The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014618	[Enterobacter] lignolyticus SCF1, complete sequence	4814049	1119851	1219565	4814049	tail,integrase,tRNA,transposase,plate	Escherichia_phage(27.27%)	96	1133235:1133251	1187326:1187342
WP_013365092.1|1119851_1121060_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.7	7.9e-50
WP_013365093.1|1121292_1122732_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_013365094.1|1122731_1123958_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013365095.1|1124289_1124538_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.9	7.3e-19
WP_013365096.1|1124646_1124898_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013365097.1|1124949_1125180_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013365098.1|1125571_1127353_+	thymidylate synthase	NA	A0A218MKK4	uncultured_virus	39.7	6.0e-22
WP_013365099.1|1127342_1128272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365100.1|1128283_1129369_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	41.7	7.9e-09
WP_013365102.1|1130248_1131334_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_013365103.1|1131667_1132846_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_013365104.1|1132838_1134884_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
1133235:1133251	attL	GGCGATAGCGTGCTGAC	NA	NA	NA	NA
WP_013365105.1|1134883_1137649_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	33.9	1.8e-121
WP_157865528.1|1138523_1139632_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.8	1.2e-49
WP_013365108.1|1140122_1140464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365109.1|1141404_1142175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365110.1|1142190_1142646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365111.1|1142660_1143143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365112.1|1143529_1143850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365113.1|1143855_1146642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365114.1|1147291_1149091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013365115.1|1149994_1150693_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_013365116.1|1150935_1152450_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_013365117.1|1152476_1152689_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.0	5.4e-07
WP_013365118.1|1152814_1153696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365119.1|1153759_1155001_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	9.1e-102
WP_013365120.1|1155730_1156213_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	4.7e-30
WP_071841377.1|1156322_1156799_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_013365122.1|1156788_1157076_+	RnfH family protein	NA	NA	NA	NA	NA
WP_013365123.1|1157117_1157459_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_013365124.1|1157608_1159270_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_013365125.1|1159355_1160234_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_013365127.1|1160356_1160950_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_013365128.1|1161001_1162288_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013365129.1|1162306_1163098_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_013365130.1|1163262_1164624_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_013365131.1|1164739_1164988_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013365132.1|1165006_1165555_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_013365133.1|1165600_1166368_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_006178051.1|1166408_1166756_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_044612070.1|1166870_1167059_-	late control protein B	NA	Q37973	Salmonella_virus	78.8	1.9e-19
WP_013365135.1|1167133_1168210_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	51.0	1.5e-100
WP_013365136.1|1168209_1168677_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	60.7	3.7e-48
WP_013365137.1|1168695_1170330_-	hypothetical protein	NA	Q858U7	Yersinia_virus	25.4	4.2e-46
WP_013365138.1|1170322_1170442_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	4.8e-13
WP_013365139.1|1170474_1170756_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	82.6	9.4e-31
WP_013365140.1|1170811_1171330_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	89.0	4.5e-87
WP_013365141.1|1171342_1172533_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	4.5e-199
WP_013365142.1|1172591_1173185_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.2	2.6e-86
WP_013365143.1|1173255_1173681_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	54.2	3.0e-36
WP_013365144.1|1173680_1174283_+|tail	tail assembly protein	tail	A0A218M4J2	Erwinia_phage	52.3	7.4e-49
WP_013365145.1|1174254_1174689_-|tail	tail assembly chaperone gp38	tail	Q9MCR5	Enterobacteria_phage	67.1	2.0e-19
WP_013365146.1|1174691_1175708_-|tail	variable tail fiber protein	tail	A0A2I8TVA9	Erwinia_phage	82.8	7.2e-81
WP_013365147.1|1175704_1176316_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	71.1	5.5e-84
WP_013365148.1|1176308_1177217_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	75.8	3.6e-124
WP_013365149.1|1177220_1177568_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.6	7.0e-44
WP_013365150.1|1177564_1178200_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	70.6	1.3e-83
WP_013365151.1|1178286_1178754_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	58.1	2.3e-42
WP_044611904.1|1178849_1179275_-	hypothetical protein	NA	O80310	Escherichia_phage	48.9	2.9e-23
WP_013365154.1|1179274_1179781_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	69.0	4.7e-65
WP_013365155.1|1179777_1179984_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	77.6	1.0e-18
WP_013365156.1|1179974_1180178_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	65.7	3.1e-20
WP_013365157.1|1180334_1180517_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	78.3	2.8e-20
WP_013365158.1|1180620_1182594_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	62.9	3.0e-240
WP_013365159.1|1182590_1182815_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	63.4	6.6e-19
WP_013365160.1|1182814_1183030_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_013365161.1|1183096_1183432_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	62.9	1.5e-30
WP_013365162.1|1183703_1184555_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	59.9	1.4e-90
WP_044612073.1|1184742_1185096_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_013365164.1|1185149_1186514_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_013365165.1|1186521_1187004_-	OmpA family protein	NA	NA	NA	NA	NA
WP_013365166.1|1187021_1188242_-	diguanylate cyclase DgcN	NA	A0A127AWB9	Bacillus_phage	31.7	4.4e-08
