The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	0	71935	2264399	transposase,integrase	Bacillus_phage(16.67%)	49	14077:14136	39659:40253
WP_003671840.1|1782_2547_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003671841.1|2557_3334_-	AccA family protein	NA	NA	NA	NA	NA
WP_178084818.1|3326_4175_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003671843.1|4171_5542_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003671844.1|5550_5985_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003671845.1|5977_6430_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003671846.1|6436_7669_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003671847.1|7679_8414_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_003671848.1|8397_9348_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_035160167.1|9347_9590_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003671850.1|9609_10584_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003671851.1|10603_11050_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003671852.1|11135_11582_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_029507777.1|12027_13107_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	6.9e-05
WP_013923732.1|13179_13350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923733.1|13450_14698_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.2	1.8e-12
14077:14136	attL	AGCCGAACGCGAATGCGTTCAATCAGTTGTAATTGATTTAAATGCTCAATATCAAAGTTT	NA	NA	NA	NA
WP_035160163.1|17714_18569_+	patatin family protein	NA	NA	NA	NA	NA
WP_003671859.1|18585_19233_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	30.7	4.2e-18
WP_003671860.1|19341_20232_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003671861.1|20300_20990_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003663646.1|21553_23113_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	9.3e-19
WP_003671864.1|23102_26768_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_013923736.1|27865_28996_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003671868.1|29221_29719_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_003671869.1|29708_30926_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003671870.1|30904_31396_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_003671871.1|31392_31965_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003671872.1|33664_34924_-	chloride channel protein	NA	NA	NA	NA	NA
WP_003671873.1|35287_36517_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.7	1.6e-87
WP_003671670.1|37583_38342_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_013923744.1|40272_41238_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
39659:40253	attR	AGCCGAACGCGAATGCGTTCAATCAGTTGTAATTGATTTAAATGCTCAATATCAAAGTTTTATCTATCGCCTTTTCCCTAATGCCAATATCATTATTGATCGCTTCCACCTTGTACAATTAGCTGGTCGCGCTTTGGACAATTGTCGTATCTCTATCCTAAAGCAACTTGATAAACAGAGCCGAGAATATAAAATTATGAAGTCACATTGGAAGCTATTCCATAAAAAAGCTGAAGATCTTCACCCTGAAGAAGTAGTTTTTCTTCGCGGCGTTAAACAATATATGACTCGCCAAAATGCTGTTGATCTCATTACTAGTAAATTTTCCAAGTTCGCTGAAGTATACCAAACTTACCAAGATATCACGAAAGCCCTAAACGAGCGCAATAGTGAATTACTAGAGTCAACCATCTTAGACTACCAAAAAACCAATACAGAAATGGATACTGCTATTCAAACCCTTCGTCAAAACAGAAAATATGTCTTAAATAGCGCTAAATTTGAATACTCTAATGGTCCTTTAGAAGGCATCAATCGCAAAATCAAAACCCTAAAACGAACTTGTTATGGTTTTGCCAATCAAAAATTTTTCTTT	NA	NA	NA	NA
WP_003672706.1|41457_43764_-	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_003672703.1|43906_44548_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013923746.1|50177_50669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672354.1|50724_51573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672352.1|51585_51957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672348.1|52259_53096_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_035160300.1|53259_53964_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_003672345.1|53960_54521_-	Fic family protein	NA	S4TP71	Salmonella_phage	29.5	2.0e-08
WP_003672343.1|54513_54936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003672341.1|55050_57309_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003672337.1|58826_61928_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_003672335.1|61929_63048_-	exonuclease SbcCD subunit D	NA	J9PM68	Bacillus_phage	25.7	5.5e-05
WP_035160298.1|63302_64079_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003672332.1|64175_67661_-	SNF2 helicase associated domain-containing protein	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.0	6.9e-38
WP_003672330.1|67725_69576_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003672329.1|69757_70000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923748.1|70361_71537_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	5.0e-118
WP_041816984.1|71536_71935_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
>prophage 2
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	77526	77685	2264399		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003672316.1|77526_77685_-	hypothetical protein	NA	A0A0A7NU07	Lactobacillus_phage	57.7	2.8e-08
>prophage 3
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	90523	147394	2264399	transposase	Streptococcus_phage(20.0%)	51	NA	NA
WP_013923736.1|90523_91654_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003671637.1|91804_92386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542585.1|92375_92882_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003671630.1|94265_95108_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_041816964.1|95254_96295_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.0	1.5e-60
WP_003671625.1|96872_97931_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003671624.1|97932_98652_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003671623.1|98899_100066_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_003671622.1|100085_101324_-	glycosyltransferase family 4 protein	NA	A0A1V0SL50	Klosneuvirus	26.3	6.0e-13
WP_003671620.1|101459_102920_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_158087755.1|103006_103951_-	EpsG family protein	NA	NA	NA	NA	NA
WP_013923764.1|104422_105118_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	35.7	1.6e-07
WP_003671614.1|105138_106104_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003671611.1|106096_107152_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003671610.1|107156_108056_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003671607.1|108112_108898_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003671606.1|108897_109554_-	sugar transferase	NA	NA	NA	NA	NA
WP_003671604.1|109569_110499_-	GDP-mannose 4,6-dehydratase	NA	A0A1V0SKV4	Klosneuvirus	37.1	1.1e-48
WP_013923765.1|110519_111263_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	34.7	1.9e-22
WP_013923766.1|111275_112151_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003671599.1|112170_113172_-	LCP family protein	NA	NA	NA	NA	NA
WP_013923736.1|113493_114624_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003671595.1|115189_115426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671593.1|115457_115970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923767.1|116016_117519_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003663508.1|117653_117839_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_035160089.1|117918_119745_-	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003671588.1|119883_121287_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003671587.1|121399_123067_-	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	41.7	8.0e-53
WP_003671585.1|123080_123644_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_013923768.1|123743_124625_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_013923769.1|124636_125299_-	serine dehydratase	NA	NA	NA	NA	NA
WP_013923770.1|125401_126784_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003671580.1|127423_127888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923771.1|128105_129266_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.0e-163
WP_041816986.1|129262_129700_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	67.6	1.7e-47
WP_003667006.1|130017_130287_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003671578.1|130432_131311_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003671576.1|131429_132665_+	MFS transporter	NA	NA	NA	NA	NA
WP_003671575.1|132685_133387_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_013923774.1|134443_135619_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	2.3e-118
WP_035167654.1|135618_136017_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.9e-46
WP_003671570.1|136188_137088_-	prenyltransferase	NA	NA	NA	NA	NA
WP_003671569.1|137168_138149_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003671564.1|138193_140212_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_003671556.1|140221_142144_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_035160084.1|142303_143323_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003671552.1|144015_144843_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.0	1.4e-98
WP_003671551.1|144845_145178_-	MazG-like family protein	NA	M5AWB2	Nitratiruptor_phage	41.2	6.5e-15
WP_003671550.1|145327_145552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923776.1|145975_147394_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	161412	162114	2264399		Indivirus(100.0%)	1	NA	NA
WP_003672198.1|161412_162114_-	ribonuclease III	NA	A0A1V0SDK0	Indivirus	35.3	4.0e-22
>prophage 5
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	170707	224264	2264399	protease,tRNA,transposase	Streptococcus_phage(16.67%)	53	NA	NA
WP_003672210.1|170707_172612_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	31.2	8.7e-19
WP_003672212.1|172615_173356_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003672213.1|173363_174713_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003672214.1|174702_175656_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.2	3.7e-10
WP_003672215.1|175673_178103_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_003672216.1|178103_179309_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	1.2e-42
WP_003663855.1|179419_179638_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003672217.1|179634_180255_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	33.0	6.5e-24
WP_003672218.1|180395_180746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672219.1|180951_182631_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003672220.1|182646_183099_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003672222.1|183117_183939_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003672223.1|183950_184823_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003672224.1|184841_185123_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003672225.1|185124_186462_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.3	1.1e-39
WP_003672226.1|186454_187315_-	hypothetical protein	NA	A0A249XZQ2	Enterococcus_phage	41.3	1.3e-35
WP_003672227.1|187444_187861_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003672228.1|187862_188300_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003672229.1|188389_189064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672230.1|189065_190142_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003672231.1|190154_190862_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003672232.1|190986_191268_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003672234.1|191293_191617_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003664009.1|191632_191941_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013923780.1|192370_193591_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	36.8	9.0e-70
WP_003672507.1|193872_194481_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003672505.1|195149_195656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672503.1|195685_196714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672501.1|196703_197591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672498.1|197772_198087_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003672497.1|198089_198647_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003672495.1|198633_199485_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013923744.1|200211_201177_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003672488.1|202538_204044_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	31.9	1.3e-09
WP_003672486.1|204288_205632_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003672483.1|205804_206728_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003664039.1|206842_207019_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003672480.1|207250_207670_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003672478.1|207683_208655_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003668441.1|208679_208919_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_003672477.1|208925_209585_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003672475.1|209588_210143_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003664049.1|210280_210430_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003672473.1|210568_212668_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003672471.1|212877_215493_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003672469.1|215562_215952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923784.1|216120_217086_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_013923785.1|217244_218576_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
WP_003664064.1|218661_219138_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003670889.1|219201_219858_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	3.5e-36
WP_003670888.1|219969_220608_-	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	33.3	3.6e-09
WP_003670886.1|220793_223211_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003670885.1|223217_224264_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.2	1.7e-29
>prophage 6
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	227750	228161	2264399		Caulobacter_phage(100.0%)	1	NA	NA
WP_003670876.1|227750_228161_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	38.8	6.0e-10
>prophage 7
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	231497	233672	2264399		Bacillus_phage(100.0%)	2	NA	NA
WP_003670871.1|231497_232973_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.1	4.8e-25
WP_003664091.1|232985_233672_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	2.3e-30
>prophage 8
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	242164	251816	2264399	transposase	Agrobacterium_phage(20.0%)	9	NA	NA
WP_003664107.1|242164_242677_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.2	1.0e-11
WP_003670857.1|242902_243844_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.7	3.0e-28
WP_003670856.1|243864_245226_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_003668489.1|245243_245708_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003670853.1|245752_246352_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003670851.1|246355_247186_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.2	1.1e-26
WP_003670849.1|247200_249867_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.0	1.6e-47
WP_041816965.1|249989_250658_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_013923790.1|250685_251816_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.3	2.3e-35
>prophage 9
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	255075	263206	2264399	tRNA,transposase	Aeromonas_phage(20.0%)	10	NA	NA
WP_003664132.1|255075_255396_-	thioredoxin family protein	NA	J7KD15	Aeromonas_phage	35.8	2.0e-05
WP_003670844.1|255560_255899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041816966.1|256210_257587_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.5	4.2e-39
WP_003670842.1|257644_258256_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003670841.1|258487_259129_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003670840.1|259141_260344_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003670839.1|260336_261074_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.9e-23
WP_003670837.1|261210_261645_+	HIT family protein	NA	D7NW73	Streptomyces_phage	32.5	8.6e-07
WP_003668512.1|261647_261878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923792.1|261961_263206_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.5	2.3e-28
>prophage 10
