The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017451	Haemophilus influenzae R2866, complete genome	1932306	473002	575672	1932306	tail,head,transposase,tRNA,integrase,holin,portal,capsid,terminase	Haemophilus_virus(61.11%)	95	488960:488978	575875:575893
WP_020910009.1|473002_473788_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	NA	NA	NA	NA
WP_005668507.1|473772_474882_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_005668505.1|475276_477412_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_020910010.1|484019_486254_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005667927.1|486614_487244_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005667925.1|487571_488861_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.1	2.5e-94
488960:488978	attL	AAAATTGACCGCACTTTGT	NA	NA	NA	NA
WP_005654245.1|489027_489369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005628250.1|489458_489938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005667922.1|489939_490710_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_005667920.1|490837_492100_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005667917.1|492380_493769_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005649657.1|493993_497014_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.0	3.9e-21
WP_005649659.1|497114_498416_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005649661.1|498587_500051_-	ATPase	NA	A0A1B3AYT3	Gordonia_phage	30.9	4.1e-45
WP_005649662.1|500179_502552_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	1.8e-21
WP_005649665.1|502731_503487_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_020910013.1|503783_505679_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.2e-115
WP_005667911.1|505757_506102_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_020910014.1|506129_507263_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005667908.1|507264_507945_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_005667906.1|507979_509035_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	3.7e-27
WP_020910015.1|509036_510473_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005667903.1|510674_511673_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005667901.1|511824_512106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005667899.1|512306_513062_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005649695.1|513411_513732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005667897.1|513933_515040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005667894.1|515161_516421_+	GntP family permease	NA	NA	NA	NA	NA
WP_005667892.1|516429_517566_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.1	5.0e-54
WP_005667890.1|517605_518319_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005649704.1|518642_521090_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_005667888.1|521102_522047_+	homoserine kinase	NA	NA	NA	NA	NA
WP_005649711.1|522089_523367_+	threonine synthase	NA	NA	NA	NA	NA
WP_005667766.1|523931_524945_-|integrase	site-specific integrase	integrase	Q94N03	Haemophilus_virus	100.0	7.5e-195
WP_005667764.1|524944_525709_-	hypothetical protein	NA	P79672	Haemophilus_phage	100.0	6.3e-138
WP_005667762.1|525718_525901_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	45.8	3.5e-10
WP_005667760.1|525900_526476_-	phage repressor protein CI	NA	Q94N02	Haemophilus_virus	100.0	6.1e-109
WP_005667758.1|526594_526807_+	hypothetical protein	NA	P79674	Haemophilus_phage	100.0	1.2e-30
WP_015967400.1|526942_527446_+	hypothetical protein	NA	P79675	Haemophilus_phage	100.0	1.8e-88
WP_005667757.1|527464_527833_+	hypothetical protein	NA	Q94N01	Haemophilus_virus	100.0	1.6e-67
WP_005667755.1|527832_528018_+	hypothetical protein	NA	Q775F8	Haemophilus_virus	100.0	8.0e-31
WP_015967401.1|528029_528311_+	hypothetical protein	NA	Q775F7	Haemophilus_virus	100.0	6.1e-46
WP_005667751.1|528361_528622_+	hypothetical protein	NA	Q775F6	Haemophilus_virus	100.0	3.6e-45
WP_005667749.1|528624_530952_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	100.0	0.0e+00
WP_005667746.1|530963_531275_+	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	100.0	2.9e-49
WP_005667744.1|531284_531803_+	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	100.0	4.6e-100
WP_005667742.1|531898_532075_+	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	67.8	4.5e-15
WP_005642973.1|532103_532505_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	100.0	2.3e-70
WP_071819916.1|532531_532792_-	ogr/Delta-like zinc finger family protein	NA	Q1I103	Pasteurella_virus	58.1	2.4e-25
WP_005667739.1|532870_533908_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	100.0	1.3e-199
WP_015967402.1|533897_535721_-|terminase	terminase ATPase subunit family protein	terminase	Q94MZ6	Haemophilus_virus	100.0	0.0e+00
WP_005667735.1|535924_536818_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	100.0	1.5e-151
WP_005667734.1|536820_537831_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	100.0	1.4e-188