1187326:1187342	attR	GTCAGCACGCTATCGCC	NA	NA	NA	NA
WP_013365167.1|1188234_1188828_-	YfiR family protein	NA	NA	NA	NA	NA
WP_013365168.1|1189174_1190245_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	52.4	5.6e-92
WP_013365169.1|1190255_1191377_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_013365170.1|1191478_1192639_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_121497579.1|1192738_1192786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013365171.1|1192891_1193224_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_013365172.1|1193502_1194240_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_013365173.1|1194370_1195351_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_013365174.1|1195347_1196079_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_013365175.1|1196207_1198781_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	2.2e-126
WP_013365176.1|1204492_1205791_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	1.2e-43
WP_013365177.1|1205794_1206115_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_013365178.1|1206159_1207515_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013365179.1|1207640_1210289_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_044611905.1|1210324_1211023_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_013365181.1|1211092_1211521_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.3	7.9e-13
WP_013365182.1|1211725_1212784_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_013364229.1|1212891_1214226_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013365183.1|1214257_1214947_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.6e-55
WP_013365184.1|1215265_1215649_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	69.9	1.8e-32
WP_013365185.1|1215758_1216346_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_013365186.1|1216450_1217335_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013365187.1|1217361_1218696_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.3	9.6e-41
WP_013365188.1|1218827_1219565_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NC_014618	[Enterobacter] lignolyticus SCF1, complete sequence	4814049	1757851	1766134	4814049		Enterobacteria_phage(42.86%)	8	NA	NA
WP_013365651.1|1757851_1759258_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.1e-17
WP_044611922.1|1759404_1760307_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.0	4.4e-45
WP_013365653.1|1760700_1761789_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.3	2.3e-101
WP_013365654.1|1761802_1762684_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.1	3.1e-112
WP_013365655.1|1762683_1763565_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	5.4e-40
WP_013365656.1|1763571_1764126_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	1.9e-51
WP_013365657.1|1764135_1764912_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013365658.1|1764901_1766134_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	6.6e-12
>prophage 3
NC_014618	[Enterobacter] lignolyticus SCF1, complete sequence	4814049	1774433	1782478	4814049		Shigella_phage(16.67%)	7	NA	NA
WP_013365665.1|1774433_1775537_+	acyltransferase	NA	Q716G0	Shigella_phage	28.1	4.9e-14
WP_157865583.1|1775533_1776670_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.4	2.6e-23
WP_013365667.1|1776666_1777413_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013365668.1|1777888_1779295_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.8	1.8e-37
WP_013365669.1|1779524_1780691_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	5.7e-114
WP_013365670.1|1780738_1781743_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.9	3.7e-29
WP_013365671.1|1781878_1782478_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.6	9.7e-17
>prophage 4
NC_014618	[Enterobacter] lignolyticus SCF1, complete sequence	4814049	1953709	2037825	4814049	tail,integrase,tRNA,holin,portal,terminase,bacteriocin,protease	Enterobacteria_phage(29.41%)	94	1953623:1953645	1988321:1988343
1953623:1953645	attL	AACCACCTTCGGGTGGTTTTTTT	NA	NA	NA	NA
WP_013365828.1|1953709_1954726_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	66.3	4.0e-132
WP_157865584.1|1954727_1954955_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	44.3	8.1e-09
WP_013365830.1|1955016_1957233_-	exonuclease	NA	S4TNL0	Salmonella_phage	40.2	9.3e-89
WP_013365831.1|1957373_1957706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013365833.1|1958101_1958356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365834.1|1958874_1959264_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.9	1.4e-19
WP_013365835.1|1959372_1959588_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	56.5	1.0e-16
WP_013365836.1|1959597_1960152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365837.1|1960206_1961040_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	51.8	5.1e-64
WP_013365838.1|1961042_1961783_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	69.6	3.2e-94
WP_013365839.1|1961802_1962225_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013365840.1|1962227_1962563_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.0	1.6e-16
WP_013365841.1|1962559_1962913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365842.1|1962905_1963559_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	47.4	1.8e-40
WP_013365843.1|1963555_1963735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365844.1|1963734_1963992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365845.1|1963988_1965968_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.4e-200
WP_013365847.1|1966688_1966922_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	75.3	4.0e-27
WP_013365849.1|1967341_1967548_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	57.6	6.9e-15
WP_013365850.1|1967544_1967916_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	67.5	3.4e-44
WP_013365851.1|1967900_1968938_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.1	1.7e-101
WP_013365852.1|1968948_1969296_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.4	3.7e-53
WP_013365853.1|1969323_1969875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013365854.1|1970386_1970758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013365855.1|1970779_1971043_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013365856.1|1971202_1971598_+	membrane protein	NA	G8C7V8	Escherichia_phage	76.2	2.9e-46
WP_013365857.1|1971584_1971866_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	7.7e-33
WP_013365858.1|1971880_1972366_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	71.4	1.2e-65
WP_157865586.1|1972383_1972935_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	62.3	5.7e-48
WP_044611930.1|1973008_1973209_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.3	1.0e-10
