The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022663	Mycobacterium kansasii ATCC 12478, complete sequence	6432277	426473	449374	6432277	transposase	Leptospira_phage(75.0%)	15	NA	NA
WP_036391246.1|426473_428198_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_023364629.1|428365_428758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103802187.1|429440_430702_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	55.4	1.2e-72
WP_080673978.1|430818_431352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080674186.1|431539_432079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129111949.1|432261_433378_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.9	1.6e-33
WP_080673980.1|434072_434600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023364638.1|434928_437259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036395997.1|437465_438095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122443431.1|438444_439562_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.5	6.2e-33
WP_023364643.1|440027_441092_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023364648.1|443552_443867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129111946.1|443921_444485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023364650.1|444979_445519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129111949.1|448257_449374_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.9	1.6e-33
>prophage 2
NC_022663	Mycobacterium kansasii ATCC 12478, complete sequence	6432277	516157	595019	6432277	integrase,tRNA,transposase	Erysipelothrix_phage(12.5%)	51	592731:592790	596097:596187
WP_023364695.1|516157_517000_-|tRNA	tRNA (adenine(58)-N(1))-methyltransferase TrmI	tRNA	NA	NA	NA	NA
WP_023364696.1|517073_517943_+	RecB family exonuclease	NA	NA	NA	NA	NA
WP_023364697.1|517939_518743_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_023364698.1|519106_520486_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	33.3	1.5e-60
WP_036395983.1|520482_520968_-	membrane protein	NA	NA	NA	NA	NA
WP_036393190.1|521093_521948_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023364701.1|521950_522232_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_036393187.1|522403_523246_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036393185.1|523540_525028_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	42.8	5.1e-107
WP_023364704.1|525047_527402_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_042313221.1|527500_528748_-	PPE family protein	NA	NA	NA	NA	NA
WP_023364706.1|529065_532644_-	methionine synthase	NA	NA	NA	NA	NA
WP_042313224.1|532763_533618_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_080674189.1|533614_534793_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_023364709.1|534821_535715_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023364710.1|535739_536984_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A1V0SAQ2	Catovirus	25.4	1.5e-27
WP_023364711.1|537405_538194_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_023364712.1|538698_539514_-	SCO1664 family protein	NA	NA	NA	NA	NA
WP_023364713.1|539497_540085_-	DUF3090 domain-containing protein	NA	NA	NA	NA	NA
WP_023364714.1|540147_540876_-	MSMEG_4193 family putative phosphomutase	NA	NA	NA	NA	NA
WP_023364715.1|540872_541703_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_023364716.1|541764_542067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099184126.1|542243_543239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042311690.1|543292_543499_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_051404563.1|543525_544608_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023364720.1|544674_550506_-	PE family protein	NA	NA	NA	NA	NA
WP_023364721.1|551098_553054_-	PE family protein	NA	NA	NA	NA	NA
WP_023364722.1|553493_563648_+	PPE family protein	NA	NA	NA	NA	NA
WP_023364723.1|563826_565077_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023364724.1|565171_565819_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023364725.1|566131_566536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023364726.1|566505_567147_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023364727.1|567193_567724_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_036393176.1|567758_569111_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_023364729.1|569306_570953_-	recombinase family protein	NA	NA	NA	NA	NA
WP_023364731.1|572632_574075_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_023364732.1|574163_574499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023364734.1|575864_576605_+	creatininase family protein	NA	NA	NA	NA	NA
WP_103797949.1|577241_578696_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_036393174.1|578632_579337_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023364740.1|579944_581888_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	4.3e-05
WP_023364742.1|581884_582925_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	26.3	4.9e-08
WP_023364744.1|582990_584052_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.8	5.3e-66
WP_023364746.1|584282_585662_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_080673988.1|585969_586806_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_023364748.1|587306_588026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080673989.1|588289_589726_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	22.4	8.5e-27
WP_080673990.1|590102_591650_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023364754.1|592173_592815_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	31.3	1.1e-13
