1614567_1617117_+	toprim domain-containing protein	NA	H9C0J7	Bdellovibrio_phage	30.1	1.8e-72
WP_013418084.1|1617134_1618718_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	3.9e-105
WP_013419097.1|1618814_1619162_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	56.1	3.9e-34
WP_041787200.1|1619158_1619566_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_013419134.1|1620237_1620954_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_155942382.1|1620899_1621328_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	48.7	9.3e-30
WP_013419136.1|1621362_1623357_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_155942383.1|1623353_1624481_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.6	5.2e-88
WP_013419138.1|1624928_1625129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081449564.1|1625140_1625947_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	50.0	4.9e-56
WP_013419140.1|1626294_1626489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041787348.1|1626571_1626952_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	43.6	1.6e-20
WP_013419142.1|1627040_1627613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787350.1|1628166_1628358_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_013419143.1|1628438_1630460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419144.1|1630969_1632601_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013419145.1|1632597_1633737_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_013419146.1|1634302_1635073_-	helix-turn-helix domain-containing protein	NA	K4I1D2	Acidithiobacillus_phage	55.9	5.6e-25
WP_013419147.1|1635069_1635288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081449415.1|1635631_1635988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787352.1|1637311_1638277_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_049779262.1|1638405_1638993_+	OmpA family protein	NA	NA	NA	NA	NA
WP_041787200.1|1639862_1640270_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_013418084.1|1640711_1642295_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	3.9e-105
>prophage 4
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	1917299	1959817	4014469	transposase,protease,integrase,tRNA	Stx2-converting_phage(28.57%)	39	1918256:1918274	1967573:1967591
WP_013419391.1|1917299_1918331_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1918256:1918274	attL	TCCAATCCATCATGGGTGC	NA	NA	NA	NA
WP_013419392.1|1918447_1919551_+|integrase	site-specific integrase	integrase	I6NSG1	Burkholderia_phage	55.3	8.9e-109
WP_049779298.1|1919563_1920004_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155942398.1|1920154_1920301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787390.1|1920303_1920510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419395.1|1920921_1921479_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_155942399.1|1921587_1921725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942400.1|1922087_1923002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419398.1|1923848_1924772_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013419399.1|1924768_1925722_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013419400.1|1925752_1927045_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_013419401.1|1927142_1928063_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_013419402.1|1928079_1928769_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_013419403.1|1928832_1930179_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_013419404.1|1930178_1930934_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_013419405.1|1930917_1933422_-	transporter	NA	NA	NA	NA	NA
WP_013419406.1|1933430_1933718_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_013419407.1|1933717_1934056_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_013419408.1|1934060_1935026_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_041787395.1|1935024_1935207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419409.1|1935568_1935874_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013419090.1|1936014_1937622_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.0	1.1e-102
WP_169309586.1|1937681_1938032_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013419092.1|1938031_1938475_-	IS66 family insertion sequence hypothetical protein	NA	Q76S41	Shigella_phage	53.1	1.7e-05
WP_155942401.1|1939242_1939938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049779301.1|1940880_1945617_-	DEAD/DEAH box helicase family protein	NA	I3PUW5	Vibrio_phage	36.8	5.9e-258
WP_049779302.1|1945602_1946043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419412.1|1946039_1946324_-	TnpV protein	NA	NA	NA	NA	NA
