The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014632	Ilyobacter polytropus DSM 2926, complete sequence	2046464	243354	254066	2046464		Bacillus_virus(16.67%)	8	NA	NA
WP_013386672.1|243354_245646_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.1	7.0e-23
WP_013386673.1|245762_246341_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_013386674.1|246524_248690_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.1	2.4e-25
WP_013386675.1|248702_249200_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_013386676.1|249218_250427_+	CinA family nicotinamide mononucleotide deamidase-related protein	NA	B5TK85	Pseudomonas_phage	37.8	2.0e-16
WP_013386677.1|250426_250975_+	cupin domain-containing protein	NA	I3VYY8	Thermoanaerobacterium_phage	41.1	5.8e-08
WP_013386678.1|251003_251525_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	32.9	4.5e-10
WP_013386679.1|251546_254066_+	DegV family EDD domain-containing protein	NA	A0A0N9SI50	Staphylococcus_phage	40.4	2.0e-15
>prophage 2
NC_014632	Ilyobacter polytropus DSM 2926, complete sequence	2046464	473977	482421	2046464	tRNA	Orpheovirus(33.33%)	7	NA	NA
WP_013386875.1|473977_474742_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	4.9e-13
WP_013386876.1|474743_475445_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.5	7.6e-13
WP_013386877.1|475693_475918_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013386878.1|476033_477272_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	1.3e-79
WP_013386879.1|477292_478534_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.3	1.5e-16
WP_013386880.1|478568_480344_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	28.0	1.3e-16
WP_013386881.1|480708_482421_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.6	4.1e-76
>prophage 3
NC_014632	Ilyobacter polytropus DSM 2926, complete sequence	2046464	903529	913576	2046464		Paramecium_bursaria_Chlorella_virus(12.5%)	10	NA	NA
WP_013387257.1|903529_904459_-	GDP-L-fucose synthase	NA	A7IWS0	Paramecium_bursaria_Chlorella_virus	54.4	4.3e-96
WP_013387258.1|904512_905622_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3I398	Synechococcus_phage	66.2	7.3e-127
WP_013387259.1|905666_906890_-	WcaI family glycosyltransferase	NA	NA	NA	NA	NA
WP_013387260.1|907179_908649_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	34.3	2.4e-56
WP_013387261.1|908663_909602_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_013387262.1|909668_910439_+	glucose-1-phosphate cytidylyltransferase	NA	I7I009	Enterobacteria_phage	23.6	3.1e-07
WP_013387263.1|910466_911549_+	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	28.0	3.0e-16
WP_013387264.1|911545_912088_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	37.3	8.5e-20
WP_013387265.1|912107_913004_+	NAD(P)-dependent oxidoreductase	NA	A0A1V0SG19	Hokovirus	23.5	7.2e-08
WP_013387266.1|913027_913576_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	A0A218MN57	uncultured_virus	34.7	1.8e-22
>prophage 4
NC_014632	Ilyobacter polytropus DSM 2926, complete sequence	2046464	999191	1037308	2046464	integrase,bacteriocin,transposase	Lactococcus_phage(28.57%)	38	1027898:1027957	1037390:1038135
WP_083789061.1|999191_999485_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148223647.1|999463_1000369_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	4.7e-39
WP_013387355.1|1000372_1000774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387356.1|1001169_1001397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387357.1|1001396_1001882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387358.1|1002126_1003890_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_013387359.1|1004273_1005263_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013387360.1|1008172_1009675_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.1	2.9e-17
WP_013387361.1|1011229_1011919_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_013387362.1|1011959_1013288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387363.1|1013342_1014722_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_013387364.1|1015183_1015522_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_013387365.1|1015576_1016878_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	41.0	3.9e-71
WP_013387366.1|1016936_1017275_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_013387367.1|1017312_1017489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387368.1|1017657_1018830_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013387369.1|1018872_1019646_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013387370.1|1019669_1019891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387371.1|1020038_1020764_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_013387372.1|1020901_1022518_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_013387373.1|1022840_1023002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387374.1|1023388_1023811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387375.1|1023935_1024556_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013387376.1|1024637_1025666_-	potassium channel protein	NA	NA	NA	NA	NA
WP_013387377.1|1025870_1026233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387378.1|1026249_1027035_+|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_013387379.1|1027113_1027443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387380.1|1027532_1027862_+	hypothetical protein	NA	NA	NA	NA	NA
1027898:1027957	attL	CTTTTTATTATAGAAAAAGAAAACCACCTGCTCTGCAGGTGGACCCAAAATGCCGGAAGG	NA	NA	NA	NA