WP_005667733.1|537844_538690_+|terminase	terminase endonuclease subunit	terminase	Q94MZ3	Haemophilus_virus	100.0	1.3e-155
WP_005667732.1|538682_539135_+|head	head completion/stabilization protein	head	Q94MZ2	Haemophilus_virus	100.0	3.3e-78
WP_005667731.1|539122_539608_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	100.0	2.0e-89
WP_005667730.1|539597_540293_+	hypothetical protein	NA	Q94MZ0	Haemophilus_virus	100.0	1.3e-126
WP_015967404.1|540564_541695_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	100.0	2.6e-220
WP_005667727.1|541698_542151_+	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	100.0	6.9e-76
WP_005667726.1|542237_542474_+|holin	holin	holin	Q94MY7	Haemophilus_virus	100.0	4.8e-36
WP_005667725.1|542466_543027_+	lysozyme	NA	Q94MY6	Haemophilus_virus	100.0	7.2e-99
WP_005667724.1|543011_543359_+	hypothetical protein	NA	Q94MY5	Haemophilus_virus	100.0	1.0e-55
WP_005667723.1|543551_543860_+	hypothetical protein	NA	Q775G2	Haemophilus_virus	100.0	1.2e-47
WP_005667722.1|543868_544039_+	hypothetical protein	NA	Q1I0Y8	Pasteurella_virus	76.8	4.2e-18
WP_005667721.1|544048_546178_+	hypothetical protein	NA	Q94MY4	Haemophilus_virus	100.0	0.0e+00
WP_005667720.1|546181_546517_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	100.0	6.1e-53
WP_020910021.1|546509_547679_+	hypothetical protein	NA	Q94MY2	Haemophilus_virus	100.0	2.3e-219
WP_005667718.1|547688_548216_+	hypothetical protein	NA	Q94MY1	Haemophilus_virus	100.0	7.5e-98
WP_015967408.1|548239_550972_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	100.0	0.0e+00
WP_005668720.1|550983_551616_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	100.0	1.6e-110
WP_005668718.1|551628_552396_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	100.0	1.5e-134
WP_005668715.1|552382_552943_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	100.0	3.3e-83
WP_005668713.1|552943_554545_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	100.0	1.1e-285
WP_005653466.1|555598_556375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005653468.1|556369_557182_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_020910023.1|557272_559180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020910024.1|559416_560121_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012564949.1|560436_561135_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044509710.1|561424_561712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005653495.1|561960_562152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020910025.1|562166_562757_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.2e-22
WP_020910026.1|562839_563283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020910027.1|563359_564121_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	29.8	4.4e-22
WP_020910028.1|564224_565178_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.3	1.4e-41
WP_005687602.1|565470_565719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005653503.1|565721_565955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044509376.1|566039_566396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048813163.1|566770_567214_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_005687598.1|567210_568152_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_005687597.1|568166_570167_+	integrating conjugative element protein	NA	I6NLI9	Burkholderia_phage	50.0	2.2e-28
WP_005667853.1|570182_570590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005667851.1|570634_570814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|571037_571898_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|571945_572503_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|572666_575672_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
575875:575893	attR	AAAATTGACCGCACTTTGT	NA	NA	NA	NA
>prophage 2
NC_017451	Haemophilus influenzae R2866, complete genome	1932306	987863	1003760	1932306	terminase,holin	Haemophilus_phage(38.89%)	22	NA	NA
WP_005666912.1|987863_988199_-	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	41.5	8.1e-13
WP_005650507.1|988201_989281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650509.1|989332_990031_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	84.5	1.4e-112
WP_005650512.1|990141_990330_+	DNA-binding protein	NA	Q7Y5W4	Haemophilus_phage	93.5	6.5e-28
WP_005650513.1|990378_990819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005650515.1|990865_991534_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.6	9.0e-56
WP_005650516.1|991530_992229_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	65.4	9.8e-61
WP_005650518.1|992225_992846_+	replication P	NA	A0A0M3LS65	Mannheimia_phage	39.1	1.9e-28
WP_005650520.1|992842_993067_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_005650522.1|993103_993523_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	75.4	1.9e-56
WP_005650527.1|994160_994826_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	42.8	2.9e-38