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	271405	344159	2264399	protease,tRNA,transposase	Enterococcus_phage(25.0%)	59	NA	NA
WP_003670828.1|271405_273094_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	2.7e-72
WP_006499680.1|273442_274411_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003670827.1|274535_275351_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003670825.1|275363_276302_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003670823.1|276487_276760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670821.1|276901_277237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670820.1|277202_278366_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	24.9	1.0e-06
WP_003670818.1|278367_278955_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_003670817.1|278944_280204_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003670815.1|280190_280769_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	41.8	2.2e-34
WP_003670812.1|280750_281263_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_078009455.1|281265_281625_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003670810.1|281688_282084_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003664194.1|282326_282605_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003670807.1|282948_283629_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003670806.1|283612_283858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670805.1|285887_286811_-	ribokinase	NA	NA	NA	NA	NA
WP_003670804.1|286867_287884_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003670802.1|287965_288574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664204.1|288789_289422_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_003670801.1|289456_290506_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	29.7	1.2e-09
WP_003670800.1|290596_291109_-	universal stress protein	NA	NA	NA	NA	NA
WP_013923795.1|291134_292538_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003670798.1|292626_293487_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003670797.1|293550_295200_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003664210.1|295314_295578_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003670796.1|295642_298063_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003670795.1|298384_299572_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	4.7e-148
WP_003670794.1|299732_300272_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003670793.1|300349_301789_-	MFS transporter	NA	NA	NA	NA	NA
WP_035159873.1|301912_302368_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003670789.1|302399_303746_-	amino acid permease	NA	NA	NA	NA	NA
WP_003670788.1|303836_304448_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003664220.1|304459_304627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670787.1|304938_305463_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003670786.1|305486_305930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923796.1|305929_307432_-	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	27.4	1.2e-34
WP_003670784.1|307558_307990_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003670783.1|308122_308971_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003664227.1|309068_310367_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_003664228.1|310359_311601_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013923736.1|312162_313293_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003670780.1|315980_316673_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	46.8	1.4e-27
WP_003670779.1|317001_318702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923799.1|318890_320021_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	24.9	4.2e-21
WP_035159868.1|320149_320926_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003670776.1|321310_322204_-	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003670774.1|322212_322791_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	57.4	8.1e-53
WP_003670772.1|322857_325092_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.3	8.9e-249
WP_013923736.1|325368_326499_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003670766.1|328225_328780_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003672156.1|335576_335825_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_013923800.1|335881_336895_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_035160256.1|336894_337923_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003672160.1|337925_339143_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003672162.1|339376_341107_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.0	1.5e-14
WP_003664342.1|341106_341373_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003672165.1|341494_341680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672169.1|341954_344159_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.3	4.0e-124
>prophage 11
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	349169	351978	2264399	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_013923803.1|349169_350036_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	9.4e-21
WP_013923804.1|350013_350397_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013923785.1|350646_351978_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
>prophage 12
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	356830	365055	2264399	transposase	Lactobacillus_phage(33.33%)	4	NA	NA
WP_003670599.1|356830_359548_-	KxYKxGKxW signal peptide domain-containing protein	NA	E9LUJ4	Lactobacillus_phage	41.6	7.0e-30
WP_003670601.1|359622_362052_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_003670603.1|362216_363794_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.2	8.2e-31
WP_013923736.1|363924_365055_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
>prophage 13
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	370668	376639	2264399		Escherichia_phage(60.0%)	5	NA	NA
WP_003670612.1|370668_371508_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.6e-33
WP_013923806.1|371654_372695_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.3	1.1e-60
WP_003670616.1|372706_373288_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.7	1.9e-33
WP_003670618.1|373301_374171_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.1	1.9e-101
WP_003670619.1|374317_376639_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	39.8	1.2e-33
>prophage 14
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	389804	390923	2264399		Streptococcus_phage(100.0%)	1	NA	NA
WP_035159796.1|389804_390923_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.0	3.5e-169
>prophage 15
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	394399	398951	2264399		Lactobacillus_prophage(50.0%)	3	NA	NA
WP_003670634.1|394399_397144_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	59.5	2.1e-42
WP_003670636.1|397362_398010_-	sugar transferase	NA	NA	NA	NA	NA
WP_003670638.1|398021_398951_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.0	8.1e-79
>prophage 16
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	408926	553986	2264399	holin,tail,tRNA,integrase,head,protease,portal,capsid,terminase,transposase	Erysipelothrix_phage(57.75%)	146	482834:482859	523836:523861
WP_003672717.1|408926_410087_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.7e-163
WP_035160403.1|410083_410521_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	68.3	3.5e-48
WP_013923809.1|410615_411074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670654.1|411126_412248_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.0	3.5e-20
WP_003670655.1|412459_413761_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.9	1.7e-42
WP_003670658.1|413772_414792_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003670659.1|414952_415315_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003670661.1|415514_416090_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_003670663.1|416094_417018_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035159799.1|417122_418652_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_035159832.1|418788_419820_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_003670666.1|419809_420265_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670667.1|420401_421109_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003670668.1|421202_421712_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670669.1|421858_422293_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003670670.1|422289_422736_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_003670671.1|422743_423667_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	38.1	1.8e-14
WP_003670672.1|423782_424241_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	52.4	3.7e-16
WP_003670678.1|424967_425531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035159801.1|425601_426084_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	43.8	1.6e-25
WP_003670681.1|426227_427559_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	1.2e-30
WP_003670682.1|427784_428966_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.4	3.1e-27
WP_080562290.1|429065_430181_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.3	1.7e-35
WP_013923811.1|430255_431674_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_035160132.1|432116_432662_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.9	1.3e-31
WP_003671721.1|432672_434103_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	40.0	6.4e-91
WP_035160130.1|434206_434923_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003671718.1|435014_435509_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_003671716.1|435765_436803_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	57.2	5.3e-111
WP_003671715.1|436819_437098_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003671713.1|437098_437473_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003671709.1|437887_438208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671707.1|438237_438708_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	54.8	7.1e-39
WP_080542590.1|438711_439038_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	49.1	1.1e-22
WP_003671705.1|439329_439638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671703.1|439877_440465_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	67.4	3.2e-65
WP_003671695.1|442206_442794_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_003671692.1|443531_444077_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003671691.1|444076_444307_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003671689.1|444333_446235_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	1.0e-88
WP_003671688.1|446464_447325_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_013923814.1|447904_448306_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	51.2	9.6e-29
WP_003671685.1|448593_448968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671680.1|451509_452049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671679.1|452545_453772_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_003671678.1|454063_454420_+	MFS transporter	NA	NA	NA	NA	NA
WP_003671677.1|454416_454650_+	MFS transporter	NA	NA	NA	NA	NA
WP_003671675.1|455449_456049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671674.1|456103_458074_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003671673.1|458074_461422_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_013923817.1|461425_462265_-	Eco57I restriction-modification methylase domain-containing protein	NA	NA	NA	NA	NA
WP_003671670.1|463615_464374_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_003671666.1|464599_465334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671665.1|465377_465590_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	72.6	1.1e-18
WP_003671664.1|465618_468228_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_003671663.1|468233_469532_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_003671662.1|469909_470368_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003671661.1|470450_470654_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	39.7	9.8e-06
WP_003671660.1|470637_470955_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	35.1	1.2e-05
WP_003671659.1|470951_472091_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	53.0	2.2e-110
WP_003671657.1|472068_472644_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.4	6.3e-74
WP_013923820.1|472699_474634_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	56.9	7.8e-225
WP_003671652.1|474700_475105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923821.1|475107_477363_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.7	1.6e-213
WP_035160419.1|477575_477857_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	52.2	5.7e-20
WP_013923822.1|477837_479193_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	65.5	5.6e-153
WP_003671979.1|479189_479657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671980.1|479805_480183_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	57.3	4.6e-33
WP_003671981.1|480302_480845_+|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	59.9	1.0e-57
WP_003671982.1|480844_482071_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	63.1	1.0e-153
WP_003671983.1|482143_482764_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	44.5	7.6e-41
WP_003671984.1|482766_482973_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
482834:482859	attL	ATACTGGCGAAGTAAACATGTTTGAT	NA	NA	NA	NA
WP_006499680.1|483103_484072_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_040455906.1|484152_485715_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	77.7	8.1e-249
WP_013923824.1|485743_487009_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	62.1	1.6e-154
WP_003671987.1|487005_487677_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	4.4e-58
WP_003671989.1|487695_488874_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	3.1e-128
WP_003671991.1|488890_489169_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003671993.1|489168_489552_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003671994.1|489538_489952_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	64.2	3.9e-41
WP_003671998.1|491093_491327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671999.1|491362_493024_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	40.6	2.1e-106
WP_003672000.1|493016_494594_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	50.5	6.1e-135
WP_003672002.1|494763_495615_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	4.1e-29
WP_035160209.1|495616_496468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672004.1|496470_496923_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003672005.1|496924_497311_+	DUF3021 family protein	NA	NA	NA	NA	NA
WP_003672007.1|497927_498164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672008.1|498188_501305_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.0	3.4e-65
WP_003672009.1|501359_502517_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003672011.1|502513_503482_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.0	4.8e-34
WP_003672012.1|503549_504209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672014.1|504205_504736_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035160210.1|504725_506258_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	31.3	4.1e-51
WP_003672018.1|506260_506482_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	67.2	2.2e-19
WP_003672019.1|506493_509106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672020.1|509110_510496_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_003672022.1|510806_511325_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035160212.1|511424_511628_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	34.3	9.8e-06
WP_013923826.1|511611_511947_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	39.1	3.6e-05
WP_003672026.1|511943_513080_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	52.4	2.0e-108
WP_178084819.1|513084_513636_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	74.3	2.1e-74
WP_013923827.1|513691_515626_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.2	1.3e-224
WP_003672034.1|515712_516099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923828.1|516101_518357_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.4	1.8e-212
WP_035160218.1|518569_518851_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	56.3	9.7e-20