WP_013419413.1|1946521_1946872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419414.1|1947206_1947566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419415.1|1947579_1948335_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_013419416.1|1948303_1948819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013419417.1|1948861_1949497_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155942403.1|1950837_1951182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787398.1|1952025_1952433_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_013419421.1|1952853_1954125_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	29.5	1.6e-24
WP_013419422.1|1954239_1954725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049779305.1|1955496_1956819_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_013419090.1|1958209_1959817_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.0	1.1e-102
1967573:1967591	attR	TCCAATCCATCATGGGTGC	NA	NA	NA	NA
>prophage 5
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	2185399	2230850	4014469	protease,integrase	Erwinia_phage(20.0%)	38	2185746:2185760	2231757:2231771
WP_013419623.1|2185399_2186560_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
2185746:2185760	attL	GCACGCTGATCGTGC	NA	NA	NA	NA
WP_155942416.1|2186730_2189118_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_013419625.1|2189218_2190271_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_013419626.1|2190282_2190795_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_013419627.1|2190811_2191612_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_013419628.1|2191608_2192508_+	UDP-2,3-diacylglucosamine diphosphatase LpxI	NA	NA	NA	NA	NA
WP_013419629.1|2192923_2193310_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_013419630.1|2193574_2194087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419631.1|2194480_2195332_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_013419632.1|2195421_2196735_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	31.9	2.3e-47
WP_013419633.1|2196727_2197300_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_013419634.1|2197392_2197986_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_013419635.1|2198005_2198485_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_013419636.1|2198486_2199137_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_013419637.1|2199099_2199471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013419638.1|2199608_2200340_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_049779341.1|2200528_2201842_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_013419640.1|2202005_2205449_+	helicase	NA	A0A248SJQ0	Salicola_phage	32.7	2.0e-26
WP_013419641.1|2205445_2205763_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_013419643.1|2206463_2207831_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.0	8.3e-80
WP_013419644.1|2208656_2209061_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_013419645.1|2209198_2210617_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_041788897.1|2212867_2213518_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_013419648.1|2213761_2214106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041788902.1|2214145_2216428_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.2	4.5e-54
WP_155942417.1|2216597_2217002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787456.1|2216973_2217174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049779345.1|2217254_2217923_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081449567.1|2218146_2219295_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013419651.1|2219302_2222455_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_013419652.1|2222457_2223996_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_013419653.1|2224587_2224791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041787457.1|2224952_2226392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041787458.1|2226388_2226670_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041787459.1|2226749_2227769_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041787768.1|2227772_2228390_+	recombinase family protein	NA	NA	NA	NA	NA
WP_049779347.1|2228335_2229397_+	recombinase family protein	NA	NA	NA	NA	NA
WP_013419654.1|2229578_2230850_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1W6JPG6	Morganella_phage	29.1	7.8e-32
2231757:2231771	attR	GCACGCTGATCGTGC	NA	NA	NA	NA
>prophage 6
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	2666756	2709881	4014469	transposase,integrase,tRNA	Stx2-converting_phage(21.43%)	40	2684209:2684225	2722002:2722018
WP_013420046.1|2666756_2667554_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.3	2.7e-59
WP_049779399.1|2667477_2668020_-	hypothetical protein	NA	A0A218MNF2	uncultured_virus	55.4	1.1e-40
WP_155942445.1|2668021_2668480_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	51.2	1.0e-26
WP_013420048.1|2668522_2668729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013418084.1|2669561_2671145_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	3.9e-105