WP_005650528.1|994856_995228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005666914.1|995277_996243_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	58.8	1.2e-88
WP_005650531.1|996600_997242_+	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	40.9	5.5e-34
WP_005650535.1|997583_997940_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_020910072.1|997908_998511_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	54.9	1.1e-57
WP_005650540.1|998503_998839_+	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	56.1	1.2e-21
WP_005650541.1|998738_999020_+	hypothetical protein	NA	Q776X1	Haemophilus_phage	74.4	4.2e-31
WP_005650543.1|999058_999571_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	8.0e-20
WP_005650545.1|999557_1000901_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.5	4.1e-124
WP_005650547.1|1000902_1002234_+	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	82.9	4.9e-210
WP_005650554.1|1003583_1003760_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
>prophage 3
NC_017451	Haemophilus influenzae R2866, complete genome	1932306	1234783	1243297	1932306		Bacillus_virus(33.33%)	8	NA	NA
WP_005647463.1|1234783_1235467_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	6.6e-54
WP_005647466.1|1235459_1235885_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	7.8e-21
WP_005667416.1|1235885_1236521_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	35.2	2.9e-11
WP_020910113.1|1237132_1239316_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	1.9e-115
WP_020910114.1|1239435_1240407_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005667420.1|1240421_1241309_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005647479.1|1241318_1242311_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_005667422.1|1242313_1243297_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	3.2e-17
>prophage 4
NC_017451	Haemophilus influenzae R2866, complete genome	1932306	1702534	1798810	1932306	tail,head,tRNA,protease,plate,integrase,portal,capsid,terminase	Mannheimia_phage(43.9%)	88	1727564:1727584	1785296:1785316
WP_005648541.1|1702534_1704253_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005648542.1|1704337_1706197_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	1.5e-87
WP_005655473.1|1706198_1706504_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_005652274.1|1706601_1706718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005666280.1|1706765_1708013_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005648546.1|1708218_1708845_+	response regulator	NA	NA	NA	NA	NA
WP_005648547.1|1708906_1709347_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_005648548.1|1709350_1709911_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_005648549.1|1716157_1716712_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_005648552.1|1716887_1717925_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.5	8.9e-34
WP_005648554.1|1717914_1718604_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005648557.1|1718642_1719464_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_005668636.1|1719765_1720533_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005658559.1|1720562_1721141_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005668633.1|1721167_1721827_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005668631.1|1721829_1724601_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.4	5.1e-20
WP_005661551.1|1724795_1725545_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.5	2.4e-17
WP_005668629.1|1725774_1727544_+	L-fucose isomerase	NA	NA	NA	NA	NA
1727564:1727584	attL	AAAAAGTGCGGTCAAAAACAT	NA	NA	NA	NA
WP_005654478.1|1729043_1729478_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_005648575.1|1729497_1730148_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005668621.1|1730186_1731473_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_005668619.1|1732000_1732849_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.3	3.0e-32
WP_020910181.1|1732986_1734372_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005668493.1|1734510_1735326_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005648584.1|1735335_1736139_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_005668491.1|1736150_1737158_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005668490.1|1737231_1739763_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_005668488.1|1740068_1741280_+	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005668486.1|1741290_1742577_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_005668481.1|1743855_1744866_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	60.4	1.4e-116
WP_005668479.1|1744875_1746651_-	oxidoreductase	NA	A0A0M3LRV4	Mannheimia_phage	65.1	1.2e-216
WP_005668477.1|1746815_1747640_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	63.2	1.4e-66
WP_005668475.1|1747660_1748710_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.6	4.4e-89
