The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	102520	138210	2308962	integrase,tRNA,lysis,protease,transposase	Vibrio_phage(40.0%)	34	100888:100903	121521:121536
100888:100903	attL	AAAATGATGGCAATGT	NA	NA	NA	NA
WP_005538152.1|102520_103213_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_005538154.1|103212_103623_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005538156.1|104198_105200_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LRG1	Mannheimia_phage	52.4	4.5e-91
WP_014702205.1|106571_106859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148660545.1|107086_107852_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	4.4e-14
WP_005542135.1|107880_108873_-	virulence protein RhuM/Fic/DOC family protein	NA	NA	NA	NA	NA
WP_005542137.1|109056_109761_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005542139.1|109844_111302_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_005542140.1|111607_112708_+	cytochrome C nitrate reductase	NA	NA	NA	NA	NA
WP_005542142.1|112768_115249_+	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_005542144.1|115319_116099_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005542147.1|116328_117786_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005542149.1|118000_118255_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_005551624.1|118546_119332_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005542159.1|119492_119885_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005542161.1|119901_120330_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005551622.1|120571_121168_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005594107.1|121180_123160_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	23.7	4.6e-15
121521:121536	attR	ACATTGCCATCATTTT	NA	NA	NA	NA
WP_005551615.1|123159_126825_-	exodeoxyribonuclease V subunit beta	NA	NA	NA	NA	NA
WP_005551614.1|126895_127252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005548745.1|127676_128207_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_005542113.1|128349_130134_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005551610.1|130280_130727_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_005551608.1|130793_131003_-	cold shock domain-containing protein CspD	NA	A0A1J0GVA5	Vibrio_phage	53.1	9.5e-12
WP_005565219.1|131193_131358_-	YoaH family protein	NA	NA	NA	NA	NA
WP_005542108.1|131408_132122_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_005551602.1|132118_132433_-	YqcC family protein	NA	NA	NA	NA	NA
WP_032997062.1|132540_133323_+	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_005551600.1|133331_134171_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.8	1.6e-38
WP_005542100.1|134222_135473_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005542098.1|135465_136062_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005594094.1|136018_137359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148660552.1|137620_137911_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143106500.1|137943_138210_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	627514	676230	2308962	tRNA,transposase	Bacillus_virus(18.18%)	45	NA	NA
WP_148660552.1|627514_627805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143106513.1|627837_628104_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_148660546.1|628085_628562_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	1.4e-34
WP_081110847.1|628519_628606_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005539905.1|628804_630583_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	9.6e-12
WP_005539902.1|630790_631318_+	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_005539900.1|631389_632115_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	S5VMD2	Pseudomonas_phage	31.0	8.4e-23
WP_005539898.1|632194_634762_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_005539895.1|634904_636236_-	MFS transporter	NA	NA	NA	NA	NA
WP_005539893.1|636636_638589_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005567670.1|638747_639155_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_005550425.1|639241_639895_+	ribonuclease T	NA	NA	NA	NA	NA
WP_005550427.1|640246_641599_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_005550429.1|641662_642229_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005594730.1|642286_643711_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_005545534.1|644065_644197_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_005550440.1|644212_644944_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_005554148.1|644945_645917_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	22.3	4.6e-08
WP_005550443.1|646182_646494_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_005539872.1|646514_646772_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_005550447.1|646842_647775_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005550449.1|647852_648770_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005550451.1|648806_649982_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_005554152.1|650049_650532_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.1	1.6e-25
WP_005552251.1|650900_652484_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005554158.1|653556_654495_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_005552256.1|654504_655488_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	2.4e-12
WP_005552257.1|655484_656483_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	3.3e-17
WP_005554161.1|656590_657298_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_005550410.1|657559_657700_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005539816.1|657709_657976_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005550404.1|658186_658756_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_005539812.1|658919_660689_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_005539808.1|660768_661158_+	DoxX family protein	NA	NA	NA	NA	NA
WP_005539804.1|661596_664488_-	ribonuclease E	NA	NA	NA	NA	NA
WP_005539800.1|664954_665914_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_005550389.1|666112_666436_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	52.8	3.9e-20