WP_013923829.1|518831_520187_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	65.5	3.3e-153
WP_003672633.1|520183_520651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672634.1|520798_521176_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	57.3	4.6e-33
WP_003672635.1|521298_521841_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.6	6.0e-58
WP_003672636.1|521840_523070_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	62.4	5.8e-149
WP_003672637.1|523143_523776_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	39.5	2.8e-38
WP_003672638.1|523768_523975_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
523836:523861	attR	ATACTGGCGAAGTAAACATGTTTGAT	NA	NA	NA	NA
WP_013923830.1|524040_525642_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.7	1.5e-250
WP_003672640.1|525669_525831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672642.1|525971_526133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672643.1|526189_527446_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	62.8	3.3e-152
WP_003672645.1|527442_528105_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	56.0	4.2e-53
WP_003672646.1|528125_529304_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	59.7	2.6e-130
WP_003672647.1|529316_529595_+|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	41.1	7.7e-09
WP_003672649.1|529595_529976_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003672651.1|529965_530388_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.8	1.5e-40
WP_003672653.1|530485_530674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672655.1|530735_532289_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	35.3	1.0e-86
WP_003672657.1|532275_532680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672658.1|532666_534253_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	47.3	2.6e-125
WP_003672659.1|534306_534570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672660.1|534571_534796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_178084820.1|534885_536259_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	53.3	2.4e-135
WP_003672662.1|536355_537369_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.0	1.3e-18
WP_003672663.1|537380_538805_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003668756.1|538806_540279_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003672664.1|540278_540596_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003672665.1|540748_541864_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003672666.1|541867_543910_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	34.7	5.9e-98
WP_003672667.1|543928_546202_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	43.2	5.5e-137
WP_003672668.1|546364_547492_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003672669.1|547508_548084_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003672670.1|548108_548777_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	49.0	1.5e-29
WP_035160390.1|548883_549657_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_003668771.1|549771_550173_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003672672.1|550180_550624_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003672673.1|550729_551500_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003672674.1|551519_552323_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003672676.1|552319_553183_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.2	1.0e-19
WP_003672677.1|553158_553986_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	34.3	2.5e-23
>prophage 17
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	568599	612118	2264399	protease,transposase	Streptococcus_phage(18.18%)	33	NA	NA
WP_013923736.1|568599_569730_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003672254.1|573338_575426_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	2.6e-64
WP_003668788.1|575565_576036_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003664576.1|576056_576476_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003672255.1|576743_577418_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_013923833.1|577456_578632_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_003672258.1|578701_582337_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	1.1e-65
WP_003674901.1|582380_585998_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.8	2.3e-52
WP_003664584.1|586225_586828_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003672260.1|587122_589615_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	39.7	6.9e-125
WP_013923834.1|589629_590097_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003672262.1|590270_591299_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	30.1	2.6e-30
WP_035160279.1|591688_592522_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013923835.1|592676_594008_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	1.9e-49
WP_013923837.1|595226_596474_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.4	1.7e-10
WP_006499680.1|596493_597462_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003672515.1|598260_598902_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	50.9	5.1e-56
WP_003672516.1|599001_600477_-	amino acid permease	NA	NA	NA	NA	NA
WP_013923838.1|600816_601272_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003672518.1|601342_602017_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003672519.1|602082_602556_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003672520.1|602567_603323_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003672521.1|603424_603625_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.3	6.3e-21
WP_003672522.1|603771_604446_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003672523.1|604629_605550_+	cation transporter	NA	NA	NA	NA	NA
WP_003672524.1|605614_606307_-	VIT family protein	NA	NA	NA	NA	NA
WP_003672525.1|606321_607005_-	VIT family protein	NA	NA	NA	NA	NA
WP_003668816.1|607176_607653_-	universal stress protein	NA	NA	NA	NA	NA
WP_003672526.1|607936_608671_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	4.1e-33
WP_003672528.1|608683_609514_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003668822.1|609513_610152_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003664620.1|610164_610818_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003668824.1|610930_612118_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 18
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	617943	689023	2264399	transposase	Streptococcus_phage(30.0%)	57	NA	NA
WP_013923784.1|617943_618909_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_041816968.1|618894_619797_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013923785.1|619954_621286_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
WP_013923840.1|621555_622686_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_035159806.1|622898_625484_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003670687.1|625542_626115_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_003670688.1|626127_627111_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003670690.1|627159_628668_-	MFS transporter	NA	NA	NA	NA	NA
WP_003670692.1|628795_629449_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_003668849.1|629461_630829_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003670693.1|630884_631772_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003670695.1|631988_632780_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003670696.1|632760_634188_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_020843286.1|634284_635823_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_003670699.1|635812_636718_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_003670701.1|636720_637014_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_035159808.1|637013_638057_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_003670706.1|638067_639225_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_035159809.1|639362_640307_+	citrate lyase	NA	NA	NA	NA	NA
WP_003670710.1|640359_641781_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003670711.1|641801_642743_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003670713.1|642808_644203_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.1	1.0e-56
WP_003670715.1|644321_645710_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003670716.1|646004_647633_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003670718.1|647769_648651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003670720.1|648694_649288_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.6	1.1e-25
WP_003670721.1|649360_650407_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003670722.1|650457_651657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143449551.1|651657_651870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670725.1|651903_652143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670726.1|652232_653393_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	67.5	1.4e-149
WP_003670728.1|653573_654971_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_003670730.1|655021_655222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670733.1|655339_656377_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_013923770.1|656477_657860_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003670735.1|658366_658807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049779702.1|658984_660190_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_003670738.1|660423_661221_+	serine hydrolase	NA	NA	NA	NA	NA
WP_013923770.1|661318_662701_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003668877.1|663282_664740_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_003670740.1|664766_665984_-	MFS transporter	NA	NA	NA	NA	NA
WP_003670741.1|666280_667615_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_148412342.1|668603_669890_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_013923744.1|669977_670943_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_035159810.1|671983_672928_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003670753.1|674868_675585_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035159811.1|675764_676793_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003670757.1|676893_677415_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003668897.1|677609_678524_-	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	41.8	1.2e-61
WP_003670759.1|678973_679906_+	ferrochelatase	NA	NA	NA	NA	NA
WP_003670760.1|679907_681212_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_035159813.1|681480_682026_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004562238.1|682044_682713_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_004562239.1|682705_684049_-	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_004562240.1|684203_685976_+	oleate hydratase	NA	NA	NA	NA	NA
WP_013923845.1|686138_687359_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.0	6.3e-71
WP_013923770.1|687640_689023_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
>prophage 19
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	694095	698316	2264399		Pseudomonas_phage(50.0%)	3	NA	NA
WP_013923770.1|694095_695478_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_029507504.1|696845_697550_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003671968.1|697560_698316_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	2.5e-14
>prophage 20
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	703931	757182	2264399	protease,transposase,integrase	Streptococcus_phage(23.08%)	43	721086:721145	769741:769857
WP_013923784.1|703931_704897_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003671536.1|707790_708174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671535.1|708336_709350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671533.1|709466_709997_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003671527.1|711376_711841_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_041816970.1|711923_713300_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.9e-29
WP_003671526.1|713377_714421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923785.1|714561_715893_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
WP_003664757.1|716114_716672_-	elongation factor P	NA	NA	NA	NA	NA
WP_003671523.1|716931_718113_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003671520.1|718985_719387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923840.1|719954_721085_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
721086:721145	attL	TTGACGGACATCCTTTCATATAGGTTTGATTCACTTAATATGATACCTGATGTCACGCCG	NA	NA	NA	NA
WP_178084821.1|721346_722210_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003664767.1|722325_722802_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003671515.1|723189_723876_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_078010085.1|724302_724488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671508.1|725056_725200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671507.1|725249_725537_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	1.4e-05
WP_003671505.1|725628_725871_+	cytochrome b5	NA	NA	NA	NA	NA
WP_049779703.1|727395_728565_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_003672717.1|728749_729910_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.7e-163
WP_041816986.1|729906_730344_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	67.6	1.7e-47
WP_003671501.1|730475_730937_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003671499.1|730948_731542_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_013923856.1|732467_733646_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	3.5e-119
WP_041816994.1|733645_734044_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	61.4	1.9e-45
WP_003671488.1|734167_734725_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003671487.1|734895_735768_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003671485.1|735838_737077_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003671482.1|737471_738689_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	24.3	1.6e-21
WP_003671481.1|738666_738882_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_003671471.1|738883_739150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923858.1|739149_741213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160075.1|741179_742085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671468.1|742696_743260_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.7	1.4e-33
WP_003671467.1|743905_744553_+	recombinase family protein	NA	NA	NA	NA	NA
WP_003671466.1|744542_745028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|745120_746251_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_006499680.1|746487_747456_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003671465.1|747744_753168_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_049779704.1|753308_753686_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013923770.1|753754_755137_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003671463.1|755934_757182_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	24.1	1.2e-16
769741:769857	attR	CGGCGTGACATCAGGTATCATATTAAGTGAATCAAACCTATATGAAAGGATGTCCGTCAAATGACGCACTTAAATGATACCATGCCCACTAACTTTTTGGCCACCCATCGCAAATAT	NA	NA	NA	NA
>prophage 21
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	768761	829162	2264399	transposase	Streptococcus_phage(22.22%)	57	NA	NA
WP_158088131.1|768761_769022_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_003672423.1|769111_769453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013923840.1|769800_770931_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_003672422.1|770989_771256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672421.1|771242_771905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143455555.1|771885_773097_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003672419.1|773053_773632_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_035160322.1|774339_775893_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.2	8.4e-20
WP_003672417.1|776407_777598_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003672416.1|777594_778518_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	30.8	9.3e-27
WP_035160320.1|778708_780805_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.0	1.6e-151
WP_003672412.1|781015_781885_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003672411.1|781924_782209_-	NADH oxidase	NA	NA	NA	NA	NA