WP_013365860.1|1973477_1973966_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	85.2	1.2e-68
WP_013365861.1|1973965_1976068_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	87.3	0.0e+00
WP_013365862.1|1976064_1976280_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	81.4	2.6e-25
WP_013365863.1|1976276_1977785_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	85.9	1.2e-254
WP_013365864.1|1977729_1979739_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	87.6	0.0e+00
WP_013365865.1|1979824_1980148_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	72.0	2.2e-36
WP_013365866.1|1980140_1980416_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	71.2	4.0e-26
WP_013365867.1|1980426_1980981_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	70.1	6.5e-60
WP_013365868.1|1980977_1981376_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	64.3	6.2e-44
WP_013365869.1|1981383_1982121_+|tail	phage tail protein	tail	O64327	Escherichia_phage	72.7	5.8e-96
WP_013365870.1|1982158_1982566_+|tail	phage minor tail protein G	tail	K7P7M5	Enterobacteria_phage	68.6	5.2e-30
WP_071841391.1|1982574_1982895_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	70.8	4.5e-37
WP_013365872.1|1982872_1985392_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	75.7	0.0e+00
WP_013365873.1|1985394_1985742_+	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	66.1	1.4e-36
WP_013365874.1|1985738_1986494_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	84.5	3.8e-127
WP_013365875.1|1986495_1987206_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	87.7	9.1e-131
WP_013365876.1|1987237_1987663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044611932.1|1987715_1988303_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.1	2.6e-75
WP_013365878.1|1988354_1991882_+	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	81.2	0.0e+00
1988321:1988343	attR	AACCACCTTCGGGTGGTTTTTTT	NA	NA	NA	NA
WP_013365879.1|1991909_1993583_+	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	66.2	9.9e-43
WP_013365880.1|1993579_1993969_+|tail	tail assembly chaperone gp38	tail	I7LEG3	Yersinia_phage	55.2	4.6e-36
WP_013365881.1|1994116_1994536_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.9	2.6e-32
WP_013365882.1|1994538_1995807_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.5	1.9e-208
WP_013365883.1|1995799_1996471_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.2	4.6e-76
WP_013365884.1|1996925_1997591_+	YecA family protein	NA	NA	NA	NA	NA
WP_013365885.1|1997633_1998845_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_013365886.1|1999037_1999277_+	YecH family protein	NA	NA	NA	NA	NA
WP_013365887.1|1999310_1999808_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_013365888.1|1999996_2000338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013365889.1|2000561_2001200_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_013365890.1|2001223_2002645_-	MFS transporter	NA	NA	NA	NA	NA
WP_077629254.1|2002851_2002938_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_013365891.1|2003021_2003273_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_013365892.1|2003324_2004668_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_013365893.1|2004850_2005354_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_013365894.1|2006115_2007096_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013365895.1|2007144_2008659_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	4.8e-12
WP_013365896.1|2008673_2009654_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_013365897.1|2009806_2010238_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_077264264.1|2011025_2011385_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_013365899.1|2011387_2011966_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_013365900.1|2012088_2012979_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_013365901.1|2012975_2013905_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_013365902.1|2013909_2015943_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_013365903.1|2015964_2016468_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_013365904.1|2016637_2018299_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	5.3e-12
WP_013365905.1|2018335_2019937_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.2e-08
WP_013365906.1|2019957_2020824_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_013365907.1|2020820_2021870_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	33.6	4.6e-06
WP_013365908.1|2021885_2022275_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	1.0e-06
WP_013365909.1|2022286_2022931_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_044612106.1|2023072_2024227_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_013365911.1|2024219_2026298_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_013365912.1|2026297_2026690_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_013365913.1|2026686_2028588_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_013365914.1|2028744_2030478_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	33.8	2.3e-82
WP_013365915.1|2030721_2031297_+	VOC family protein	NA	NA	NA	NA	NA
WP_013365916.1|2031363_2032107_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_013365917.1|2032201_2033176_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_013365918.1|2033172_2033916_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_013365919.1|2033953_2034349_-	membrane protein	NA	NA	NA	NA	NA
WP_013365920.1|2034401_2035220_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.6e-57
WP_013365921.1|2035216_2035783_-	hydrolase	NA	NA	NA	NA	NA
WP_013365922.1|2036052_2037825_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	28.4	6.2e-11
>prophage 5
NC_014618	[Enterobacter] lignolyticus SCF1, complete sequence	4814049	2211191	2220002	4814049	tRNA	Tupanvirus(33.33%)	10	NA	NA
WP_013366082.1|2211191_2213120_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	3.3e-127
WP_013366083.1|2213123_2213666_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	3.7e-15
WP_001124225.1|2213763_2213961_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013366084.1|2214010_2214367_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2214488_2214533_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_013366085.1|2214647_2215631_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	3.8e-34
WP_013366086.1|2215646_2218034_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.0	3.6e-06
WP_006820203.1|2218038_2218338_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_013366087.1|2218440_2219421_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_013366088.1|2219450_2220002_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.7	3.3e-19