592731:592790	attL	CGATTATGCCGAGGTCTGTGTTAAGCCGAGGATCTGCGGAGATGTCCTGCGCTCGTGGGG	NA	NA	NA	NA
WP_023364757.1|592872_594072_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_023364759.1|594068_595019_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
596097:596187	attR	CCCCACGAGCGCAGGACATCTCCGCAGATCCTCGGCTTAACACAGACCTCGGCATAATCGGCGTTAAGCCGAATTCGGCTTAACTCCGACC	NA	NA	NA	NA
>prophage 3
NC_022663	Mycobacterium kansasii ATCC 12478, complete sequence	6432277	2375535	2406261	6432277	integrase,tRNA,transposase	Bacillus_phage(30.0%)	26	2394898:2394957	2406526:2406849
WP_023367953.1|2375535_2376726_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_036394034.1|2376878_2379044_+	LCP family protein	NA	NA	NA	NA	NA
WP_023367957.1|2379088_2379757_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_023367959.1|2379767_2380544_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.1e-17
WP_023367961.1|2380557_2381472_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_036393793.1|2381468_2382494_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_023367965.1|2382567_2383692_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	41.5	5.5e-05
WP_023367967.1|2383810_2384752_-	mycothiol synthase	NA	NA	NA	NA	NA
WP_023367969.1|2384748_2385513_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.6	8.9e-15
WP_036393795.1|2385619_2385859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023367973.1|2386685_2387486_+	mannan chain length control protein LmeA	NA	NA	NA	NA	NA
WP_036393799.1|2387778_2388246_+	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_023367977.1|2388284_2389127_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_023367979.1|2389128_2389431_+	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_099184325.1|2389560_2390235_+	FABP family protein	NA	NA	NA	NA	NA
WP_042312135.1|2390357_2392760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023367989.1|2392869_2394381_+	sensor domain-containing protein	NA	NA	NA	NA	NA
2394898:2394957	attL	GGTCAAGTCCAGGGACGTGGTGTACGACGTCGATCGTGTGATTCTTCGATTTTGTGATTT	NA	NA	NA	NA
WP_023364740.1|2395221_2397165_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	4.3e-05
WP_023364742.1|2397161_2398202_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	26.3	4.9e-08
WP_023364744.1|2398267_2399329_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.8	5.3e-66
WP_082273697.1|2399419_2400148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023367994.1|2400402_2400639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122443431.1|2400826_2401943_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.5	6.2e-33
WP_023364744.1|2402153_2403215_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.8	5.3e-66
WP_023364742.1|2403280_2404321_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	26.3	4.9e-08
WP_023364740.1|2404317_2406261_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	4.3e-05
2406526:2406849	attR	AAATCACAAAATCGAAGAATCACACGATCGACGTCGTACACCACGTCCCTGGACTTGACCAAATCGTTTGGGTCGCGTGCGGTTGGGTCGATTACGCGCACATGTTGGCGTTCTTGGCCGGCCTGAGCGACAGGTCGCGGGCGACTAGACGGCTAGCGTGGCAGGTGCTGATGGCGGTGCTGGATTACGCTGAGGCGGATGGTGCTTTGGCCGCTAATCCTGGGCGCGGGGTGGGGCGTAATGCGGTGCCGGCCACAGCGCCCCGCGAGCACCGCCCGCTTACCGGCCCGCAGGTTGCAGCACTTGCGCAACATGTGGCTGCAC	NA	NA	NA	NA
>prophage 4
NC_022663	Mycobacterium kansasii ATCC 12478, complete sequence	6432277	3727682	3767049	6432277	protease,integrase,transposase	Pandoravirus(50.0%)	33	3758746:3758786	3769056:3769096
WP_036396138.1|3727682_3729071_+|protease	type VII secretion-associated serine protease mycosin	protease	NA	NA	NA	NA
WP_023369894.1|3729067_3730066_+	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_036396152.1|3730052_3731264_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023369898.1|3731417_3732200_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_099185019.1|3732625_3734029_-	sulfatase	NA	NA	NA	NA	NA
WP_023369902.1|3734095_3734746_-	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
WP_023369904.1|3734801_3735284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036396154.1|3735341_3736010_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_023369908.1|3736112_3736769_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_023369910.1|3736778_3737291_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_023369912.1|3737334_3738564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023369914.1|3738717_3740613_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_036396157.1|3740839_3742249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023369918.1|3742316_3742703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023369920.1|3742707_3743442_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_023369922.1|3743498_3744518_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036396141.1|3744645_3745527_+	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_023369926.1|3745587_3746202_+	muconolactone Delta-isomerase family protein	NA	NA	NA	NA	NA
WP_023369928.1|3746222_3747719_+	bifunctional phosphatase PAP2/diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_023369930.1|3747755_3749648_+	serine/threonine protein kinase	NA	A0A0B5J6A8	Pandoravirus	27.1	5.8e-15
WP_133163603.1|3750816_3751386_-	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_023369935.1|3751538_3751880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023369937.1|3753297_3754629_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_023369939.1|3754715_3755816_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_023369941.1|3755970_3757725_-	YncE family protein	NA	NA	NA	NA	NA