WP_003672409.1|782209_784537_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003672408.1|784735_785386_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003669019.1|785459_786113_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003672406.1|786142_787420_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003664819.1|787466_787718_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003672404.1|787720_787918_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003672402.1|788136_789150_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	33.0	6.2e-40
WP_003672401.1|789403_792271_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003672398.1|792307_792844_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003672397.1|793160_793412_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003672396.1|793466_794306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672395.1|794324_794801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672394.1|794860_795298_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003672393.1|795338_795911_-	guanylate kinase	NA	S4VT50	Pandoravirus	39.7	1.6e-05
WP_035160315.1|795917_796328_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003672390.1|796456_797848_+	amino acid permease	NA	NA	NA	NA	NA
WP_003672389.1|798029_799334_+	MFS transporter	NA	NA	NA	NA	NA
WP_013923862.1|799577_800753_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	5.9e-119
WP_041816984.1|800752_801151_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_013923864.1|801269_802688_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003670052.1|804067_805141_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003670050.1|805137_805956_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003670048.1|805955_806762_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	24.2	2.8e-11
WP_003664847.1|806761_807853_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.1	1.2e-36
WP_013923866.1|808093_809269_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	2.7e-119
WP_041816996.1|809268_809667_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.1e-45
WP_003670043.1|809842_812245_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_003670041.1|812334_813246_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_035159616.1|813481_816145_+	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.8	8.6e-65
WP_003670037.1|816289_816757_+	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.3	4.1e-15
WP_003670031.1|818369_819026_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003670029.1|819119_819707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670028.1|819737_819968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670026.1|820262_820682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923869.1|820770_820989_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003670023.1|820985_821984_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A249XZT7	Enterococcus_phage	29.3	2.0e-14
WP_003670022.1|822147_823110_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_013923870.1|823482_824658_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	3.5e-119
WP_041816996.1|824657_825056_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.1e-45
WP_003670020.1|825232_825337_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003670019.1|825348_825987_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003670018.1|826164_826950_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003670016.1|827214_827775_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003670014.1|827779_829162_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.8e-16
>prophage 22
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	833909	834323	2264399		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003664887.1|833909_834323_+	helix-turn-helix transcriptional regulator	NA	A0A0H4ITV7	Staphylococcus_phage	44.3	1.6e-07
>prophage 23
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	838880	839762	2264399		Hokovirus(100.0%)	1	NA	NA
WP_003670001.1|838880_839762_+	XRE family transcriptional regulator	NA	A0A1V0SGN0	Hokovirus	32.8	3.9e-14
>prophage 24
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	843055	884302	2264399	tRNA,transposase	unidentified_phage(27.27%)	37	NA	NA
WP_013923840.1|843055_844186_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_003664906.1|844361_844829_+	universal stress protein	NA	NA	NA	NA	NA
WP_003669986.1|844840_846769_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	D0R0F5	Streptococcus_phage	30.8	1.1e-66
WP_003669985.1|846988_847891_-	ROK family protein	NA	NA	NA	NA	NA
WP_006499680.1|848183_849152_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_035159607.1|850482_851229_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003669978.1|851263_852619_-	APC family permease	NA	NA	NA	NA	NA
WP_003669977.1|852794_855206_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003669974.1|855524_856256_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013923736.1|856493_857624_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_013923874.1|857676_858183_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003669972.1|858261_859698_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003669971.1|859836_862041_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	R9R4J2	Mycobacterium_phage	32.6	3.1e-84
WP_003669970.1|862113_863943_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.6e-57
WP_003669969.1|863926_865669_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.8e-39
WP_003669968.1|865665_866214_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035159637.1|866409_867432_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.3	2.4e-52
WP_003669963.1|867689_867875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|868092_869223_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003669962.1|869343_869883_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003669961.1|869888_870266_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_003669960.1|870408_870771_-	EamA family transporter	NA	NA	NA	NA	NA
WP_013923875.1|870779_871250_-	EamA family transporter	NA	NA	NA	NA	NA
WP_013923876.1|871384_872560_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	3.8e-118
WP_035167654.1|872559_872958_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.9e-46
WP_003669958.1|873164_874217_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003669957.1|874218_874929_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003669956.1|874942_875533_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003669954.1|875529_876291_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_003669952.1|876299_876890_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_049779707.1|876951_878247_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003669950.1|878266_879238_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003669949.1|879243_880161_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003675129.1|880150_881416_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_035159600.1|881418_881877_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_003669946.1|881885_883397_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_003669945.1|883492_884302_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	2.5e-15
>prophage 25
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	931094	1123915	2264399	tRNA,transposase,integrase	unidentified_phage(15.25%)	168	988331:988350	1005563:1005582
WP_035159561.1|931094_932576_+	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.9	3.5e-76
WP_003669861.1|932719_934156_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.5	2.4e-29
WP_003669858.1|934658_936611_+	MFS transporter	NA	NA	NA	NA	NA
WP_013923870.1|937082_938258_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	3.5e-119
WP_041816996.1|938257_938656_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.1e-45
WP_003669856.1|938745_939375_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003669855.1|939381_939756_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003669854.1|939834_940299_-	universal stress protein	NA	NA	NA	NA	NA
WP_003669853.1|940503_940974_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_019252975.1|941028_942342_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_013923880.1|942591_943218_+	DedA family protein	NA	NA	NA	NA	NA
WP_013923881.1|943232_944363_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.0	6.7e-27
WP_003669850.1|944562_945555_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.9	4.1e-12
WP_003669849.1|945592_947044_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_035159556.1|947070_948249_-	galactokinase	NA	NA	NA	NA	NA
WP_003669847.1|948443_949412_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003669846.1|949441_950224_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003669845.1|950259_950766_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003664967.1|950779_951004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669844.1|951060_951387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003669843.1|951410_952532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035159553.1|952638_953136_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_035159551.1|953386_954139_+	nicotinamide mononucleotide transporter	NA	A0A2H4PB74	Lactobacillus_phage	70.6	2.1e-93
WP_003669840.1|954310_955153_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	33.1	6.5e-35
WP_003669839.1|955232_955952_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003669838.1|955944_956925_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003669837.1|957037_957793_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	1.1e-25
WP_003669836.1|957792_959721_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003669835.1|959962_960790_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003669833.1|960795_961719_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.1	7.2e-112
WP_003669831.1|961815_962538_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003669829.1|962588_964082_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003669828.1|964157_965318_-	MFS transporter	NA	NA	NA	NA	NA
WP_003669826.1|965418_965922_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	46.7	7.3e-34
WP_013923882.1|965921_966545_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	40.0	1.6e-06
WP_003669822.1|966688_968593_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.5	3.2e-74
WP_003669820.1|968666_968960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003669818.1|968963_970253_-	peptidase	NA	A0A172JHT2	Bacillus_phage	26.9	8.7e-31
WP_003669817.1|970249_971395_-	ATP-binding protein	NA	A0A223LDC9	Bacillus_phage	30.5	9.2e-24
WP_011953588.1|971398_972031_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003669815.1|972090_972471_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_013923884.1|972597_973563_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_164480658.1|973835_974009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003669812.1|974010_974694_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003669810.1|974699_975020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003669809.1|975050_976010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923784.1|976055_977021_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003669808.1|977190_977763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035159539.1|977989_978274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669804.1|978454_979534_-	phosphoesterase	NA	NA	NA	NA	NA
WP_003669801.1|979669_980905_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003669800.1|981259_982645_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003669799.1|982716_983310_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	48.3	3.8e-29
WP_035159531.1|983386_984166_-	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_003669797.1|984207_985749_-	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	26.5	1.5e-37
WP_003669796.1|986503_987025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|987307_988438_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
988331:988350	attL	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_080562295.1|988544_988835_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	44.7	4.0e-16
WP_003669794.1|988895_989930_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_003669793.1|989932_990334_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	49.6	1.8e-27
WP_013923887.1|990427_990787_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	32.7	5.2e-10
WP_013923888.1|990803_991421_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_003669792.1|992027_992513_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	45.6	3.3e-07
WP_003669791.1|992528_992909_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003669790.1|993341_993551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003669789.1|993534_994146_+	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_003669787.1|994963_995992_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	44.9	7.2e-12
WP_003669786.1|996365_997361_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003665032.1|997357_998257_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003669785.1|998249_999014_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-10
WP_003669784.1|999079_999643_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_003669783.1|999690_1000023_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003669782.1|1000195_1001518_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_098046634.1|1001664_1002951_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_041816971.1|1003316_1004525_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	3.4e-93
WP_013923790.1|1004539_1005670_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.3	2.3e-35
1005563:1005582	attR	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_003669780.1|1006062_1006380_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	38.8	9.3e-19
WP_003669779.1|1006381_1007137_-	TerC family protein	NA	S5MAL1	Bacillus_phage	41.8	2.4e-41
WP_003669778.1|1007155_1008076_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003669776.1|1008222_1009140_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003669775.1|1009181_1010615_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003669772.1|1010981_1012310_+	purine permease	NA	Q9KX94	Enterobacteria_phage	30.8	2.7e-35
WP_013923891.1|1012621_1014052_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_013923840.1|1014044_1015175_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_013923892.1|1017122_1017557_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013923893.1|1017752_1018928_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	56.0	2.7e-119
WP_041816999.1|1018927_1019326_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.5e-45
WP_003669760.1|1019737_1020475_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003669758.1|1020601_1021255_-	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_003669756.1|1021386_1021650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669754.1|1021775_1023905_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.4	4.0e-158
WP_003669751.1|1024063_1025185_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_013923736.1|1025401_1026532_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_049779709.1|1026727_1027822_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	40.8	6.9e-69
WP_013923770.1|1027886_1029269_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003670075.1|1030146_1031001_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006499680.1|1031116_1032085_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003670076.1|1032149_1033361_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_003670077.1|1033431_1034013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670079.1|1034211_1034868_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003670081.1|1035384_1036770_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003670082.1|1037085_1037724_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003670083.1|1037802_1038204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670084.1|1038420_1039698_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003670086.1|1040024_1041221_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.6	2.0e-53