WP_013420049.1|2671241_2671589_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.1	2.5e-33
WP_041787200.1|2671585_2671993_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_013420050.1|2672280_2672499_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013420051.1|2672603_2672789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169309547.1|2673142_2673541_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	4.9e-09
WP_169309548.1|2673506_2673680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013420052.1|2673758_2675891_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155942447.1|2677440_2678715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420055.1|2679065_2680631_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013420056.1|2680871_2681840_-	GDP-mannose 4,6-dehydratase	NA	NA	NA	NA	NA
WP_013420057.1|2681856_2682834_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	56.0	1.1e-97
WP_013420058.1|2683168_2684584_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	2.2e-59
2684209:2684225	attL	CGAGGCACGCGCGCGGA	NA	NA	NA	NA
WP_013420059.1|2684586_2685894_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_013420060.1|2686002_2687157_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_013420061.1|2687448_2688825_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013420062.1|2688821_2689835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420063.1|2689834_2691139_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013420064.1|2691184_2691586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420065.1|2691855_2692980_+	WcbD protein	NA	NA	NA	NA	NA
WP_013420066.1|2692972_2693770_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041787573.1|2694003_2695089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420068.1|2695085_2695769_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	8.8e-06
WP_013420069.1|2695775_2697113_+	glycosyltransferase family 4 protein	NA	K9ME50	Sulfolobus_virus	29.3	6.3e-08
WP_013419092.1|2697424_2697868_+	IS66 family insertion sequence hypothetical protein	NA	Q76S41	Shigella_phage	53.1	1.7e-05
WP_169309586.1|2697867_2698218_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013420070.1|2698277_2699882_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.8	1.8e-102
WP_155942569.1|2700728_2702228_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_013420073.1|2702650_2703049_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_013420074.1|2703048_2703282_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013420075.1|2703359_2705216_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_013420076.1|2705212_2705491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013420077.1|2705745_2707530_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_013420078.1|2707585_2707834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013420079.1|2707915_2708638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013420080.1|2708597_2709881_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	29.1	3.1e-28
2722002:2722018	attR	CGAGGCACGCGCGCGGA	NA	NA	NA	NA
>prophage 8
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	3064774	3073126	4014469	transposase	Porcine_endogenous_retrovirus(14.29%)	7	NA	NA
WP_013420400.1|3064774_3065740_+|transposase	IS481 family transposase	transposase	Q8UM96	Porcine_endogenous_retrovirus	31.0	5.6e-06
WP_013420401.1|3066331_3067738_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	46.0	4.4e-52
WP_013420402.1|3067824_3068922_-	RNA-directed DNA polymerase	NA	A0A1I9KFG3	Aeromonas_phage	38.3	1.9e-55
WP_013420403.1|3068966_3069275_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	43.4	4.5e-10
WP_013420404.1|3069283_3069580_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	51.0	1.2e-20
WP_013420405.1|3069643_3070009_-	diversity-generating retroelement protein Avd	NA	D4HTV8	Vibrio_phage	29.8	1.6e-06
WP_013420406.1|3070117_3073126_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	36.5	6.8e-34
>prophage 9
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	3401356	3453967	4014469	transposase,integrase	Pseudomonas_phage(16.67%)	39	3413920:3413979	3453968:3455113
WP_013420693.1|3401356_3402625_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	41.7	6.7e-76
WP_013420694.1|3402762_3403005_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013420695.1|3403108_3404533_+	DUF3987 domain-containing protein	NA	A0A2P1CA42	Pseudomonas_phage	47.3	4.7e-110
WP_013420696.1|3404878_3405574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420697.1|3406167_3406863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155942483.1|3406935_3407334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420700.1|3407968_3408535_-	phosphatidylethanolamine N-methyltransferase family protein	NA	NA	NA	NA	NA
WP_013420701.1|3408655_3409657_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013420702.1|3409853_3411716_-	Na+/solute symporter	NA	NA	NA	NA	NA
