The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	327261	378307	4812600	transposase	Staphylococcus_phage(22.22%)	40	NA	NA
WP_015498147.1|327261_328422_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.6e-42
WP_015498148.1|329233_330253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498149.1|330523_331366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498150.1|331395_331590_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_044044417.1|331796_332330_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	29.8	2.3e-14
WP_015498152.1|332446_332872_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_015498153.1|332873_333572_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_187292535.1|333975_334269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043035.1|336459_336771_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.6	1.9e-16
WP_085982875.1|336735_337263_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_051067932.1|337420_338311_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015498158.1|338434_338935_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_015498159.1|339166_339652_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_144055482.1|339732_340011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498161.1|340281_340728_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_044043037.1|341027_341330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498165.1|341835_342438_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_015498168.1|345505_346285_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144055483.1|346387_347536_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.3	9.8e-26
WP_044043041.1|347569_348727_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015498171.1|348751_349603_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015498172.1|349609_350422_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015498173.1|350449_351208_+	SDR family oxidoreductase	NA	A0A1S5V0V2	Saudi_moumouvirus	31.3	1.7e-05
WP_083902898.1|352091_352334_-	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_015498175.1|352436_352751_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_015498176.1|352825_353830_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_015498177.1|353921_354782_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I5ARC7	Synechococcus_phage	28.1	1.2e-15
WP_015498179.1|356523_357357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498183.1|365677_366838_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.2e-39
WP_015498185.1|367270_367579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498187.1|368642_368972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498188.1|369070_369400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044044423.1|369862_370192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498191.1|370301_371513_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_015498192.1|371552_372347_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_015498193.1|372634_373456_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051067937.1|374452_375463_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	41.7	1.6e-56
WP_044042951.1|375465_375777_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.6	3.8e-17
WP_187292462.1|377600_377864_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015497970.1|377983_378307_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	1109283	1137978	4812600	protease,transposase,holin	Shigella_phage(33.33%)	24	NA	NA
WP_015498856.1|1109283_1109559_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044043271.1|1109555_1110251_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.7	1.1e-32
WP_015498857.1|1110421_1111474_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015498858.1|1111731_1115166_+	YhaN family protein	NA	NA	NA	NA	NA
WP_015498859.1|1115211_1115886_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_015498860.1|1116683_1116923_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_015498861.1|1117334_1119101_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.2	2.3e-50
WP_015498862.1|1119225_1120185_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_015498863.1|1120310_1121543_-	MFS transporter	NA	NA	NA	NA	NA
WP_015498864.1|1121574_1122864_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_015498865.1|1122954_1123266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043274.1|1123410_1124001_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015498867.1|1124176_1125121_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015498868.1|1125178_1125670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498869.1|1125679_1126276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498870.1|1126277_1126838_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_015498871.1|1126849_1128622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498872.1|1128997_1130440_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_015498873.1|1130712_1131966_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_044043277.1|1131975_1132239_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_015498874.1|1132235_1135157_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_144055702.1|1135239_1135713_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_015498876.1|1136017_1137079_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	31.2	3.0e-21
WP_144055703.1|1137078_1137978_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
>prophage 3
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	1305120	1356009	4812600	transposase,integrase	Burkholderia_phage(33.33%)	33	1298316:1298330	1332740:1332754
1298316:1298330	attL	ACCATCATTGCCAAT	NA	NA	NA	NA