WP_003670087.1|1041222_1041843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003665077.1|1042066_1042252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670088.1|1042383_1043328_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	6.9e-17
WP_003670089.1|1043753_1045460_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	41.6	2.5e-25
WP_003670090.1|1045623_1045944_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003670091.1|1046045_1046282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670092.1|1046390_1048373_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	39.7	9.3e-32
WP_003670093.1|1048469_1049159_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	8.5e-33
WP_003670094.1|1049177_1050236_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003670096.1|1050247_1050760_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003665087.1|1050915_1051926_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.8	3.1e-07
WP_003670099.1|1052448_1054089_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_041816972.1|1054165_1055542_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.9e-29
WP_003670100.1|1055855_1056539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035159672.1|1056867_1058673_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	31.9	3.9e-85
WP_003670105.1|1059113_1060346_-	MFS transporter	NA	NA	NA	NA	NA
WP_003670112.1|1061888_1063283_+	amino acid permease	NA	NA	NA	NA	NA
WP_013923790.1|1064455_1065586_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.3	2.3e-35
WP_003670117.1|1066298_1066736_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670119.1|1068492_1069149_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_035159677.1|1069277_1069589_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003670122.1|1069686_1070289_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003670124.1|1070355_1070808_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003670125.1|1070800_1072114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923901.1|1072125_1073301_-	MFS transporter	NA	NA	NA	NA	NA
WP_003670129.1|1073376_1074699_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.5	6.6e-66
WP_003670131.1|1074917_1075559_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003670133.1|1075704_1078236_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.3	2.4e-64
WP_003670134.1|1078296_1078749_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003670140.1|1079882_1080893_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.4	5.5e-65
WP_035159679.1|1080912_1082211_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.7	6.0e-56
WP_013923903.1|1083482_1084613_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	1.1e-34
WP_003670146.1|1085060_1085732_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003670148.1|1085833_1086205_-	HesB/YadR/YfhF-family protein	NA	NA	NA	NA	NA
WP_003670149.1|1086456_1087308_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_041817002.1|1087380_1088259_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.8e-51
WP_013923736.1|1088382_1089513_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003670152.1|1089673_1090546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035159681.1|1090621_1091611_+	asparaginase	NA	NA	NA	NA	NA
WP_003670156.1|1091665_1092667_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003670158.1|1092899_1093832_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003670159.1|1093882_1094695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670162.1|1096213_1097167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670165.1|1097962_1099294_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	28.9	1.1e-23
WP_035159684.1|1099290_1099971_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	8.1e-28
WP_003670169.1|1100336_1100540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670171.1|1100845_1101109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670172.1|1102487_1103507_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003670176.1|1103721_1104258_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	25.5	7.3e-08
WP_003670177.1|1104477_1105068_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.5	2.2e-13
WP_013923840.1|1105752_1106883_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_003670181.1|1107111_1107258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035159692.1|1107280_1107958_-	glucose-6-phosphate 1-dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003669460.1|1108054_1108378_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003670186.1|1108898_1109357_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.7	1.3e-18
WP_003670189.1|1109932_1111354_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003670192.1|1114070_1114568_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670193.1|1114605_1115211_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003670194.1|1115502_1116747_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003670195.1|1116764_1118315_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_035159694.1|1118453_1120373_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1X9VNR2	Mimivirus	28.9	5.7e-18
WP_003670197.1|1120571_1122515_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_035159695.1|1122526_1123915_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 26
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1128391	1136730	2264399		Bacillus_virus(50.0%)	7	NA	NA
WP_003670203.1|1128391_1129534_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	31.2	1.1e-13
WP_003670204.1|1129782_1130004_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003670206.1|1130012_1131137_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003670208.1|1131133_1133083_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.8	2.7e-140
WP_003670209.1|1133125_1135615_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.4	1.4e-114
WP_003665235.1|1135832_1136129_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003670210.1|1136166_1136730_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	71.1	1.3e-42
>prophage 27
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1141415	1159225	2264399		Bacillus_phage(33.33%)	14	NA	NA
WP_003670215.1|1141415_1142807_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.5	4.0e-122
WP_003670216.1|1142928_1144131_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	31.9	4.2e-43
WP_003670217.1|1144143_1144470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670218.1|1144569_1145454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670220.1|1146072_1147140_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	31.6	1.2e-36
WP_003670222.1|1147405_1147840_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013923911.1|1147927_1149649_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	44.2	1.3e-111
WP_011953351.1|1149991_1150699_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	4.3e-40
WP_035159702.1|1150712_1152578_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.7	7.2e-34
WP_003670226.1|1152555_1153851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670228.1|1153863_1154706_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_003670229.1|1154723_1155530_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.1	3.3e-36
WP_003670231.1|1155630_1156905_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	2.8e-21
WP_003670234.1|1158715_1159225_+	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	51.3	6.3e-41
>prophage 28
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1164071	1171228	2264399	protease,transposase	unidentified_phage(33.33%)	6	NA	NA
WP_013923736.1|1164071_1165202_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003669548.1|1165465_1165894_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003670240.1|1165961_1166957_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.8	2.9e-34
WP_003670242.1|1166958_1168146_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003670244.1|1168651_1168873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670246.1|1168990_1171228_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.9	3.5e-120
>prophage 29
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1181353	1185532	2264399		Bacillus_phage(100.0%)	1	NA	NA
WP_003670254.1|1181353_1185532_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.2	1.6e-17
>prophage 30
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1193664	1194330	2264399		Alteromonas_phage(100.0%)	1	NA	NA
WP_003670268.1|1193664_1194330_+	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	25.2	1.3e-06
>prophage 31
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1199243	1200110	2264399		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003670278.1|1199243_1200110_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.0	2.8e-57
>prophage 32
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1204263	1206732	2264399		Staphylococcus_virus(50.0%)	2	NA	NA
WP_003669595.1|1204263_1205238_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.2	3.5e-133
WP_003665344.1|1205433_1206732_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.4	2.5e-70
>prophage 33
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1210724	1212107	2264399		Pseudomonas_phage(100.0%)	1	NA	NA
WP_013923770.1|1210724_1212107_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
>prophage 34
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1219907	1221290	2264399		Pseudomonas_phage(100.0%)	1	NA	NA
WP_013923770.1|1219907_1221290_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
>prophage 35
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1228688	1232173	2264399		Lactobacillus_phage(66.67%)	3	NA	NA
WP_003670309.1|1228688_1230095_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.4	1.0e-80
WP_013923915.1|1230350_1230923_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	45.1	1.6e-40
WP_003670311.1|1230922_1232173_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	45.5	8.4e-39
>prophage 36
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1235253	1240330	2264399	tRNA,transposase	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_003670315.1|1235253_1236561_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	1.0e-95
WP_013923918.1|1236927_1238064_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	31.6	1.6e-28
WP_003670316.1|1238121_1239585_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003670318.1|1239586_1240330_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	5.9e-32
>prophage 37
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1247042	1249665	2264399		Bifidobacterium_phage(66.67%)	3	NA	NA
WP_003670330.1|1247042_1248011_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	32.0	3.4e-11
WP_003669666.1|1248023_1248794_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.9	9.8e-30
WP_003670332.1|1248780_1249665_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	29.9	5.4e-16
>prophage 38
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1254023	1265443	2264399	transposase	Bacillus_phage(33.33%)	11	NA	NA
WP_003670341.1|1254023_1255322_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	52.7	1.7e-119
WP_003670343.1|1255342_1256053_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_003670345.1|1256320_1257259_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003669685.1|1257337_1258480_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	33.1	1.0e-59
WP_003665397.1|1258660_1259350_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.1e-38
WP_013923920.1|1259381_1260554_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	8.5e-33
WP_013923918.1|1260540_1261677_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	31.6	1.6e-28
WP_013923921.1|1261955_1262864_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003669691.1|1262866_1263211_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003670355.1|1263287_1264169_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003670357.1|1264513_1265443_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	36.9	6.5e-28
>prophage 39
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1269824	1270487	2264399		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003670368.1|1269824_1270487_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	46.0	1.8e-40
>prophage 40
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1275113	1341429	2264399	tRNA,transposase,integrase	Prochlorococcus_phage(13.33%)	50	1323091:1323110	1347215:1347234
WP_013923922.1|1275113_1276361_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	3.0e-12
WP_006499680.1|1276458_1277427_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003672297.1|1277742_1279422_+	acetolactate synthase AlsS	NA	G8DDL3	Micromonas_pusilla_virus	22.7	8.7e-31
WP_035160289.1|1279438_1280155_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003672295.1|1280282_1280507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672294.1|1280832_1280973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672293.1|1281000_1281378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003672292.1|1281379_1282873_-	threonine synthase	NA	NA	NA	NA	NA
WP_003672291.1|1282979_1284254_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003672289.1|1284265_1285126_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003672287.1|1285279_1285765_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	3.1e-21
WP_003672285.1|1285727_1286882_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003672284.1|1286953_1288249_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.0	1.1e-17
WP_003672282.1|1288472_1289192_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_003672280.1|1289192_1289441_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003672279.1|1289441_1290122_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003672278.1|1290125_1292354_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	6.8e-148
WP_013923923.1|1292329_1293784_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	9.4e-58
WP_003672276.1|1293788_1294826_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	40.2	1.5e-60
WP_003672274.1|1294835_1295408_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.6	6.8e-28
WP_003672273.1|1295411_1296950_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.1	7.6e-74
WP_003672271.1|1296965_1298225_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_013923924.1|1298341_1299760_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003665449.1|1299899_1300586_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003672269.1|1300752_1301802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160286.1|1302155_1303406_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	3.5e-85
WP_003671436.1|1310069_1310669_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_003671434.1|1310668_1311259_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_003671433.1|1311283_1314949_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_003671432.1|1314957_1318569_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_003671431.1|1319146_1319434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671430.1|1319437_1319842_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_003671429.1|1319843_1322351_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
1323091:1323110	attL	CGTCAACCCTAAGGGGTATT	NA	NA	NA	NA
WP_013923925.1|1323114_1324491_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_003671425.1|1324587_1324914_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041816973.1|1325230_1328266_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_013923927.1|1328406_1328643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671419.1|1328648_1328882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671418.1|1329057_1329558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671416.1|1329554_1330196_-	recombinase family protein	NA	NA	NA	NA	NA
WP_003671415.1|1330845_1331415_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.6	5.4e-33
WP_003671413.1|1332020_1332737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671410.1|1332736_1335673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671409.1|1335696_1335930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671408.1|1335942_1336509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671407.1|1336569_1336770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160055.1|1336831_1338034_+|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	23.4	5.3e-14