WP_005539796.1|666535_667531_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	40.5	1.2e-67
WP_032997137.1|667554_668664_-	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	2.3e-16
WP_005539787.1|669699_669891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005539783.1|670038_670623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005549079.1|670632_671214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148660554.1|671217_673608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014702320.1|674173_675586_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_005553836.1|676029_676230_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	50.9	4.8e-05
>prophage 3
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	1314771	1367922	2308962	tRNA,integrase,transposase	Shigella_phage(28.57%)	52	1321056:1321080	1330217:1330241
WP_158511711.1|1314771_1315176_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.9	6.5e-17
WP_014702415.1|1315252_1317454_+	phospholipase	NA	NA	NA	NA	NA
WP_014702376.1|1317453_1318608_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_014702416.1|1318646_1319852_+	sel1 repeat family protein	NA	NA	NA	NA	NA
1321056:1321080	attL	GTATAACTAAACGTATAACTAAAAT	NA	NA	NA	NA
WP_014702418.1|1321457_1321967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594668.1|1321953_1322160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594667.1|1322149_1322521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075560362.1|1322513_1323374_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005657512.1|1323686_1324112_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005703567.1|1324183_1324948_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	38.6	2.8e-16
WP_005594661.1|1324944_1325220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594660.1|1325241_1325625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594659.1|1325718_1326030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594657.1|1326054_1326507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594655.1|1326520_1326781_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005594653.1|1326791_1327001_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005594652.1|1327187_1327964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594651.1|1327973_1328645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594650.1|1328818_1330063_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.6	5.9e-85
WP_005544391.1|1330958_1331186_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
1330217:1330241	attR	GTATAACTAAACGTATAACTAAAAT	NA	NA	NA	NA
WP_041160762.1|1331182_1333915_-	YdbH family protein	NA	NA	NA	NA	NA
WP_005544395.1|1334020_1334638_-	MarC family protein	NA	NA	NA	NA	NA
WP_005550792.1|1334718_1336644_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	6.8e-72
WP_005544399.1|1336791_1337850_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.3	1.4e-114
WP_005544401.1|1337931_1338390_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005544402.1|1338462_1338852_+	RidA family protein	NA	NA	NA	NA	NA
WP_005544404.1|1338920_1340918_-	transketolase	NA	NA	NA	NA	NA
WP_041160763.1|1341050_1342004_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	1.2e-08
WP_158511712.1|1349422_1349941_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.1	1.2e-20
WP_148325802.1|1349989_1350133_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162493033.1|1350252_1350450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079254132.1|1350468_1350570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061866575.1|1351359_1352937_-	pilus assembly protein TadG	NA	NA	NA	NA	NA
WP_014702429.1|1352953_1353532_-	pilus assembly protein TadF	NA	NA	NA	NA	NA
WP_014702430.1|1353597_1354173_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_014702431.1|1354186_1354948_-	Flp pilus assembly protein TadD	NA	NA	NA	NA	NA
WP_014702432.1|1354937_1355804_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014702433.1|1355800_1356688_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014702434.1|1356687_1357968_-	CpaF family protein	NA	NA	NA	NA	NA
WP_014702435.1|1357981_1359106_-	flp operon protein D	NA	NA	NA	NA	NA
WP_014702436.1|1359121_1359625_-	RcpB protein	NA	NA	NA	NA	NA
WP_014702437.1|1359621_1361004_-	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_041160765.1|1361005_1361830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041160766.1|1361881_1362310_-	type 4 prepilin peptidase 1	NA	NA	NA	NA	NA
WP_041160767.1|1362325_1362556_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_014702441.1|1362647_1362875_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_014702442.1|1363394_1363643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041160768.1|1363630_1364095_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_014702445.1|1364256_1364958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014702446.1|1364961_1366887_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_005546808.1|1366924_1367098_+	DUF5363 domain-containing protein	NA	NA	NA	NA	NA
WP_148660549.1|1367164_1367922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	1532691	1631967	2308962	protease,tRNA,integrase,transposase	Shigella_phage(15.0%)	93	1543391:1543450	1575835:1576259
WP_005542509.1|1532691_1533168_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_014702468.1|1533286_1533784_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_005549216.1|1533889_1534732_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_005553760.1|1534766_1535444_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005542501.1|1535433_1536471_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.3	1.8e-31
WP_005542499.1|1536666_1537224_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
1543391:1543450	attL	TGTAGTGGTACACTAATCCCGCATTCCTCAATAAGTGGTAAAATATCATCAACAAGAGGA	NA	NA	NA	NA
WP_071805258.1|1543457_1543559_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014702472.1|1543815_1544370_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_005544546.1|1544378_1544600_+|transposase	transposase	transposase	Q716C2	Shigella_phage	55.1	6.7e-16
