The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018528	Lactobacillus helveticus R0052, complete sequence	2129206	34492	105819	2129206	protease,bacteriocin,integrase,transposase	Streptococcus_phage(12.5%)	59	26204:26218	113841:113855
26204:26218	attL	TTAAAATTATTGATT	NA	NA	NA	NA
WP_014918011.1|34492_35692_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1Q1PVS7	Staphylococcus_phage	31.6	1.0e-09
WP_014918012.1|36106_37393_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.1	8.2e-106
WP_014918013.1|37649_38003_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_003624837.1|37999_38200_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014918014.1|38367_39006_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	2.2e-19
WP_014918015.1|39002_39761_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_014918016.1|40782_42042_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_051001671.1|42087_42627_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014918018.1|42730_44023_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_014918021.1|45275_45746_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	48.0	2.4e-31
WP_014918022.1|45761_46238_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	69.2	1.7e-56
WP_014562800.1|47115_48516_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014562801.1|48612_49386_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_014918025.1|49424_49985_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014562803.1|49985_50510_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014562804.1|50511_50904_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_014918026.1|50921_53156_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.2	2.5e-89
WP_014918027.1|53410_54445_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014918028.1|54441_55014_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_162470548.1|55180_55363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918029.1|55431_55770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014918030.1|56027_56789_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.8	5.0e-18
WP_014918031.1|56785_57682_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014918032.1|57678_58671_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014918033.1|59009_59717_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_107775352.1|59773_61240_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	NA	NA	NA	NA
WP_014918035.1|61365_62187_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014918037.1|62621_62906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918038.1|62964_63978_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	1.3e-50
WP_014918039.1|64104_64947_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_014918040.1|65295_66123_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.5	2.6e-97
WP_014918041.1|67683_70515_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	24.9	1.2e-29
WP_014918042.1|70554_71565_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014918043.1|71860_72274_+	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	39.4	6.9e-06
WP_138427588.1|77685_77994_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_014918046.1|79069_79699_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080588337.1|79873_80701_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014918048.1|81027_81897_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014918049.1|81893_82841_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_014918050.1|82852_83809_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_014918051.1|83827_84664_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_014918052.1|84765_85524_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014918054.1|85986_86718_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014918055.1|87247_87469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014918056.1|87797_88514_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	3.3e-40
WP_041808893.1|88580_90437_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.6	2.3e-32
WP_014918058.1|90426_91776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918059.1|91778_92603_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_014918060.1|92618_93416_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.1	2.0e-30
WP_014918061.1|93502_94744_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.1e-17
WP_014918062.1|95222_95702_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_014918064.1|97574_98453_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014918065.1|98595_99573_+|bacteriocin	class III bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014918066.1|99655_100747_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014918067.1|100875_101760_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_014918068.1|101768_102422_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_041808618.1|102425_103775_-	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	21.1	1.1e-10
WP_014562851.1|103947_104889_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014918070.1|104922_105819_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
113841:113855	attR	AATCAATAATTTTAA	NA	NA	NA	NA
>prophage 2
NC_018528	Lactobacillus helveticus R0052, complete sequence	2129206	560422	569189	2129206		Prochlorococcus_phage(33.33%)	9	NA	NA
WP_014563196.1|560422_560908_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.4	2.8e-22
WP_014918431.1|560873_562049_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_014918432.1|562252_562969_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	38.3	3.7e-39
WP_014918433.1|562969_563224_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014918434.1|563220_563892_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014918435.1|563888_566117_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	2.3e-143
WP_014918436.1|566092_567544_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	5.3e-61
WP_014918437.1|567545_568583_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.2	1.5e-60
WP_014918438.1|568592_569189_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	3.3e-25
>prophage 3
NC_018528	Lactobacillus helveticus R0052, complete sequence	2129206	815248	823700	2129206		uncultured_virus(16.67%)	8	NA	NA
WP_014918614.1|815248_815908_+	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.4	3.1e-08
WP_014918615.1|815900_816701_+	SGNH/GDSL hydrolase family protein	NA	Q6SEC0	Lactobacillus_prophage	23.9	9.3e-07
WP_014918616.1|816715_817342_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_014918617.1|817492_817756_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_012212011.1|817818_818037_+	YneF family protein	NA	NA	NA	NA	NA
WP_014918618.1|818118_819876_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.6	7.7e-46
WP_014918619.1|819868_821662_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.3	5.3e-18
WP_014918620.1|821756_823700_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	2.7e-60
>prophage 4
NC_018528	Lactobacillus helveticus R0052, complete sequence	2129206	1791850	1855830	2129206	bacteriocin,transposase	Clostridioides_phage(14.29%)	58	NA	NA
WP_014919390.1|1791850_1793128_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	8.4e-10
WP_014919391.1|1793175_1793607_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
WP_014919392.1|1793816_1794587_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_051001685.1|1794579_1794795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919394.1|1796447_1796684_-	transferase	NA	A0A191KBJ5	Streptococcus_virus	65.3	3.7e-20
WP_014919395.1|1796888_1798340_-	flippase	NA	NA	NA	NA	NA
WP_014919396.1|1798336_1799467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158310017.1|1799484_1799640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919397.1|1799702_1800197_-	acyltransferase	NA	NA	NA	NA	NA
WP_014919398.1|1800193_1800721_-	glycosyltransferase in exopolysaccharide biosynthesis	NA	A0A1V0SGD8	Hokovirus	31.4	1.6e-07
WP_014919399.1|1800705_1800921_-	lipase chaperone	NA	NA	NA	NA	NA
WP_014919400.1|1800921_1801947_-	glycosyltransferase family 2 protein	NA	A0A1V0S9B9	Catovirus	26.8	7.0e-07