WP_003671405.1|1338199_1339261_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.9	1.9e-07
WP_003671404.1|1340328_1340517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160043.1|1340505_1341429_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.1	3.3e-32
1347215:1347234	attR	AATACCCCTTAGGGTTGACG	NA	NA	NA	NA
>prophage 41
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1354402	1366187	2264399	protease,transposase	unidentified_phage(20.0%)	9	NA	NA
WP_013923840.1|1354402_1355533_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_035160034.1|1355946_1356900_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.3	1.2e-13
WP_003671371.1|1356899_1357400_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003671369.1|1357420_1360270_+	DEAD/DEAH box helicase	NA	A0A1B0YC45	Lactobacillus_phage	25.7	1.1e-20
WP_003671367.1|1360745_1362101_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	52.9	1.8e-127
WP_003671366.1|1362386_1362707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671365.1|1362815_1363520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671362.1|1363595_1364330_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003671361.1|1364378_1366187_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.0	7.1e-71
>prophage 42
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1370559	1387491	2264399	transposase	Planktothrix_phage(33.33%)	14	NA	NA
WP_003671350.1|1370559_1371330_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	3.3e-25
WP_003671349.1|1371322_1371961_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003665495.1|1372032_1372461_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_013923736.1|1373947_1375078_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003665503.1|1376066_1376756_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003671341.1|1376748_1377813_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	2.5e-23
WP_003671339.1|1377825_1378677_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013923770.1|1378828_1380211_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003671337.1|1381107_1382028_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003671335.1|1382186_1383383_+	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.7	1.8e-06
WP_003671333.1|1383464_1383755_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_003671331.1|1383755_1384397_-	endonuclease III	NA	NA	NA	NA	NA
WP_003671329.1|1384694_1386167_+	amino acid permease	NA	NA	NA	NA	NA
WP_178084822.1|1386129_1387491_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.2	6.0e-22
>prophage 43
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1391361	1392806	2264399		Anguillid_herpesvirus(50.0%)	2	NA	NA
WP_003671324.1|1391361_1391805_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	8.4e-26
WP_003671323.1|1391846_1392806_-	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	27.8	5.5e-14
>prophage 44
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1397403	1401500	2264399	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_003671318.1|1397403_1398102_+	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	30.4	9.2e-19
WP_003671314.1|1398546_1399395_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003671312.1|1399472_1401500_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	1.3e-89
>prophage 45
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1405459	1471766	2264399	protease,tRNA,transposase	unidentified_phage(10.0%)	58	NA	NA
WP_013923736.1|1405459_1406590_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003671305.1|1406735_1407647_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003671304.1|1407654_1408326_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	9.5e-13
WP_003671302.1|1408325_1409123_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003667193.1|1409364_1410210_+	pur operon repressor	NA	NA	NA	NA	NA
WP_003671300.1|1410213_1411581_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.1	2.4e-31
WP_003671298.1|1411655_1412645_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	8.4e-42
WP_003671296.1|1412934_1413678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671295.1|1413748_1414570_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003671292.1|1414569_1415937_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.4	5.6e-28
WP_003671291.1|1415938_1416763_-	ligase	NA	NA	NA	NA	NA
WP_013923938.1|1417371_1418547_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	7.8e-119
WP_035160025.1|1418761_1419172_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_172401344.1|1419217_1419775_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003671286.1|1419950_1421555_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	7.5e-149
WP_003671285.1|1421823_1423101_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003665599.1|1423193_1423439_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003671283.1|1423600_1424917_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003671281.1|1424900_1425791_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003671280.1|1425840_1426545_+	class A sortase	NA	NA	NA	NA	NA
WP_003671278.1|1426960_1429342_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	30.7	2.7e-118
WP_003671277.1|1429357_1431145_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_003671275.1|1431157_1431937_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_035160021.1|1431948_1432815_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003671272.1|1432834_1433491_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003667233.1|1433529_1433994_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003667234.1|1434123_1434693_+	LemA family protein	NA	NA	NA	NA	NA
WP_003671267.1|1434695_1435592_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003671266.1|1435745_1437125_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003667239.1|1437196_1438693_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	3.4e-71
WP_013923939.1|1438773_1439610_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	5.0e-27
WP_003671262.1|1440070_1441006_+	glutaminase	NA	NA	NA	NA	NA
WP_003671261.1|1441049_1442339_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003671260.1|1442331_1442571_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003671258.1|1442590_1443808_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.7	1.1e-22
WP_003671256.1|1443807_1445334_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.7	5.5e-40
WP_003671255.1|1445355_1445496_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003671253.1|1445819_1446182_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003671252.1|1446182_1447310_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.4	1.2e-28
WP_003667249.1|1447328_1447703_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	2.1e-09
WP_003671251.1|1447892_1449269_+	cytosine permease	NA	NA	NA	NA	NA
WP_003671249.1|1449259_1450498_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_003671247.1|1450882_1451674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160010.1|1451919_1452558_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_035160007.1|1452763_1453324_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003671241.1|1453342_1456882_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003671240.1|1456878_1457151_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003671238.1|1457251_1457608_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003665652.1|1457796_1458291_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_013923940.1|1458292_1459687_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	28.1	3.3e-15
WP_003671235.1|1459679_1460222_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	27.4	7.2e-11
WP_003671234.1|1460455_1462564_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.4	4.6e-106
WP_035160003.1|1462654_1463575_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003671232.1|1463682_1464684_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003671230.1|1464704_1466231_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	41.7	4.4e-90
WP_003671227.1|1467486_1468434_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_013923770.1|1469011_1470394_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_041816974.1|1470458_1471766_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	1.9e-49
>prophage 46
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1475377	1478318	2264399	transposase	unidentified_phage(50.0%)	3	NA	NA
WP_013923840.1|1475377_1476508_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_013923943.1|1476522_1477098_-	recombinase family protein	NA	NA	NA	NA	NA
WP_003672067.1|1477742_1478318_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	42.6	9.2e-33
>prophage 47
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1484806	1488142	2264399	integrase	unidentified_phage(50.0%)	2	1481057:1481070	1489205:1489218
1481057:1481070	attL	TGAATTTTATTTTC	NA	NA	NA	NA
WP_003672051.1|1484806_1486039_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUX8	unidentified_phage	41.6	5.3e-86
WP_013923944.1|1486759_1488142_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	7.9e-30
1489205:1489218	attR	GAAAATAAAATTCA	NA	NA	NA	NA
>prophage 48
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1495127	1502331	2264399	transposase	Lactococcus_phage(33.33%)	5	NA	NA
WP_003670588.1|1495127_1495880_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	49.2	1.5e-62
WP_041816975.1|1497191_1497548_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013923947.1|1497618_1499163_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	25.1	3.9e-17
WP_003670585.1|1499235_1499364_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003670582.1|1500831_1502331_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.1	2.7e-68
>prophage 49
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1509147	1511454	2264399		Bacillus_virus(100.0%)	2	NA	NA
WP_003670572.1|1509147_1510614_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.0	2.8e-110
WP_003670569.1|1510626_1511454_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.1	4.2e-79
>prophage 50
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1514774	1518242	2264399		Pseudomonas_phage(50.0%)	2	NA	NA
WP_013923770.1|1514774_1516157_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003670564.1|1516355_1518242_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	34.0	5.3e-93
>prophage 51
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1523050	1533993	2264399	tRNA	Pandoravirus(20.0%)	11	NA	NA
WP_003670554.1|1523050_1524193_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	25.9	1.5e-18
WP_003667322.1|1524219_1524921_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003670553.1|1524926_1525676_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	5.4e-25
WP_003670552.1|1525691_1526483_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003670551.1|1526590_1527931_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.0	3.6e-72
WP_003670550.1|1527959_1528643_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003666282.1|1528654_1528951_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670548.1|1529089_1529626_+	hypothetical protein	NA	J9PV85	Bacillus_phage	49.1	3.6e-39
WP_003670547.1|1529651_1531025_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003670546.1|1531042_1532200_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_035159778.1|1532580_1533993_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	4.3e-55
>prophage 52
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1539538	1541645	2264399	transposase	unidentified_phage(50.0%)	2	NA	NA
WP_013923736.1|1539538_1540669_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003670541.1|1540712_1541645_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	29.5	8.3e-23
>prophage 53
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1549001	1561802	2264399	transposase	Streptococcus_phage(44.44%)	15	NA	NA
WP_003670529.1|1549001_1550021_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	62.3	2.9e-114
WP_003670528.1|1550135_1552307_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.8	1.7e-252
WP_003666324.1|1552406_1552628_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	45.3	5.0e-11
WP_003670526.1|1552885_1553398_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_041816984.1|1553700_1554099_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_013923949.1|1554098_1555274_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	4.5e-119
WP_003670524.1|1555520_1557356_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.6	1.0e-56
WP_003667377.1|1557364_1557685_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003670523.1|1557688_1558291_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003670521.1|1558295_1558544_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003670519.1|1558553_1559195_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	54.8	6.6e-56
WP_003670516.1|1559214_1559538_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003670515.1|1559552_1560566_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.8	1.1e-33
WP_003670513.1|1560576_1560927_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003670512.1|1560935_1561802_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	52.6	8.6e-75
>prophage 54
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1567583	1573187	2264399	tRNA	Streptococcus_phage(50.0%)	6	NA	NA
WP_003670504.1|1567583_1568579_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.1	9.7e-54
WP_003670503.1|1568724_1569450_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003670502.1|1569433_1569988_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670501.1|1570006_1571038_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.4	7.6e-62
WP_003670500.1|1571151_1571925_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.3	5.6e-33
WP_035159772.1|1571942_1573187_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	8.0e-98
>prophage 55
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1577564	1582626	2264399		Tupanvirus(33.33%)	4	NA	NA
WP_003670490.1|1577564_1579502_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	29.2	7.6e-55
WP_003666366.1|1579742_1580387_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003666368.1|1580621_1580906_+	co-chaperone GroES	NA	A7KV50	Bacillus_phage	34.8	8.4e-11
WP_003670484.1|1580997_1582626_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.4	5.6e-160
>prophage 56
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1590491	1592520	2264399		Streptococcus_phage(100.0%)	2	NA	NA
WP_003670474.1|1590491_1591124_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.0	9.5e-39
WP_003670472.1|1591185_1592520_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	38.9	1.1e-76
>prophage 57
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1601260	1602175	2264399		Bacillus_phage(100.0%)	1	NA	NA
WP_003666398.1|1601260_1602175_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.4	7.5e-69
>prophage 58
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1605521	1606454	2264399		Bacillus_virus(100.0%)	1	NA	NA
WP_003670453.1|1605521_1606454_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.9	2.6e-85
>prophage 59
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1609501	1612659	2264399	transposase	Streptococcus_phage(100.0%)	2	NA	NA
WP_003670449.1|1609501_1611226_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	59.6	5.5e-198
WP_013923785.1|1611327_1612659_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
>prophage 60
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1616163	1626186	2264399		Streptococcus_phage(40.0%)	6	NA	NA
WP_003670443.1|1616163_1619028_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	3.7e-308
WP_035159752.1|1619296_1620628_+	amino acid permease	NA	NA	NA	NA	NA
WP_003670441.1|1620714_1621608_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.4	1.5e-10
WP_003670440.1|1621623_1622610_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	54.6	1.2e-93
WP_003670439.1|1622628_1623570_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.8	2.5e-51
WP_003666435.1|1625592_1626186_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	8.0e-56
>prophage 61
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1629946	1631269	2264399		Streptococcus_phage(100.0%)	1	NA	NA
WP_003666443.1|1629946_1631269_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	69.9	8.9e-172