WP_051067960.1|1305120_1306353_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015497934.1|1309054_1310554_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_015497935.1|1310550_1311303_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.5	1.4e-41
WP_015499042.1|1311583_1313557_-	acyltransferase	NA	C6ZR20	Salmonella_phage	28.3	1.3e-49
WP_015499043.1|1313953_1315603_+	hypothetical protein	NA	I6NPA6	Burkholderia_phage	27.3	6.0e-08
WP_015499044.1|1315599_1316169_+	HNH endonuclease	NA	A0A2H4YGS2	Pseudomonas_virus	36.1	1.3e-07
WP_144055523.1|1316721_1316937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043323.1|1317160_1317427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043324.1|1317481_1317694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085982898.1|1317690_1317966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083902925.1|1317989_1318499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499046.1|1320221_1320644_+	H-type lectin domain-containing protein	NA	NA	NA	NA	NA
WP_015499048.1|1321966_1324339_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_015499050.1|1327700_1328750_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	29.0	1.2e-22
WP_144055525.1|1330362_1331061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499054.1|1331057_1332383_-	DUF3131 domain-containing protein	NA	NA	NA	NA	NA
WP_015499055.1|1332372_1334205_-	cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
1332740:1332754	attR	ACCATCATTGCCAAT	NA	NA	NA	NA
WP_044043332.1|1334216_1335359_-	acyltransferase	NA	NA	NA	NA	NA
WP_015499057.1|1335355_1337083_-	DUF3131 domain-containing protein	NA	NA	NA	NA	NA
WP_051067962.1|1337129_1337525_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015499059.1|1337542_1337887_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_015499060.1|1337864_1339070_-	SpoIIE family protein phosphatase	NA	Q56AR1	Bacillus_thuringiensis_phage	28.1	5.9e-05
WP_015499061.1|1339430_1340045_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015499050.1|1340176_1341226_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	29.0	1.2e-22
WP_015499062.1|1342708_1343596_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	43.1	1.3e-54
WP_015499063.1|1343720_1344236_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015499064.1|1344279_1346781_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.3	2.2e-46
WP_015499066.1|1348633_1349086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499067.1|1349082_1349370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498511.1|1349493_1350435_-|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
WP_187292552.1|1350585_1352850_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_187292553.1|1353895_1354075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015498511.1|1355067_1356009_+|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	1733281	1795125	4812600	transposase,integrase	Ralstonia_phage(10.0%)	53	1734239:1734259	1804825:1804845
WP_044044587.1|1733281_1734106_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1734239:1734259	attL	ATGCTGCGGCGCGGCCCGTCA	NA	NA	NA	NA
WP_015499448.1|1734474_1735218_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_015499449.1|1735435_1735651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499451.1|1736411_1737683_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	30.2	7.0e-33
WP_015499452.1|1737686_1738289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499454.1|1739145_1739388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499455.1|1739362_1739779_+	nuclease	NA	NA	NA	NA	NA
WP_015499458.1|1740793_1741450_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	43.3	2.7e-36
WP_015499459.1|1741640_1743053_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.2	1.3e-40
WP_083902939.1|1743226_1743547_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_015499461.1|1743687_1743984_-	cation transporter	NA	NA	NA	NA	NA
WP_015499462.1|1743995_1744400_-	mercuric transporter MerT	NA	NA	NA	NA	NA
WP_015499463.1|1744474_1744894_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044043464.1|1745295_1745667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055545.1|1745834_1746233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499465.1|1746523_1747441_-	DMT family transporter	NA	NA	NA	NA	NA
WP_051067976.1|1747857_1749660_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015499468.1|1749652_1751107_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015499469.1|1751682_1752945_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	52.8	1.8e-121
WP_015499470.1|1753244_1754111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044044593.1|1754307_1754850_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_015499472.1|1755030_1755603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499473.1|1758567_1759998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499474.1|1760231_1760948_-	LrgB family protein	NA	NA	NA	NA	NA
WP_044043468.1|1760944_1761298_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_015499475.1|1761728_1762640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499476.1|1763231_1764719_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_144055546.1|1764763_1765102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499478.1|1765420_1765627_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	57.1	4.2e-12
WP_015499479.1|1765937_1766303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499480.1|1766615_1767851_-	MFS transporter	NA	NA	NA	NA	NA
WP_083902940.1|1768404_1768635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085982882.1|1768679_1769808_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	1.2e-55
WP_015499483.1|1770279_1771368_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	7.6e-28