3758746:3758786	attL	TGGAGCCGATGACGGGAATCGAACCCGCGTATTCAGCTTGG	NA	NA	NA	NA
WP_122530125.1|3759276_3760393_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.7	2.2e-30
WP_023369948.1|3760522_3760828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023369952.1|3761442_3762927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036396191.1|3762908_3763223_-	DUF2563 family protein	NA	NA	NA	NA	NA
WP_142396053.1|3763439_3763649_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023369958.1|3763862_3764903_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023369960.1|3764902_3765853_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_023369962.1|3765849_3767049_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3769056:3769096	attR	TGGAGCCGATGACGGGAATCGAACCCGCGTATTCAGCTTGG	NA	NA	NA	NA
>prophage 1
NC_022654	Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence	144951	60231	114260	144951	integrase,protease,transposase	Mycobacterium_phage(45.45%)	52	55646:55661	121221:121236
55646:55661	attL	CGCCCACCCTCACCCG	NA	NA	NA	NA
WP_040624331.1|60231_61932_-|protease	type VII secretion-associated serine protease mycosin	protease	V5UPA7	Mycobacterium_phage	35.2	5.6e-70
WP_080674295.1|61948_63592_-	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
WP_007172339.1|65052_65973_-	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_007172340.1|66051_66336_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_007172341.1|66380_66677_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_007172342.1|66820_67975_-	PPE family protein	NA	NA	NA	NA	NA
WP_007172343.1|68004_68301_-	PE family protein	NA	NA	NA	NA	NA
WP_007172344.1|68394_72621_-	type VII secretion protein EccC	NA	A0A0A0RUH6	Bacillus_phage	31.7	2.8e-17
WP_101930849.1|72617_74063_-	type VII secretion protein EccB	NA	V5UN45	Mycobacterium_phage	34.7	1.3e-59
WP_023363502.1|74176_75217_-	C40 family peptidase	NA	V5UPI8	Mycobacterium_phage	41.7	1.1e-15
WP_051404593.1|75302_76406_-	hypothetical protein	NA	A0A1B3B1U7	Gordonia_phage	59.5	3.0e-32
WP_023363505.1|76469_77444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172349.1|77545_77809_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_040624374.1|77811_78228_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_169733147.1|78509_79772_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_007172352.1|79983_80565_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	33.0	1.4e-23
WP_040624340.1|80564_82217_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	26.6	8.0e-21
WP_023363510.1|82537_83260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074021534.1|83256_84159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141224646.1|84292_84700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155254717.1|85590_86022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139315440.1|86252_86525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139315441.1|86648_87320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172361.1|87429_88509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155254718.1|88623_89328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139315443.1|89335_90043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172365.1|90260_90554_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_040624378.1|90550_90802_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_007172367.1|90907_91414_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007172368.1|91720_92158_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_023363514.1|92213_92804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172369.1|92766_93051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023363516.1|93427_95290_+	helicase associated domain-containing protein	NA	NA	NA	NA	NA
WP_007172373.1|95450_95867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172374.1|96252_97440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172375.1|97552_97894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363520.1|97890_99597_-	PPE domain-containing protein	NA	NA	NA	NA	NA
WP_007172377.1|99613_99919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041321561.1|99994_100309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172379.1|100336_101857_-	DUF4226 domain-containing protein	NA	V5UPX1	Mycobacterium_phage	41.6	6.5e-09
WP_074021258.1|102078_102834_-	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_007172400.1|103662_104358_+	ParA family protein	NA	NA	NA	NA	NA
WP_023363524.1|104360_105122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172404.1|105203_105488_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_007172405.1|105484_105742_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_007172406.1|105956_106250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101930848.1|106266_107265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172408.1|107976_108546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172409.1|108535_109636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	24.5	1.1e-05
WP_007172410.1|109754_109967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172412.1|110543_112190_+	ParB N-terminal domain-containing protein	NA	A0A2P1N496	Mycobacterium_phage	44.5	2.6e-104
WP_051404594.1|113135_114260_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	25.0	5.5e-05
121221:121236	attR	CGCCCACCCTCACCCG	NA	NA	NA	NA