WP_013387381.1|1028038_1028506_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.9	2.3e-18
WP_013387382.1|1029491_1029788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387383.1|1029917_1030892_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	28.4	8.4e-10
WP_013387384.1|1030948_1031392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387385.1|1031402_1032083_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013387386.1|1032120_1032942_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	52.5	2.9e-27
WP_013387387.1|1033073_1033616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288113.1|1033654_1034452_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_013387389.1|1034572_1036636_-	glycogen-debranching protein	NA	NA	NA	NA	NA
WP_013387381.1|1036840_1037308_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.9	2.3e-18
1037390:1038135	attR	CCTTCCGGCATTTTGGGTCCACCTGCAGAGCAGGTGGTTTTCTTTTTCTATAATAAAAAGGCAGAATAAATTTCTGCCTTTTAAGCTAATGTCAATTAAGAGTTTATAAACCCCTATAATATTAACCTTTATTAATTTATTATCTTATTTATACTAAGTTTTATCAATTATTTGCTCGTATATGAAGTTCCATAGCTGTTGTAATGAACCTTTGAAAAATCCATGTCCTCTTCAGTATAAGCTGGCCTTTCTTGTTCTGGATATCCCATTGCCAGTATAGCAAGCACTTTGATATCCTCCTCTATACCTAATATCTCTCTTGCTATAACATCTGCTCCTCTTCCGTCTTCAGATGGTCTTTTGTCAATCTGGACCCAGCATGATTTAAGGCCCTTTTCTTCCGCCTCTAGCTGCATAAATGTAAGAGCTATAGAGCAGTCTTCTAACCATGTATCTGACTTTTCCTCTCTACCTAAAACCACTATTGCTACTGGGGCATCTTTCACAAGCTGCCCTCCTGCAGGTTTTGCCTTAGAAAGTTTATCTAATTTAGCACTGTCGTCTACCACCACAAATTCCCAAGGTCTTTTATTTTTCCCACTTGGAGATATTAGTCCCGCCTTTAGAATAGTTTCCAATTTTTCAGTTTCTACCGGTTTTTCTTGAAATTTTCTTATACTTCTTCTTTTTTTCAGTAATTCAAACAACATAATTTATTCCCCCTTAATCTTCTATTAAATCATATA	NA	NA	NA	NA
>prophage 5
NC_014632	Ilyobacter polytropus DSM 2926, complete sequence	2046464	1116321	1177208	2046464	protease,terminase,plate,capsid,tail,portal	Fusobacterium_phage(26.09%)	68	NA	NA
WP_013387468.1|1116321_1116855_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7R243	Vibrio_phage	39.0	1.3e-20
WP_013387469.1|1116863_1117442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387470.1|1117441_1118548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387471.1|1118540_1119146_-|tail	phage tail protein I	tail	A0A2K9V471	Faecalibacterium_phage	28.0	1.7e-13
WP_013387472.1|1119138_1120236_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	39.6	5.1e-72
WP_013387473.1|1120228_1120528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387474.1|1120530_1121034_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013387475.1|1121149_1121689_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	39.3	1.5e-16
WP_013387476.1|1121688_1122723_-	late control D family protein	NA	A0A067ZG47	Vibrio_phage	28.2	3.7e-32
WP_148223697.1|1122724_1122922_-|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	46.2	4.9e-10
WP_013387478.1|1122926_1125308_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	27.9	4.0e-37
WP_013387479.1|1125443_1125782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387480.1|1125807_1126494_-	Rha family transcriptional regulator	NA	A0A1W6JPM7	Staphylococcus_phage	46.8	4.6e-47
WP_013387481.1|1126506_1127025_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	38.6	4.7e-28
WP_013387482.1|1127024_1128461_-	hypothetical protein	NA	A0A0E3U251	Fusobacterium_phage	39.5	1.5e-100
WP_013387483.1|1128465_1128768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387484.1|1128777_1129257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387485.1|1129256_1129817_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013387486.1|1129813_1130143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387487.1|1130129_1130462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387488.1|1130468_1131506_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	25.1	3.5e-30
WP_013387489.1|1131516_1131843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387490.1|1131844_1132927_-|protease	Clp protease ClpP	protease	A0A0E3Y6E9	Fusobacterium_phage	38.6	2.7e-57
WP_013387491.1|1132913_1134455_-|portal	phage portal protein	portal	A0A0E3Y693	Fusobacterium_phage	45.9	6.2e-124
WP_013387492.1|1134463_1134685_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	46.7	2.3e-08
WP_013387493.1|1134685_1136497_-|terminase	phage terminase large subunit family protein	terminase	A0A0E3U2N4	Fusobacterium_phage	52.2	2.8e-168
WP_013387494.1|1136468_1136948_-	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	30.4	2.8e-14
WP_013387495.1|1137070_1137577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387496.1|1137746_1138769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387497.1|1138769_1140026_-	site-specific DNA-methyltransferase	NA	D0R0C5	Streptococcus_phage	45.4	1.1e-99
WP_013387498.1|1140222_1140384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041921162.1|1140492_1140690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387500.1|1140685_1141330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387501.1|1141334_1142225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387502.1|1142243_1145294_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.9	5.5e-15
WP_013387503.1|1145319_1146621_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041921163.1|1146613_1148836_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	31.8	1.8e-28
WP_013387505.1|1149615_1150221_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_013387506.1|1150236_1150917_-	helix-turn-helix domain-containing protein	NA	A0A0E3U270	Fusobacterium_phage	41.0	8.9e-43