WP_015499484.1|1771367_1772156_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044044598.1|1772152_1773112_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015499486.1|1773224_1774331_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_015499487.1|1774390_1775491_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015499488.1|1775612_1776191_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_015499489.1|1776187_1776673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499490.1|1776669_1778136_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015499491.1|1778182_1779505_-	MFS transporter	NA	NA	NA	NA	NA
WP_015499492.1|1779501_1780965_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1C9C5E2	Heterosigma_akashiwo_virus	28.2	2.3e-48
WP_015499493.1|1781072_1781537_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015498857.1|1781940_1782993_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015499495.1|1785481_1786573_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_144055547.1|1787570_1787765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499498.1|1788137_1788461_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015499499.1|1789636_1790191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499501.1|1790342_1790765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015497934.1|1790816_1792316_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_015497935.1|1792312_1793065_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.5	1.4e-41
WP_015499502.1|1793823_1795125_+|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	27.6	1.3e-21
1804825:1804845	attR	ATGCTGCGGCGCGGCCCGTCA	NA	NA	NA	NA
>prophage 5
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	1828172	1862675	4812600	transposase,integrase	Streptococcus_phage(28.57%)	32	1820816:1820831	1869739:1869754
1820816:1820831	attL	GCTTCCGGCCCATTGC	NA	NA	NA	NA
WP_015499532.1|1828172_1829252_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_015499533.1|1829453_1830263_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015499534.1|1830304_1830973_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015499535.1|1830981_1831782_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_044043482.1|1832591_1833854_-	sulfate permease	NA	NA	NA	NA	NA
WP_144055550.1|1833908_1834094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499538.1|1835082_1835379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055551.1|1836494_1836881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043485.1|1837022_1837655_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044043488.1|1837812_1838235_+	GFA family protein	NA	NA	NA	NA	NA
WP_015499474.1|1838455_1839172_-	LrgB family protein	NA	NA	NA	NA	NA
WP_044043468.1|1839168_1839522_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_015499541.1|1839954_1840971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043490.1|1841066_1841270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015499542.1|1841266_1843027_+	hypothetical protein	NA	G8EY43	Synechococcus_phage	24.4	3.5e-30
WP_015499544.1|1843672_1844485_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044043492.1|1844551_1844851_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015499546.1|1845027_1845735_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	33.5	9.0e-22
WP_015499548.1|1846573_1846966_-	RidA family protein	NA	NA	NA	NA	NA
WP_015499549.1|1847166_1848168_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044043494.1|1848232_1848997_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	5.2e-31
WP_015499551.1|1848993_1849863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015499552.1|1849862_1851128_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_015499553.1|1851124_1852522_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015499554.1|1853106_1853733_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015499555.1|1853729_1854650_+	isopenicillin N synthase family oxygenase	NA	S4VNP9	Pandoravirus	26.5	1.1e-14
WP_015499556.1|1854646_1855426_+	creatininase family protein	NA	NA	NA	NA	NA
WP_187292566.1|1855991_1856504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085982882.1|1856431_1857561_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	1.2e-55
WP_015499559.1|1859209_1860166_+	DUF3427 domain-containing protein	NA	NA	NA	NA	NA
WP_015499561.1|1860760_1861468_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	33.1	6.9e-22
WP_044043499.1|1861535_1862675_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.9	7.2e-37
1869739:1869754	attR	GCTTCCGGCCCATTGC	NA	NA	NA	NA
>prophage 6
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	2284130	2341256	4812600	transposase,integrase	Tupanvirus(18.18%)	44	2279861:2279876	2343453:2343468
2279861:2279876	attL	GCAGGCCAAGACCCGC	NA	NA	NA	NA
WP_015499933.1|2284130_2284529_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	33.6	2.7e-15
WP_015499935.1|2285241_2286051_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_044044691.1|2286427_2287621_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_015499937.1|2287923_2288241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051068112.1|2288215_2288656_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015499939.1|2288712_2289297_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_015499940.1|2289293_2289875_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_015499941.1|2289867_2290725_-	UPF0280 family protein	NA	NA	NA	NA	NA
WP_015499942.1|2290724_2292215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499943.1|2292214_2294950_-	molybdopterin-dependent oxidoreductase	NA	A0A0P0IVM8	Acinetobacter_phage	31.6	3.9e-12