WP_005541001.1|1544903_1546208_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005541000.1|1546613_1547945_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	32.1	2.8e-48
WP_005549887.1|1548034_1548742_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_005540997.1|1548816_1549506_-	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	36.5	2.2e-36
WP_005540996.1|1549886_1550546_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005540748.1|1552125_1552686_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_005540740.1|1552698_1553133_+	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_005540738.1|1553151_1554519_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005540737.1|1554592_1555036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005540735.1|1555208_1555976_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005540733.1|1556087_1556945_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005540731.1|1556984_1557404_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005540730.1|1557385_1557715_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005540728.1|1557695_1558697_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005540727.1|1558795_1559272_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005540726.1|1559395_1559863_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005540725.1|1559906_1561253_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005540723.1|1561550_1562312_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_005540721.1|1562430_1563819_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_005551725.1|1563842_1564115_+	DUF997 family protein	NA	NA	NA	NA	NA
WP_005540717.1|1564111_1565548_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005540715.1|1565566_1566109_+	adenosine monophosphate-protein transferase	NA	NA	NA	NA	NA
WP_005540713.1|1566121_1567006_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005540711.1|1567250_1568300_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005540710.1|1568293_1568593_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005540709.1|1569207_1569762_-	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_005540708.1|1569910_1570234_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_005595258.1|1570462_1571836_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_005540705.1|1572232_1572505_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005540704.1|1572504_1572717_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_005540698.1|1572706_1573330_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_075560365.1|1573714_1574131_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	35.7	3.8e-12
WP_109091990.1|1574171_1574339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005540696.1|1574335_1574608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544546.1|1574684_1574906_-|transposase	transposase	transposase	Q716C2	Shigella_phage	55.1	6.7e-16
WP_014702479.1|1574914_1575469_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	31.0	6.4e-07
WP_071805258.1|1575725_1575827_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041160793.1|1575889_1576315_-	hypothetical protein	NA	NA	NA	NA	NA
1575835:1576259	attR	TCCTCTTGTTGATGATATTTTACCACTTATTGAGGAATGCGGGATTAGTGTACCACTACAGCACCAGTTTGGTGATTTGCGATTTCTTACGGTATTGATTGCCCGAATAATTCGGCACGCTCACCTGTACGCTGATAGCAAGTAACTCATCATAAGCAATAGAACCCACATCCACCTCTTCCGAATAGGTGCTGAAGTTCATGTAAGGCAAACGTTCATCTTGTATGGTCAGGCTTGCCAGCCCTTCCTGTTCAAACGCCGTCACAATATGGATTTTCGCTTTCTCCAAGCTCAACCGCCAGTCTTCATAGCTCGGATAAACCCTTTTCACATTTTTGGCATAGCCAATCAGGGTATCAAGGCGTATTGCCTGTGCATCCTGCTCGGTATAAATACCCGGGTAGTTCACCAGGATTTTACGTGGA	NA	NA	NA	NA
WP_005542545.1|1577605_1579879_-	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_005542549.1|1580110_1581712_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_005542551.1|1581955_1582537_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.3	2.0e-59
WP_005542555.1|1582546_1583779_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	1.6e-127
WP_005542557.1|1583841_1584165_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_005542561.1|1584623_1585469_-	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_005542563.1|1585541_1587701_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	53.5	2.0e-205
WP_005542565.1|1587787_1588000_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	62.1	7.1e-15
WP_005542572.1|1589710_1589965_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	64.0	5.9e-24
WP_005542575.1|1590213_1594482_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	7.0e-69
WP_005542577.1|1594584_1598613_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	26.2	3.0e-21
WP_005542578.1|1598883_1599255_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005542581.1|1599306_1599798_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005542586.1|1600153_1600843_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005542594.1|1600847_1601276_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005547787.1|1601431_1601983_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_005542598.1|1601984_1602395_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005542600.1|1602832_1603537_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_079254142.1|1603596_1603851_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	52.4	9.1e-09
WP_075560367.1|1603784_1604174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005542604.1|1604179_1604461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014702332.1|1604552_1604729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005539195.1|1604737_1605748_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005539198.1|1605750_1607871_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005594882.1|1609401_1610091_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_005540455.1|1610087_1611311_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005540457.1|1611303_1612713_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_005550263.1|1612739_1613192_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005540460.1|1613313_1613868_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A0F6R5Z1	Sinorhizobium_phage	29.8	1.7e-07