WP_013387507.1|1151058_1151211_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_013387508.1|1151287_1151773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387509.1|1151748_1152705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387510.1|1152694_1152925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387511.1|1153207_1153348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387512.1|1153366_1153504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387513.1|1153744_1153945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387515.1|1154088_1155498_+	recombinase family protein	NA	NA	NA	NA	NA
WP_013387516.1|1155572_1155746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387517.1|1155747_1157133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387518.1|1157562_1157772_-	glutaredoxin	NA	NA	NA	NA	NA
WP_013387519.1|1157824_1158736_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_013387520.1|1158799_1159417_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013387521.1|1159431_1160220_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_013387522.1|1160249_1161191_-	D-2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	31.3	8.6e-28
WP_013387523.1|1161241_1161886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387524.1|1162355_1163093_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013387525.1|1163139_1163526_-	HAD hydrolase family protein	NA	A0A1W6DYI0	Aeromonas_phage	38.7	9.3e-13
WP_013387526.1|1163883_1164966_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_013387527.1|1164999_1166709_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_013387528.1|1166925_1167123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013387529.1|1167160_1167799_-	alpha/beta hydrolase fold protein	NA	NA	NA	NA	NA
WP_013387530.1|1167809_1168376_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_013387531.1|1168375_1168822_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_013387532.1|1168840_1169644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013387533.1|1169658_1170648_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_013387534.1|1170665_1172348_-	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_013387535.1|1172357_1175870_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_013387536.1|1175885_1177208_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.9	5.2e-31
>prophage 1
NC_014633	Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence	961624	11948	32799	961624	portal,terminase,tail,head,protease,plate,capsid	Vibrio_phage(25.0%)	28	NA	NA
WP_013388357.1|11948_12461_-	hypothetical protein	NA	A0A2I7S8P5	Vibrio_phage	32.6	1.2e-10
WP_013388358.1|12472_12799_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_013388359.1|12805_13543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388360.1|13604_14621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388361.1|14635_14893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388362.1|14927_16085_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	33.8	1.8e-14
WP_013388363.1|16086_16692_-|tail	phage tail protein	tail	A0A0C5AJ63	Bacteriophage	31.8	8.8e-18
WP_013388364.1|16684_17806_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	32.4	2.6e-47
WP_013388365.1|17798_18095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388366.1|18091_18565_-|tail	phage tail protein	tail	A0A2K9V465	Faecalibacterium_phage	32.8	1.5e-09
WP_013388367.1|18576_19134_-|plate	phage baseplate assembly protein V	plate	A0A0E3Y4V1	Fusobacterium_phage	32.0	4.5e-08
WP_013388368.1|19133_20165_-	late control D family protein	NA	R9U464	Rhizobium_phage	27.9	4.5e-22
WP_013388369.1|20169_20367_-|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	41.5	7.8e-08
WP_013388370.1|20366_22094_-|tail	phage tail tape measure protein	tail	A0A1J0MFP9	Staphylococcus_phage	44.3	8.9e-63
WP_013388372.1|22244_22877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388373.1|22938_23463_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	26.6	3.6e-07
WP_013388374.1|23474_24923_-	hypothetical protein	NA	A0A0C5AEE8	Bacteriophage	39.5	1.4e-82
WP_013388375.1|24922_25183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388376.1|25182_25671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388377.1|25667_26231_-|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	43.0	5.0e-15
WP_013388378.1|26230_26554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388379.1|26562_26865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388380.1|26873_27890_-|capsid	major capsid protein	capsid	A0A0E3U2N5	Fusobacterium_phage	32.6	3.2e-44
WP_013388381.1|27906_28239_-|head	head decoration protein	head	NA	NA	NA	NA
WP_013388382.1|28238_29324_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	37.3	2.1e-49
WP_013388383.1|29313_30816_-|portal	phage portal protein	portal	A0A0E3Y693	Fusobacterium_phage	38.4	2.0e-95
WP_013388384.1|30797_31016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388385.1|31041_32799_-|terminase	phage terminase large subunit family protein	terminase	A0A0E3U2N4	Fusobacterium_phage	51.4	3.0e-167
>prophage 2
NC_014633	Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence	961624	109047	142285	961624	integrase,terminase,tail,capsid	Bacillus_phage(18.75%)	44	141063:141079	146317:146333