WP_015499944.1|2294942_2295776_-	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_015499945.1|2296425_2297406_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015499946.1|2297471_2298053_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_015499947.1|2298049_2299309_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_044043598.1|2299612_2300767_-	CoA transferase	NA	NA	NA	NA	NA
WP_015499949.1|2300779_2301979_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_044044693.1|2302091_2303003_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144055561.1|2304250_2304550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187292572.1|2304894_2306346_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_044043601.1|2306342_2307251_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_015499954.1|2307712_2308102_-	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	32.5	2.1e-12
WP_015499956.1|2308521_2310099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044044695.1|2310436_2310613_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_044043604.1|2310848_2312075_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A097EVZ9	Ruegeria_phage	41.7	1.1e-80
WP_044043606.1|2313245_2315300_-	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_015499959.1|2315498_2316947_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	3.5e-89
WP_044043608.1|2316946_2318110_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_015499961.1|2318254_2320588_+	response regulator	NA	A0A2K9L0Z8	Tupanvirus	25.0	1.6e-06
WP_015499962.1|2320584_2321565_-	glucokinase	NA	NA	NA	NA	NA
WP_015499963.1|2321567_2322887_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.3	7.0e-60
WP_015499964.1|2322901_2323942_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015499965.1|2324185_2325544_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015499966.1|2325637_2326645_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_044043610.1|2327953_2329615_+	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_015499968.1|2329633_2330746_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	34.5	1.8e-24
WP_015499969.1|2330814_2331549_+	RlmE family RNA methyltransferase	NA	A0A1L3KKA3	Hubei_virga-like_virus	28.0	4.7e-05
WP_015499970.1|2331615_2332209_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_015499971.1|2332212_2333688_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_015499972.1|2333691_2333901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015499973.1|2334060_2335578_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	21.6	2.6e-26
WP_015499974.1|2336057_2337698_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015498856.1|2339065_2339341_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044043271.1|2339337_2340033_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.7	1.1e-32
WP_015498857.1|2340203_2341256_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2343453:2343468	attR	GCGGGTCTTGGCCTGC	NA	NA	NA	NA
>prophage 7
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	2529794	2614790	4812600	transposase,integrase,tRNA	Leptospira_phage(30.0%)	76	2540118:2540177	2581806:2582973
WP_015500128.1|2529794_2530784_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_044044721.1|2530966_2532118_+	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_015500130.1|2532114_2532627_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_015500131.1|2532623_2533097_+	CinA family protein	NA	NA	NA	NA	NA
WP_015500132.1|2533251_2534433_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.2	2.0e-34
WP_015500133.1|2534478_2534688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500134.1|2534669_2535806_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_015500135.1|2535827_2536274_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_044044725.1|2536358_2536919_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.4	7.2e-14
WP_187292461.1|2537016_2537160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083902989.1|2537313_2537472_+	cytochrome c	NA	NA	NA	NA	NA
WP_044043671.1|2537501_2537909_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_015500138.1|2537845_2538802_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_015500139.1|2538947_2539991_-	hypothetical protein	NA	NA	NA	NA	NA
2540118:2540177	attL	AAAGGCTTATCCCCTTTGCTCCGGCGGCACCTGATGTAGTGTGAAGCGGCTTGCCAATCT	NA	NA	NA	NA
WP_015498511.1|2540202_2541144_+|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
WP_044043674.1|2541386_2541710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500141.1|2541758_2543321_-	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_044044727.1|2543488_2545063_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_015500143.1|2545053_2545728_+	YdcF family protein	NA	NA	NA	NA	NA
WP_015500144.1|2547062_2547680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500145.1|2547751_2548633_+	DMT family transporter	NA	NA	NA	NA	NA
WP_015500146.1|2548747_2549851_+	membrane protein	NA	NA	NA	NA	NA
WP_015500147.1|2549942_2550806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043682.1|2550846_2551824_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_015500149.1|2551885_2552887_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015500150.1|2552949_2553834_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_044043684.1|2553826_2554447_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044042951.1|2555691_2556003_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.6	3.8e-17