WP_041808829.1|1801933_1803037_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051001686.1|1803042_1803597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051001687.1|1803614_1805006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919402.1|1805014_1805515_-	multidrug MFS transporter	NA	NA	NA	NA	NA
WP_014919403.1|1805527_1805977_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_014919404.1|1805991_1806642_-	sugar transferase	NA	NA	NA	NA	NA
WP_014919405.1|1806760_1807531_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014919406.1|1807530_1808325_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_014919407.1|1808335_1809223_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012212250.1|1809234_1810296_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	2.5e-15
WP_014919408.1|1810776_1812042_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014919411.1|1813279_1814212_-	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	36.9	2.0e-13
WP_023061786.1|1814361_1814607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919414.1|1815856_1816753_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014919415.1|1816740_1818405_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.6	4.0e-20
WP_014919416.1|1818412_1819123_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_014919417.1|1820532_1820898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919418.1|1821154_1821904_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_014919419.1|1821938_1822985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919420.1|1823072_1825490_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_014919425.1|1828033_1829377_-	PFL family protein	NA	NA	NA	NA	NA
WP_014919426.1|1829389_1829659_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_014919428.1|1830696_1831473_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	1.3e-18
WP_051001688.1|1832389_1833973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014919431.1|1833905_1834556_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	45.2	5.2e-40
WP_023062121.1|1834621_1834942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192438.1|1834989_1835199_-	Protein of unknown function	NA	NA	NA	NA	NA
WP_014919432.1|1835293_1836469_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.0e-123
WP_003627295.1|1836597_1836867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919433.1|1836960_1837512_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	45.2	3.3e-19
WP_014919434.1|1837703_1838249_-	AAA family ATPase	NA	A0A0K2FM14	Brevibacillus_phage	29.4	1.6e-10
WP_014919435.1|1838343_1838643_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_014919436.1|1838735_1840250_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_148271901.1|1840326_1841556_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	4.6e-122
WP_014919438.1|1841696_1842320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919439.1|1842337_1842862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041808833.1|1844493_1845243_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_014919443.1|1846832_1847318_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014564215.1|1847320_1848091_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014919444.1|1848101_1849643_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.4e-43
WP_014919445.1|1849651_1850029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919446.1|1850162_1850720_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014919447.1|1851477_1852719_-	LCP family protein	NA	NA	NA	NA	NA
WP_014919448.1|1852880_1854677_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_041808836.1|1854680_1854944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014919449.1|1855557_1855830_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 5
NC_018528	Lactobacillus helveticus R0052, complete sequence	2129206	1905719	1981828	2129206	integrase,bacteriocin,transposase	Acinetobacter_phage(30.77%)	50	1958825:1958882	1994065:1994122
WP_014919494.1|1905719_1906523_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.4	4.2e-84
WP_014919495.1|1906873_1908082_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_014564267.1|1908171_1908366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564268.1|1908404_1909898_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.7	9.0e-72
WP_014564269.1|1910007_1912542_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	2.0e-71
WP_014919496.1|1912748_1913108_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_014919497.1|1913170_1914151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919498.1|1914300_1915548_+	MFS transporter	NA	NA	NA	NA	NA
WP_014919503.1|1917614_1918889_+	MFS transporter	NA	NA	NA	NA	NA
WP_051001690.1|1919000_1919873_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014919508.1|1922283_1922832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014919511.1|1924745_1925015_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014919512.1|1925090_1927259_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.9e-171
WP_005720082.1|1927251_1927677_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_014919513.1|1927657_1928665_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	3.5e-96
WP_003618609.1|1932311_1932785_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014564286.1|1932938_1935224_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014919517.1|1935201_1936134_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_014564289.1|1937504_1938539_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.5e-36
WP_014564290.1|1938754_1939831_+	guanine permease	NA	NA	NA	NA	NA
WP_014564291.1|1939833_1940391_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014919521.1|1941992_1942535_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003630368.1|1942608_1943598_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003630369.1|1943645_1944404_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_014919522.1|1944462_1945233_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_014564296.1|1945225_1946068_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_014919523.1|1946048_1947428_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_014919524.1|1947441_1947858_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_013855208.1|1947862_1948333_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_014564299.1|1948336_1949566_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014564300.1|1949587_1950319_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	1.8e-12
WP_014919525.1|1950318_1951236_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013855204.1|1951245_1951488_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_014919526.1|1951546_1952530_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014564303.1|1952526_1952994_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014919527.1|1953023_1953470_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_014564315.1|1956358_1957198_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
1958825:1958882	attL	AGGGCCTAGTACTTTTGGAATGGAAATACTTTCCAACACCAAAAATTCTAGACCCGAT	NA	NA	NA	NA
WP_014919531.1|1958944_1961212_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.9	2.5e-126
WP_014919533.1|1962169_1962703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014919535.1|1964212_1965562_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.4	1.9e-121
WP_014564315.1|1967252_1968092_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014919539.1|1971080_1971320_+|integrase	integrase core domain-containing protein	integrase	NA	NA	NA	NA
WP_174225720.1|1971437_1972694_-	MFS transporter	NA	NA	NA	NA	NA
WP_014919543.1|1974789_1975815_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.9	2.9e-61
WP_014919544.1|1975811_1976591_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	37.8	1.7e-37
WP_014919545.1|1976593_1977181_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_014919546.1|1977177_1978398_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_014919547.1|1978390_1979185_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_107775355.1|1979560_1980955_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014919549.1|1980970_1981828_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1994065:1994122	attR	ATCGGGTCTAGAATTTTTGGTGTTGGAAAGTATTTCCATTCCAAAAGTACTAGGCCCT	NA	NA	NA	NA