WP_013388475.1|109047_111759_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_013388476.1|111764_112334_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_041921274.1|112338_112620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388478.1|112661_112973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388479.1|113020_113527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388480.1|113541_113982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388481.1|113982_114372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388482.1|114396_115374_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_013388483.1|115378_115759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388484.1|115763_116633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388485.1|116797_117286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388486.1|117514_117760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041921275.1|117762_118152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388488.1|118645_118807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388489.1|118807_121732_-|capsid	minor capsid protein	capsid	B5TA65	Burkholderia_phage	28.4	3.8e-13
WP_041921276.1|121858_123133_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	59.2	1.7e-140
WP_013388491.1|123116_123557_-|terminase	terminase small subunit	terminase	Q4ZCF3	Staphylococcus_virus	55.8	4.6e-32
WP_013388492.1|123626_123935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388493.1|123961_124342_-	hypothetical protein	NA	A0A2I2L3K7	Orpheovirus	55.9	2.0e-31
WP_013388494.1|124328_124553_-	DUF3310 domain-containing protein	NA	A0A1B1IWM3	uncultured_Mediterranean_phage	64.6	1.1e-18
WP_013388495.1|124542_124938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388496.1|124918_125476_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_083789132.1|125475_125685_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_187288126.1|125736_126306_-	DnaB-like helicase C-terminal domain-containing protein	NA	W8EEZ1	Geobacillus_phage	46.6	8.3e-34
WP_049774891.1|126323_126989_-	hypothetical protein	NA	D2XR44	Bacillus_phage	29.3	1.4e-08
WP_013388497.1|126982_127807_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_013388498.1|128215_128593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013388499.1|128584_128779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388500.1|128822_129023_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013388501.1|129173_129557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013388502.1|129728_130112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013388503.1|130146_130575_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1X9I6C0	Streptococcus_phage	33.1	1.5e-08
WP_013388504.1|130576_131596_-	DNA-binding protein	NA	Q331X4	Clostridium_botulinum_C_phage	29.4	2.2e-16
WP_013388505.1|131624_134552_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	40.0	5.2e-180
WP_013388506.1|134551_136702_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	38.1	3.5e-109
WP_013388507.1|136649_137360_-	phage repressor	NA	A0A1X9I5R4	Streptococcus_phage	25.1	1.8e-14
WP_013388508.1|137557_137755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013388510.1|137876_138050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013388511.1|138133_139240_+	YqaJ viral recombinase family protein	NA	O48490	Bacillus_phage	32.0	5.0e-27
WP_013388512.1|139252_140119_+	recombination protein RecT	NA	Q0H279	Geobacillus_phage	43.2	5.4e-53
WP_013388513.1|140184_140487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013388514.1|140560_140749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013388515.1|140749_141838_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	41.6	6.2e-70
141063:141079	attL	ATTTTCAAAATAAATTG	NA	NA	NA	NA
WP_083789133.1|142018_142285_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	59.7	4.0e-15
WP_083789133.1|142018_142285_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	59.7	4.0e-15
146317:146333	attR	CAATTTATTTTGAAAAT	NA	NA	NA	NA
>prophage 3
NC_014633	Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence	961624	273412	284277	961624		Synechococcus_phage(28.57%)	8	NA	NA
WP_013388621.1|273412_274909_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	1.3e-62
WP_013388622.1|275130_275703_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	7.3e-22
WP_013388623.1|275690_276689_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	41.8	1.6e-61
WP_013388624.1|276704_278099_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.5	1.4e-58
WP_013388625.1|278101_278812_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.7	1.3e-41
WP_013388626.1|278859_279987_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_013388627.1|280005_280518_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.6	2.7e-20
WP_013388628.1|280551_284277_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.6	1.9e-33
>prophage 4
NC_014633	Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence	961624	418181	427491	961624		Enterobacteria_phage(25.0%)	9	NA	NA
WP_013388734.1|418181_419129_-	ABC transporter substrate-binding protein	NA	G3M9Z0	Bacillus_virus	26.9	4.0e-09
WP_013388736.1|420609_421182_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.2	7.8e-48
WP_013388737.1|421178_422030_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	34.8	3.5e-28
WP_013388738.1|422026_423187_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	41.3	5.9e-71
WP_013388739.1|423240_423732_-	lipase	NA	F5B430	Synechococcus_phage	31.9	8.8e-08
WP_013388740.1|423728_424451_-	uracil-DNA glycosylase	NA	A0A1B0WL61	Flavobacterium_phage	37.0	8.3e-23
WP_041921288.1|424496_425294_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	49.4	2.2e-08
WP_013388742.1|425399_426239_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_049774896.1|426219_427491_-	L-aspartate oxidase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	26.9	9.5e-22