WP_005594879.1|1614333_1614807_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_032997160.1|1615100_1617230_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005550269.1|1617314_1618217_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005540468.1|1618328_1620131_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	3.9e-53
WP_005540470.1|1620213_1620825_-	UDP-glucose 6-dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	52.7	4.0e-50
WP_014702489.1|1620881_1621037_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014702490.1|1621129_1622233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005540473.1|1622364_1623639_+	GntP family permease	NA	NA	NA	NA	NA
WP_005594873.1|1623635_1624775_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.7	3.9e-51
WP_005540477.1|1624845_1625385_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.4	6.2e-15
WP_014702491.1|1625624_1626986_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_014702492.1|1627102_1627636_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_032997155.1|1627693_1629085_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005540485.1|1629273_1629774_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_032998660.1|1629824_1630730_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_005540487.1|1630898_1631615_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_005582243.1|1631712_1631967_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	1764464	1801224	2308962	tRNA,protease,transposase	Bacillus_phage(33.33%)	35	NA	NA
WP_005551169.1|1764464_1765742_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_099308997.1|1765763_1766870_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_005542473.1|1766878_1767934_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005551171.1|1768077_1768629_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_005542469.1|1768650_1769790_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_005542467.1|1770084_1771134_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_005542466.1|1771235_1772600_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005542465.1|1772692_1773934_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_005542464.1|1774090_1774591_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_158511708.1|1774630_1774723_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014702512.1|1774685_1775138_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	5.6e-33
WP_148660552.1|1775232_1775523_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005555155.1|1777296_1778574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005543742.1|1778575_1779331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005555157.1|1779327_1780389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005543738.1|1780396_1781380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005543734.1|1781988_1784253_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_005543732.1|1784396_1785041_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.1	1.4e-53
WP_014702515.1|1785451_1786243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005543727.1|1786444_1787272_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.6	1.5e-31
WP_005543726.1|1787366_1787810_+	peptidoglycan-binding protein LysM	NA	J9QDY6	Clostridium_phage	46.3	2.0e-06
WP_005543723.1|1787899_1788496_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005543722.1|1788592_1788946_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_005543719.1|1788966_1790397_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_005543714.1|1790596_1791136_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_005543712.1|1791159_1792704_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_005543710.1|1792898_1793630_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_005543708.1|1793750_1794965_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014702516.1|1795081_1796383_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_005594325.1|1796373_1798080_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005540502.1|1798132_1798882_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_005540508.1|1798977_1799247_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005540510.1|1799454_1800609_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.2	5.6e-130
WP_158511708.1|1800704_1800797_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079254134.1|1800759_1801224_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	1.0e-34
>prophage 6
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	2114862	2164249	2308962	tRNA,integrase,transposase	Klosneuvirus(20.0%)	46	2119431:2119446	2166218:2166233
WP_005542438.1|2114862_2115342_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_005542439.1|2115402_2116374_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005550377.1|2116979_2118713_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.6	6.6e-82
WP_014702560.1|2118809_2119397_+	VOC family protein	NA	NA	NA	NA	NA
2119431:2119446	attL	AGCATTTTATGAAAAA	NA	NA	NA	NA
WP_005542443.1|2119438_2119894_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005542444.1|2120034_2121117_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.4	5.1e-08
WP_005542445.1|2121156_2122056_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005542446.1|2122065_2122920_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.0e-48
WP_005542447.1|2123099_2123609_+	lipoprotein NlpC	NA	A0A1V0DZX6	Clostridioides_phage	37.3	9.1e-16
WP_005581143.1|2123777_2123963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005542449.1|2124006_2124258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005542450.1|2124341_2125004_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005542451.1|2125025_2125571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005542452.1|2125794_2126262_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005551246.1|2126274_2127612_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_005552864.1|2127639_2128467_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_158511708.1|2129757_2129850_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079254134.1|2129812_2130277_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	1.0e-34