WP_013420703.1|3411717_3411978_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_013420704.1|3412136_3412817_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013420705.1|3412968_3413565_-	metallophosphoesterase family protein	NA	A0A292GAJ3	Xanthomonas_phage	40.8	2.9e-29
3413920:3413979	attL	CTAGTGCACTGACGCAAACATAGGATTCACAAAGCAGACGAAGCAAGGCATGCTTCAGGC	NA	NA	NA	NA
WP_013417725.1|3413979_3415065_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155942484.1|3415030_3415357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013420707.1|3415904_3416981_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013420708.1|3417153_3417735_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.3	1.1e-25
WP_013420709.1|3417985_3420313_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	25.3	8.4e-24
WP_013420710.1|3420327_3421431_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013420711.1|3421427_3422876_-	N-6 DNA methylase	NA	A0A1V0SLK8	Klosneuvirus	29.0	3.7e-22
WP_013420712.1|3423166_3424012_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049779482.1|3424916_3425960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169309568.1|3426584_3426746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420714.1|3426877_3427369_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013420715.1|3427489_3428692_+	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	33.2	1.0e-20
WP_155942583.1|3429914_3431500_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	5.0e-105
WP_013419097.1|3431596_3431944_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	56.1	3.9e-34
WP_041787200.1|3431940_3432348_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	53.3	1.1e-06
WP_013420716.1|3433295_3433592_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	46.6	5.8e-15
WP_013420717.1|3433602_3433887_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013420718.1|3434021_3434627_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_081449501.1|3434645_3435545_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_013420721.1|3435776_3436232_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	49.0	8.3e-37
WP_013420722.1|3436354_3436861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081449575.1|3438181_3438424_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013420725.1|3439533_3441999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013420726.1|3442009_3445210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041787757.1|3445652_3446786_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013420730.1|3448483_3449416_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_013417725.1|3452881_3453967_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3453968:3455113	attR	GCCTGAAGCATGCCTTGCTTCGTCTGCTTTGTGAATCCTATGTTTGCGTCAGTGCACTAGATTCCGCCAGGAGATTGGGGATTTCGCAAGCGGCGCGCGCGAAGGCGCCGCCTGCGTCTACCCGGGTAGATTTCTGCCAGCCCTATTTCACTATCAGCTCGGTCTACTGATGCATGGCGAGGTGTTCCTGGAGGACTTCAATGGCGGCCATAGCTACATCAGGGCCGCAGGAGGCAGCAGCGGTCGCAAGCTTTTGCAGCAGGACATCGGGGTCCTGGTACTTCAACCGCTCCTCCAGCGTCATGCTGCCCATAAAGTCGCCGCAGATAAGCTCCAGGGCGACGTTGTCGTGAGCGGTTCCGGTGTCATGCTTCACCTTTTCGAGAGCCAACTCTACAATTTCGGCCTGCCCCTGATAAAGGCGAAAGGTCTTGACCTGTTTTTGCTCCTCGCCCGCTTCCAGGCTCTTGCCTTTCGCTTTCGCCTTCCGGACGAGTTCGTTGAGGTCACCCCTCGACATCTTTTCTGCCGCCTCAAGCCACTCCGCTGCGTTTTCGGGGGTAACGACGCCTGAGATCGCACGCAGCTTGGTCCAGCCGATGGCTTCAAGCTGCGCGGCAGAAATCTTGCAATTCGAAAGCACGTCGTAGATGCGCATCAATACGCTCTCGCCCGCCTGATGCCCTTTCCCTTCTCGAGCCATTCATTAAAGGACGAGTAAGGAGCGAACCAGCCCTCTCGTTTCACGCGCAATAGCCGACCACCCATGCGGAAGGCCGTCTTGTCGTAAAGATTTGCCGAGGAGTCGATATCGCTCAGGGTCTCTTCGAGATCTGCGTTCTCGATTTCATGAACGATGTCGCCAAGTTCGCTGTCGTAGGGCTCGGTCCATCCGGCAGGCGCGGGAAGGCTCGTCTCCGGCGCCTCAATTTGAAGCGCCGCTTCGACAAGCGCATCGTGACCAATAGGCACGCTTGCATCCTTCGGCCGAGTTATCTTCTTCTTGAAGGTGACGATCATTTGCGGAGGCCTTTCCTGGAAAATGGAGAGGCACCGGCACGCCTGCCGAAAGACATAGAGAGCCCCGAACAGTTTTCATGTCGGTGCCCTCCTTGGCTATGGCCAGACATCTGAGAACTCGGGATG	NA	NA	NA	NA
>prophage 10
NC_014664	Rhodomicrobium vannielii ATCC 17100, complete sequence	4014469	3635369	3643433	4014469		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_013420880.1|3635369_3636407_+	peptidoglycan-binding protein	NA	A0A1Y0T0G4	Sinorhizobium_phage	48.0	5.7e-33
WP_013420881.1|3636421_3636769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420882.1|3636765_3637053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013420883.1|3637135_3637516_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	43.0	2.5e-10
WP_013420884.1|3638030_3638579_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	69.2	1.4e-43
WP_155942588.1|3638837_3641588_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.3	2.3e-97
WP_013420886.1|3641605_3642130_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_013420887.1|3642329_3642881_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.4	1.0e-41
WP_013420888.1|3642968_3643433_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.3	1.9e-36