WP_011272685.1|1748721_1749372_+|terminase	terminase	terminase	Q19US0	Mannheimia_phage	46.0	4.1e-45
WP_005668469.1|1749665_1750172_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	51.0	2.8e-33
WP_005668467.1|1750171_1750381_+|tail	tail protein	tail	E5G6M9	Salmonella_phage	40.6	4.5e-06
WP_005668464.1|1750382_1750604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668462.1|1750596_1751115_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	46.6	9.5e-37
WP_005668457.1|1751099_1751450_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_005633796.1|1751624_1751840_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.9	1.4e-10
WP_020910182.1|1751836_1752307_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	47.8	5.6e-28
WP_020910183.1|1752306_1752765_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	45.6	1.4e-23
WP_005668444.1|1752742_1753015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005668442.1|1753083_1755819_+|tail	phage tail tape measure protein	tail	K7RVY9	Vibrio_phage	35.9	1.4e-73
WP_005668440.1|1755919_1756474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005653088.1|1756482_1756911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668437.1|1757014_1757614_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_005663412.1|1757615_1757954_+	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.5e-19
WP_005663411.1|1757950_1758865_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	59.2	5.1e-94
WP_005663410.1|1758851_1759391_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	52.8	1.2e-50
WP_005668434.1|1759399_1761877_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	73.3	7.8e-270
WP_005668432.1|1761887_1762439_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	50.5	2.7e-42
WP_005668430.1|1762431_1762911_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.0	2.7e-46
WP_005663399.1|1763055_1764240_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.2	3.0e-102
WP_005663396.1|1764243_1764750_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	7.1e-53
WP_005668426.1|1764833_1765133_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	40.7	9.7e-10
WP_005633772.1|1765132_1765279_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_005668423.1|1765446_1765884_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	57.4	1.2e-40
WP_005668421.1|1765883_1767077_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	52.5	1.0e-105
WP_005668419.1|1767102_1767342_-	nuclease	NA	NA	NA	NA	NA
WP_032826233.1|1767338_1767827_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	44.3	4.2e-34
WP_005668415.1|1767856_1768564_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	36.2	4.8e-31
WP_005668413.1|1768699_1768939_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005633751.1|1769304_1769595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668410.1|1769686_1769947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668407.1|1769964_1770345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668404.1|1770348_1770591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005655052.1|1770716_1771025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020910187.1|1771034_1773221_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.5	1.2e-165
WP_005668397.1|1773239_1773431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668395.1|1773441_1773651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668393.1|1773664_1774186_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	7.3e-29
WP_013527358.1|1774424_1775480_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	36.2	2.2e-56
WP_005658606.1|1781860_1783324_-	potassium transporter	NA	NA	NA	NA	NA
WP_080000348.1|1783326_1783959_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.5	3.0e-24
WP_020910189.1|1784062_1784302_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	63.9	1.8e-06
WP_005633091.1|1784343_1785195_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005630808.1|1785362_1785752_-	RidA family protein	NA	NA	NA	NA	NA
1785296:1785316	attR	AAAAAGTGCGGTCAAAAACAT	NA	NA	NA	NA
WP_005687850.1|1785808_1786561_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005648601.1|1786711_1787269_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	26.1	2.6e-08
WP_005658616.1|1787270_1787687_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_020910190.1|1787830_1789066_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.7	1.7e-124
WP_005648605.1|1789075_1789657_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.8	5.8e-59
WP_006995277.1|1789779_1791078_-	trigger factor	NA	NA	NA	NA	NA
WP_020910191.1|1791378_1794642_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_020910192.1|1794695_1795550_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_020910193.1|1795568_1797428_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.3	3.1e-13
WP_020910194.1|1797424_1798810_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