WP_143106500.1|2130258_2130525_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_148660552.1|2130557_2130848_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143106533.1|2131055_2131244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544663.1|2131417_2131867_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_109091998.1|2131933_2132005_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162200194.1|2132099_2132252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544504.1|2132574_2134041_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	2.2e-99
WP_005551084.1|2135201_2135405_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005542338.1|2141242_2142061_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.8e-13
WP_005550711.1|2142064_2143117_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005542341.1|2143124_2144012_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005542342.1|2144001_2144967_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005542343.1|2144966_2146658_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005565835.1|2146872_2148279_+	GTP-binding protein YcjX	NA	NA	NA	NA	NA
WP_005542351.1|2148291_2149371_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_005542350.1|2149454_2150414_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_005542348.1|2150791_2151088_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_005542347.1|2151207_2152152_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_005594151.1|2152166_2154017_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.6	1.3e-67
WP_005543009.1|2154016_2155504_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	39.0	1.1e-08
WP_005551345.1|2155500_2155995_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005543005.1|2156150_2157944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543003.1|2157968_2158328_-	GtrA family protein	NA	I1TED9	Salmonella_phage	46.7	4.6e-22
WP_005543001.1|2158331_2159252_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_005542998.1|2159259_2160768_-	spermidine synthase	NA	NA	NA	NA	NA
WP_005542996.1|2160754_2161372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005542994.1|2161400_2163026_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_005542990.1|2163427_2164249_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2166218:2166233	attR	AGCATTTTATGAAAAA	NA	NA	NA	NA
>prophage 7
NC_017846	Aggregatibacter actinomycetemcomitans D7S-1, complete sequence	2308962	2198455	2237262	2308962	tRNA,transposase	Escherichia_phage(27.27%)	39	NA	NA
WP_005555043.1|2198455_2200387_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.8e-131
WP_158511708.1|2200448_2200541_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079254134.1|2200503_2200968_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	1.0e-34
WP_143106500.1|2200949_2201216_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_148660552.1|2201248_2201539_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005542265.1|2201789_2202569_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_071805301.1|2202881_2203424_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.5	1.1e-14
WP_005542274.1|2203648_2203846_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005542276.1|2203899_2204253_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005538881.1|2204429_2204627_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_005554604.1|2205229_2206183_+	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
WP_005538887.1|2206197_2208399_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_005538890.1|2208421_2209402_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	31.5	1.2e-11
WP_005538891.1|2209468_2210227_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_005538892.1|2210346_2212197_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005538893.1|2212281_2213172_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_005538894.1|2213182_2213428_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005538896.1|2213653_2214550_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_005538897.1|2214572_2215919_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005538899.1|2215975_2216617_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005538901.1|2216678_2218136_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_014702573.1|2218149_2219058_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_005538905.1|2219189_2219867_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005538908.1|2219911_2220088_+	EamA family transporter	NA	NA	NA	NA	NA
WP_005538910.1|2220084_2220774_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005538912.1|2220857_2221181_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_005538914.1|2221297_2222839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005538916.1|2223093_2224467_-	TolC family protein	NA	NA	NA	NA	NA
WP_005538918.1|2224543_2226478_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	43.8	7.4e-42
WP_005538920.1|2226497_2227682_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	45.1	2.5e-08
WP_005538922.1|2227903_2229574_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	78.5	1.6e-258
WP_005538924.1|2229684_2229972_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	47.8	2.2e-19
WP_005538926.1|2229981_2230278_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	43.8	4.3e-10
WP_050542386.1|2230344_2230746_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005553836.1|2230734_2230935_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	50.9	4.8e-05
WP_014702406.1|2231378_2232773_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_005541792.1|2233403_2235695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005541791.1|2235715_2236891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071805333.1|2237025_2237262_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	49.3	2.9e-09