>prophage 62
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1635663	1643168	2264399	tRNA	Lactococcus_phage(25.0%)	9	NA	NA
WP_003670431.1|1635663_1638069_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.9	6.3e-91
WP_003666449.1|1638086_1638560_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.8	4.0e-42
WP_003670430.1|1638616_1639201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035159745.1|1639351_1640041_+	uracil-DNA glycosylase	NA	A0A0A8IL23	Epstein-Barr_virus	49.2	1.7e-41
WP_003670427.1|1640101_1641076_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003670426.1|1641195_1641675_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003670425.1|1641653_1642163_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670424.1|1642194_1642617_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_003667489.1|1642628_1643168_-	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	26.4	2.8e-07
>prophage 63
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1651786	1661151	2264399		Bacillus_phage(40.0%)	8	NA	NA
WP_003670418.1|1651786_1653607_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.5	8.1e-91
WP_003670417.1|1653867_1654179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670416.1|1654240_1656106_+	acetyltransferase	NA	C6ZR20	Salmonella_phage	28.7	8.8e-24
WP_003670415.1|1656116_1656572_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013923961.1|1656576_1657383_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003670413.1|1657705_1658308_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	53.1	6.5e-29
WP_003670412.1|1658944_1659664_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	4.7e-34
WP_003670411.1|1659663_1661151_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.9	6.7e-35
>prophage 64
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1664780	1722604	2264399	protease,transposase	Pseudomonas_phage(27.27%)	54	NA	NA
WP_013923784.1|1664780_1665746_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003670405.1|1665976_1666276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670404.1|1666413_1666620_+	sugar (pentulose and hexulose) kinase	NA	NA	NA	NA	NA
WP_003670403.1|1666675_1667515_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003670402.1|1667766_1668774_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003670400.1|1668790_1669723_+	carbamate kinase	NA	NA	NA	NA	NA
WP_003670398.1|1669771_1670683_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003670397.1|1670766_1671348_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003670396.1|1671613_1671991_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003670395.1|1671990_1673928_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.1	1.9e-93
WP_003670394.1|1674044_1674521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670393.1|1674750_1675080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670388.1|1676977_1677844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670387.1|1678193_1679915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670386.1|1680212_1681226_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_143455556.1|1681396_1682683_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003670384.1|1682826_1683420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035159791.1|1683613_1684633_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003670382.1|1684839_1686072_+	arginine deiminase	NA	NA	NA	NA	NA
WP_003666533.1|1686182_1686644_+	arginine repressor	NA	NA	NA	NA	NA
WP_003670381.1|1686664_1688086_+	amino acid permease	NA	NA	NA	NA	NA
WP_003670380.1|1688134_1689541_+	amino acid permease	NA	NA	NA	NA	NA
WP_013923918.1|1689663_1690800_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	31.6	1.6e-28
WP_013923770.1|1691342_1692725_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_003672583.1|1693128_1693836_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_013923965.1|1693835_1695173_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_003667548.1|1695402_1695978_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	52.4	1.3e-47
WP_003676159.1|1695999_1697082_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	4.0e-05
WP_003672578.1|1697074_1697941_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_035160352.1|1697946_1698975_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	39.5	4.1e-55
WP_003672575.1|1699088_1700324_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.3	1.0e-97
WP_003676152.1|1700416_1701052_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003672571.1|1701182_1702910_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003672570.1|1703011_1704127_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003672568.1|1704123_1704897_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003666556.1|1705055_1706327_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.5	7.5e-67
WP_003666558.1|1706637_1707345_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003666561.1|1707369_1707588_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003666564.1|1707630_1708149_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003666566.1|1708138_1708681_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003672565.1|1708712_1710242_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003672563.1|1710277_1711222_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003666573.1|1711248_1712676_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003672561.1|1712687_1713119_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003667560.1|1713320_1713584_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_003672560.1|1713602_1714919_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003666578.1|1715025_1716018_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_011953410.1|1716024_1716261_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003666580.1|1716284_1716509_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003666583.1|1716557_1717751_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003672558.1|1717763_1718057_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_013923835.1|1718103_1719435_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	1.9e-49
WP_013923770.1|1719934_1721317_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_013923840.1|1721473_1722604_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
>prophage 65
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1726781	1728206	2264399		Aichi_virus(100.0%)	1	NA	NA
WP_003672384.1|1726781_1728206_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.0	6.5e-35
>prophage 66
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1732792	1737315	2264399		Staphylococcus_phage(50.0%)	5	NA	NA
WP_003672376.1|1732792_1733635_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.8	3.3e-55
WP_013923967.1|1733627_1734725_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003666602.1|1734836_1735325_-	universal stress protein	NA	NA	NA	NA	NA
WP_003672374.1|1735408_1735705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672373.1|1736010_1737315_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.4	1.4e-97
>prophage 67
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1741144	1741894	2264399		Streptococcus_phage(100.0%)	1	NA	NA
WP_178084824.1|1741144_1741894_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	31.0	1.3e-21
>prophage 68
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1749670	1763969	2264399	tRNA,transposase	Pacmanvirus(20.0%)	9	NA	NA
WP_003671959.1|1749670_1750819_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.9	2.5e-37
WP_003671958.1|1750840_1752061_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_035160185.1|1752386_1755041_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.5	2.2e-153
WP_011953418.1|1755423_1756842_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003671956.1|1756842_1757859_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003671955.1|1757865_1759596_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.4	2.9e-29
WP_003671954.1|1759588_1761334_+	thiol reductant ABC exporter subunit CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	1.4e-20
WP_003671953.1|1761388_1762603_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013923976.1|1762721_1763969_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.2	1.4e-12
>prophage 69
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1769963	1770614	2264399		Planktothrix_phage(100.0%)	1	NA	NA
WP_003671944.1|1769963_1770614_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	4.9e-30
>prophage 70
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1777449	1854861	2264399	tRNA,transposase	Bacillus_phage(17.65%)	69	NA	NA
WP_003671933.1|1777449_1778538_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	7.2e-119
WP_011953420.1|1778772_1780314_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003671931.1|1780475_1783121_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	26.2	4.9e-36
WP_003671930.1|1783132_1785139_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.8	6.5e-65
WP_003671929.1|1785151_1785751_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003671927.1|1785765_1786782_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	32.8	3.0e-10
WP_003671926.1|1786794_1787883_+|tRNA	queuine tRNA-ribosyltransferase family protein	tRNA	NA	NA	NA	NA
WP_003671925.1|1787954_1788419_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_013923770.1|1788915_1790298_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_011953421.1|1790455_1791415_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_035160179.1|1791428_1792802_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.4	3.6e-51
WP_013923978.1|1793061_1795716_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	32.5	5.0e-65
WP_003666685.1|1795966_1796233_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003666687.1|1796229_1796673_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003666689.1|1796682_1796979_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003666690.1|1797077_1797614_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003671918.1|1797615_1799991_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	45.2	6.6e-16
WP_003666692.1|1800081_1800396_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.4	6.2e-15
WP_003671917.1|1800450_1801032_-	YslB family protein	NA	NA	NA	NA	NA
WP_003671914.1|1801159_1801963_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003671913.1|1801964_1802552_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.9	2.1e-08
WP_035160174.1|1802557_1803082_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003671910.1|1803096_1803540_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003671908.1|1803653_1804487_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003671905.1|1804476_1805352_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003671904.1|1805494_1805935_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_003671902.1|1805927_1806386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160173.1|1806425_1807526_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003671898.1|1807686_1808697_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_003671896.1|1808710_1809556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671894.1|1809630_1810377_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003671893.1|1810496_1811474_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_013923979.1|1811391_1812462_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_003667658.1|1812461_1812773_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_003671889.1|1812769_1813204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671887.1|1813190_1813481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671886.1|1813477_1813909_+	ComGF family competence protein	NA	NA	NA	NA	NA
WP_006499680.1|1814127_1815096_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003671884.1|1815403_1816237_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003671880.1|1816250_1817447_+	acetate kinase	NA	NA	NA	NA	NA
WP_003671879.1|1817561_1818170_+	metallophosphoesterase	NA	A0A076G7D9	Bacillus_phage	38.5	1.3e-29
WP_003671878.1|1818189_1818726_+	YutD family protein	NA	NA	NA	NA	NA
WP_003671876.1|1818734_1819505_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003671875.1|1819488_1820142_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_013923980.1|1820109_1820757_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_013923981.1|1828404_1828593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148412345.1|1828582_1828738_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_167497301.1|1828754_1828901_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013923983.1|1828961_1830173_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.9	8.3e-92
WP_003671670.1|1830177_1830936_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_013923984.1|1831145_1832690_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	24.8	6.6e-17
WP_003672243.1|1832891_1833383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672242.1|1833630_1834032_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003672241.1|1834157_1834829_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003672240.1|1834911_1835946_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_003672239.1|1835947_1837324_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003672238.1|1837394_1838033_-	DsbA family protein	NA	NA	NA	NA	NA
WP_013923736.1|1838160_1839291_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003672237.1|1839490_1840144_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003672236.1|1840147_1840960_+	NAD kinase	NA	NA	NA	NA	NA
WP_003672235.1|1840959_1841865_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013923736.1|1842024_1843155_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_013923981.1|1848947_1849136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923985.1|1849125_1849482_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013923987.1|1849984_1850173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671829.1|1850162_1850519_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013923988.1|1850585_1852115_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_013923989.1|1852181_1853399_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_041816977.1|1853484_1854861_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.9e-29
>prophage 71
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1858392	1860723	2264399		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003671816.1|1858392_1860723_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	48.4	5.2e-82
>prophage 72
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1875219	1878015	2264399	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_035160157.1|1875219_1878015_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	26.0	3.3e-83
>prophage 73
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	1884122	1887644	2264399		Virus_Rctr197k(50.0%)	2	NA	NA
WP_003671770.1|1884122_1886600_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.2	5.0e-51
WP_003671769.1|1886669_1887644_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.8	8.6e-39
>prophage 75
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2015973	2019220	2264399		Planktothrix_phage(50.0%)	4	NA	NA
WP_178084825.1|2015973_2016708_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.6	1.3e-31
WP_003671088.1|2016709_2018221_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003665847.1|2018521_2018713_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003671086.1|2018773_2019220_+	GatB/YqeY domain-containing protein	NA	A0A248SJP2	Salicola_phage	27.8	1.8e-07
>prophage 76
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2026054	2027068	2264399		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003671076.1|2026054_2027068_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	45.9	2.8e-48
>prophage 77
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2033102	2036112	2264399		Helicobacter_phage(50.0%)	2	NA	NA
WP_003671068.1|2033102_2034968_+	DNA primase	NA	I6P4U6	Helicobacter_phage	34.2	6.0e-49
WP_003671067.1|2034969_2036112_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	2.5e-37
>prophage 78
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2040771	2057017	2264399	integrase,transposase	Streptomyces_phage(16.67%)	13	2034777:2034794	2060740:2060757
2034777:2034794	attL	ATGCGAGCAATTGATGAT	NA	NA	NA	NA
WP_003671056.1|2040771_2044119_+	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.3	3.2e-149
WP_003671054.1|2044304_2045726_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_003671053.1|2045867_2046749_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_003671050.1|2046748_2047642_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.6	3.3e-21
WP_003671048.1|2047655_2048012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671047.1|2048004_2048796_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003671046.1|2048758_2049364_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.5e-12
WP_003671045.1|2049363_2050080_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003671042.1|2050433_2051051_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_013923770.1|2051613_2052996_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	6.1e-30
WP_041816974.1|2053060_2054368_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	1.9e-49
WP_003670890.1|2054562_2055588_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003670891.1|2055577_2057017_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.4	9.7e-63
2060740:2060757	attR	ATGCGAGCAATTGATGAT	NA	NA	NA	NA
>prophage 79
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2061509	2074596	2264399	tRNA,transposase	Staphylococcus_phage(25.0%)	14	NA	NA
WP_003666054.1|2061509_2061785_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
WP_035159901.1|2061920_2063186_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013924006.1|2063300_2064632_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
WP_003670897.1|2064813_2066025_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	3.8e-36
WP_003670898.1|2066026_2067937_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.8e-56
WP_003670899.1|2067954_2068917_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.1	2.8e-114
WP_003670900.1|2068932_2069421_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	39.1	1.6e-22
WP_003670901.1|2069409_2070054_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003670903.1|2070232_2071075_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	1.0e-16
WP_003670904.1|2071167_2072094_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003670905.1|2072097_2072700_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003670906.1|2072718_2072940_+	YozE family protein	NA	NA	NA	NA	NA
WP_003670908.1|2072960_2073833_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003670909.1|2073825_2074596_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	36.6	2.2e-21
>prophage 80
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2079674	2178863	2264399	tail,head,protease,plate,portal,capsid,terminase,transposase	Lactobacillus_phage(65.31%)	111	NA	NA
WP_089413505.1|2079674_2081684_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	1.1e-125
WP_003670916.1|2081702_2084168_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.0	1.1e-93
WP_013924009.1|2084183_2084651_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	39.2	1.2e-17
WP_003668076.1|2084759_2085695_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_041816978.1|2085798_2087175_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.9e-29
WP_003670918.1|2087299_2087704_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003666088.1|2088217_2088358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670921.1|2088386_2088881_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003670922.1|2090122_2090506_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003670923.1|2090523_2090715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670926.1|2090730_2091276_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003670928.1|2091457_2092987_-	gluconokinase	NA	NA	NA	NA	NA
WP_003670930.1|2093037_2094057_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080542584.1|2094139_2095324_-	gluconate permease	NA	NA	NA	NA	NA
WP_080542583.1|2095380_2096757_-	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	52.8	1.5e-105
WP_003670935.1|2096917_2097685_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003670937.1|2097720_2098149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670939.1|2098206_2098728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670940.1|2098776_2099205_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	33.0	8.2e-10
WP_003670941.1|2099201_2099510_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	50.0	1.1e-21
WP_003670942.1|2099732_2099939_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003670943.1|2099950_2100718_+	phage repressor protein/antirepressor Ant	NA	A0A2H4JCR9	uncultured_Caudovirales_phage	62.4	3.4e-83
WP_003670946.1|2100994_2101201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670947.1|2101197_2101377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670948.1|2101412_2101643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670949.1|2101635_2101908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670950.1|2101911_2102664_+	ERF family protein	NA	D6PSU1	Lactobacillus_phage	62.0	5.2e-44
WP_003670951.1|2102666_2103347_+	hypothetical protein	NA	A0A2D1GP81	Lactobacillus_phage	46.1	3.7e-49
WP_003670952.1|2103336_2103765_+	single-stranded DNA-binding protein	NA	G4KNN8	Staphylococcus_phage	39.9	2.3e-20
WP_003670953.1|2103777_2104608_+	helix-turn-helix domain-containing protein	NA	E9LUM6	Lactobacillus_phage	57.0	2.2e-19
WP_003670954.1|2104623_2105421_+	ATP-binding protein	NA	B4XYS7	Lactobacillus_phage	40.7	6.4e-40
WP_003670956.1|2105579_2105840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670957.1|2105829_2106351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670958.1|2106363_2106921_+	DUF1064 domain-containing protein	NA	K4I216	Lactobacillus_phage	48.0	1.5e-24
WP_003670959.1|2106997_2107447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670960.1|2107439_2107718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013924015.1|2107714_2108086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923840.1|2108100_2109231_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_013924016.1|2109292_2109490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670962.1|2109479_2109722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013924017.1|2109690_2110077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670964.1|2110189_2110384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666915.1|2110487_2110631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013924018.1|2110662_2110854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670966.1|2110963_2111479_+	hypothetical protein	NA	A0A0A1EL23	Lactobacillus_phage	32.0	1.5e-10
WP_003670967.1|2112303_2112783_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	39.5	3.7e-27
WP_003670968.1|2112772_2113207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670970.1|2113752_2113932_+	hypothetical protein	NA	F8J1H1	Lactobacillus_phage	50.0	2.1e-07
WP_003670971.1|2113924_2114203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670973.1|2114446_2114617_+	hypothetical protein	NA	F8J1H1	Lactobacillus_phage	50.0	2.2e-06
WP_099979596.1|2114909_2115695_+	AAA family ATPase	NA	E9LUN5	Lactobacillus_phage	71.9	1.5e-113
WP_013924020.1|2115878_2116346_+|terminase	phage terminase small subunit P27 family	terminase	E9LUH9	Lactobacillus_phage	65.4	5.4e-47
WP_003670979.1|2116342_2118052_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	83.7	1.3e-287
WP_003670981.1|2118032_2118395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670983.1|2118395_2118551_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_003670984.1|2118557_2119817_+|portal	phage portal protein	portal	D2KRA7	Lactobacillus_phage	75.7	1.8e-177
WP_013924021.1|2119755_2120409_+|head,protease	HK97 family phage prohead protease	head,protease	D2KRA8	Lactobacillus_phage	70.3	1.4e-61
WP_003670989.1|2120409_2121546_+|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	76.2	3.4e-156
WP_003670991.1|2121687_2122101_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUI5	Lactobacillus_phage	63.8	4.0e-30
WP_013924022.1|2122003_2122357_+|head	phage head closure protein	head	E9LUI6	Lactobacillus_phage	64.9	3.8e-37
WP_003670994.1|2122340_2122715_+	HK97 gp10 family phage protein	NA	E9LUI7	Lactobacillus_phage	63.2	5.8e-36
WP_003670995.1|2122711_2123131_+	hypothetical protein	NA	D2KRB3	Lactobacillus_phage	53.7	4.4e-40
WP_003670996.1|2123130_2123760_+|tail	phi13 family phage major tail protein	tail	E9LUI9	Lactobacillus_phage	72.3	1.6e-75
WP_003670997.1|2123812_2124154_+	hypothetical protein	NA	E9LUJ0	Lactobacillus_phage	42.1	6.1e-16
WP_003670999.1|2124162_2124333_+	hypothetical protein	NA	E9LUJ1	Lactobacillus_phage	58.9	2.0e-12
WP_003671001.1|2124349_2128852_+|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	66.3	8.6e-275
WP_003671002.1|2128855_2129698_+|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	57.8	3.5e-89
WP_003671003.1|2129772_2132241_+|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	46.5	5.9e-161
WP_003671004.1|2132253_2132616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671005.1|2132615_2134490_+|plate	BppU family phage baseplate upper protein	plate	O03968	Lactobacillus_phage	35.0	5.2e-93
WP_003671006.1|2134501_2135287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671007.1|2135301_2135700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003671008.1|2135700_2135844_+	XkdX family protein	NA	NA	NA	NA	NA
WP_003671010.1|2136484_2136961_+	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	42.8	5.7e-20
WP_003671011.1|2136973_2137900_+	SH3 domain-containing protein	NA	A0A0A1ERA5	Lactobacillus_phage	68.2	1.3e-129
WP_003663879.1|2138046_2138205_+	hypothetical protein	NA	A0A0A7NU07	Lactobacillus_phage	69.2	1.8e-10
WP_003671013.1|2138634_2140167_-	gluconokinase	NA	NA	NA	NA	NA
WP_003671015.1|2140393_2140927_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003667978.1|2141424_2141655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666104.1|2141851_2142127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013924025.1|2142187_2142679_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_013923840.1|2142904_2144035_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_080562318.1|2144363_2145287_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_006499680.1|2145288_2146257_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_080562303.1|2146332_2146929_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003671027.1|2147266_2149534_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_041817006.1|2150022_2150421_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.5e-45
WP_003671670.1|2150782_2151541_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_049779724.1|2151545_2152628_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	46.2	5.9e-81
WP_013923840.1|2152648_2153779_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	1.8e-27
WP_003672077.1|2155261_2156203_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003672078.1|2156261_2156987_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	45.8	3.9e-28
WP_003672079.1|2157060_2159949_-	YfhO family protein	NA	NA	NA	NA	NA
WP_003672080.1|2160117_2161302_+	MFS transporter	NA	NA	NA	NA	NA
WP_003672081.1|2161367_2161943_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003672082.1|2162290_2162665_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003672083.1|2162698_2163520_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013924033.1|2163538_2164981_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.9	1.6e-73
WP_006499680.1|2165047_2166016_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003672085.1|2166142_2166295_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_013924034.1|2166634_2168053_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003672088.1|2169873_2170080_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_035160234.1|2170304_2171102_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FFL6	Cedratvirus	26.4	2.8e-11
WP_003672090.1|2171113_2172403_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003672092.1|2172383_2173622_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.6	1.8e-105
WP_003672093.1|2173608_2174070_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003672095.1|2174062_2175472_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003667917.1|2175504_2175837_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003672097.1|2175853_2176744_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003672099.1|2176959_2177631_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013923736.1|2177732_2178863_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
>prophage 81
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2189928	2191903	2264399	transposase	Lactococcus_phage(100.0%)	2	NA	NA
WP_013924038.1|2189928_2191140_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.7	4.1e-91
WP_003671670.1|2191144_2191903_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
>prophage 82
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2197991	2202256	2264399		Streptococcus_phage(50.0%)	3	NA	NA
WP_004562314.1|2197991_2200856_+	DEAD/DEAH box helicase	NA	A0A1X9I5C8	Streptococcus_phage	35.1	3.1e-60
WP_004562313.1|2200949_2201468_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_004562312.1|2201551_2202256_+	DnaD domain protein	NA	A0T2N5	Geobacillus_phage	33.3	9.0e-06
>prophage 83
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2205549	2206164	2264399		Bacillus_phage(100.0%)	1	NA	NA
WP_035160109.1|2205549_2206164_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	1.2e-25
>prophage 84
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2210084	2212273	2264399		Escherichia_phage(50.0%)	4	NA	NA
WP_004562299.1|2210084_2210480_-	ribonuclease HI family protein	NA	A0A1C3S7E2	Escherichia_phage	29.5	7.3e-05
WP_003667861.1|2210503_2210911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562298.1|2210911_2211358_+	signal peptidase II	NA	NA	NA	NA	NA
WP_004562297.1|2211361_2212273_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.0	3.2e-11
>prophage 85
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2216040	2226416	2264399		Staphylococcus_phage(40.0%)	8	NA	NA
WP_004562294.1|2216040_2217723_-	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	38.0	1.2e-08
WP_004562292.1|2219001_2219880_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.4	1.0e-14
WP_013924042.1|2219876_2220521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080542586.1|2220581_2221241_-	HD domain-containing protein	NA	S4W232	Pandoravirus	25.8	2.5e-05
WP_004562289.1|2221336_2222185_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_004562288.1|2222158_2223004_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035160101.1|2223163_2223688_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.6	2.5e-13
WP_035160099.1|2225525_2226416_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.7	3.0e-54
>prophage 86
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2233553	2239898	2264399		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_004562274.1|2233553_2235290_+	AarF/ABC1/UbiB kinase family protein	NA	C7U092	Ostreococcus_tauri_virus	25.7	1.9e-33
WP_004562273.1|2235293_2236109_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004562272.1|2236160_2236553_-	VOC family protein	NA	NA	NA	NA	NA
WP_098035078.1|2236660_2237038_+	CrcB family protein	NA	NA	NA	NA	NA
WP_004562270.1|2237030_2237369_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	33.3	4.2e-09
WP_004562269.1|2237384_2239898_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	3.4e-132
>prophage 87
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2252628	2253111	2264399		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004562256.1|2252628_2253111_+	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	65.6	6.3e-59
>prophage 88
NC_015697	Lactobacillus reuteri SD2112, complete sequence	2264399	2256534	2263660	2264399	transposase	unidentified_phage(33.33%)	5	NA	NA
WP_013923790.1|2256534_2257665_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.3	2.3e-35
WP_004562247.1|2258005_2258653_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006499680.1|2259157_2260126_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_013924049.1|2260461_2261706_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.7	1.3e-28
WP_013923785.1|2262328_2263660_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