WP_083902991.1|2557667_2557862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187292462.1|2557867_2558131_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015500153.1|2558250_2558574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015500154.1|2558920_2559973_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044044729.1|2561577_2562894_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_015500156.1|2562947_2563847_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015500157.1|2564690_2565062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500158.1|2565616_2566168_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500159.1|2566242_2567118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500161.1|2567709_2569062_-	DNA-repair polymerase	NA	NA	NA	NA	NA
WP_015500162.1|2569473_2569677_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_015500164.1|2570774_2571887_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_044044731.1|2572094_2572517_-	NUDIX hydrolase	NA	I4AZJ3	Saccharomonospora_phage	46.2	1.8e-09
WP_144055724.1|2572777_2573329_-	LysE family transporter	NA	NA	NA	NA	NA
WP_044044733.1|2573421_2573823_-	VOC family protein	NA	NA	NA	NA	NA
WP_015500169.1|2574513_2574843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500171.1|2575622_2575778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500172.1|2575835_2576723_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	33.1	1.4e-32
WP_015500173.1|2576734_2577928_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_015499070.1|2578526_2578979_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015499071.1|2579044_2579278_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_015499072.1|2579274_2580168_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_015498511.1|2580838_2581780_-|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
WP_044043694.1|2581821_2582346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055576.1|2584063_2584222_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2581806:2582973	attR	AGATTGGCAAGCCGCTTCACACTACATCAGGTGCCGCCGGAGCAAAGGGGATAAGCCTTTCAGACGCATTTGATTGCAACGACACTCCGTGGACAGCTTGGTTCATAACAGGCATCAAATCCATGAGTAGGCTCATCGCTTCCTCCGGAATCGCACCTTGTTTTGAAAGTTCTTCGGCAAGAGAGCGCAGCGAATGAGGTCGTCCGCGGACACTAGGTCCCAGCATAACATCTTCCGCGATCTGCCGAAGTCGGCGTTCAACCTGAACTCGTAGCATAGCAATCGCTAGGTTTGGGTCATTGCCCTCGAAGTACATGAAAGCATTTACATCTTCTTCATCAGGGGTTGTGTTAGATGCGTCCAATTTACGCTCAACTTTGGAGAAAACGATCTCCAAGCCACCGGGGGCACTGATCTTCTCAATTATCCCTAACGCCCAAGGGACAATAGCCACTGCTAGCGCACCTGCCGCAATAGGGGGAATTTCCTTCCCGAACGTATCAAAAAAAGCAACTACAACGCAAAAAACACTAAGAGCCACCTTTGCCCTATGGCTGCGCCAAAATGGACTTAGTCGTCTCACAACTCTGCACCAACCGAATATATTTAATTACTCAATAGCACATTGACCTTGTTAGTCAAAATTGTCTGACGTCAGCGCTTCTATTTGATAAGAGAGTGTTGTTGGCTCATCGTAACCACTGAGGAGTGGGACATGAGACAGACAACTGGAACACGCAAAAGCCCGGGTGAGAAGATCGTCAAAGATATCAAACGGGCGACCCGCAATCATTATTCATCTGAAGAGAAGATTAGGATCGTCTTAGACGGTCTGCGTGGGGAAGACAGCATTGCCGAGCTGTGTCGTCCACTGCCCGGCAGTGCATGTTTACATGCACGAGAGGGGTGAAGGCATCTCCCAAGGCATCTACTACAAATGGTCCAAGGACTTTATGGAGGCCGGTAAGAAGCGCCTTGCGGGCGATACCGCCCGCGCCGCCACAACCGACGAGGTGAAGGATCTGCGCCGTGAAGCACGTGATCTGAAGGAAGTCGTTGCGGAGCAAACACTTGAACTCCGCTTGCTCAAAAAAAGCATGTTCGACGGTGGGGGCGACCACGAATGAGGTATCCCGCATCAGAGAAGCTGGAGATCATCAAGCTGGTC	NA	NA	NA	NA
WP_044043696.1|2584205_2584562_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	34.4	1.2e-06
WP_044043699.1|2584585_2584813_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	35.6	3.2e-05
WP_015500179.1|2585031_2586660_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_015500180.1|2586679_2587408_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015500181.1|2587426_2588683_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015500182.1|2588679_2589486_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.9e-16
WP_015500183.1|2589546_2590584_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500184.1|2590837_2591836_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_144055577.1|2596616_2596718_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015500187.1|2596841_2597108_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015500188.1|2597167_2598658_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_015500189.1|2598659_2599154_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_015500190.1|2599220_2600207_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_015500191.1|2600312_2600978_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044043702.1|2600970_2602338_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015500193.1|2602316_2603327_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500197.1|2608542_2609322_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_187292582.1|2609455_2610184_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.9e-30
WP_015500199.1|2610194_2610932_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015500200.1|2610931_2612296_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_015499481.1|2612599_2612875_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015501160.1|2612871_2613567_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	8.3e-44
WP_015498857.1|2613737_2614790_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	2654765	2716280	4812600	protease,transposase,integrase	Bacillus_virus(25.0%)	54	2645457:2645471	2688613:2688627
2645457:2645471	attL	AGGTCTTTGGGTTTG	NA	NA	NA	NA
WP_015500236.1|2654765_2656064_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.4	1.4e-73
WP_187292466.1|2659495_2659660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043730.1|2660093_2660957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500242.1|2661459_2663328_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_083903007.1|2663859_2664207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500244.1|2666003_2667428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500245.1|2667802_2668126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_187292462.1|2668245_2668509_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015500246.1|2670856_2671732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500247.1|2671828_2672920_+	sodium-dependent bicarbonate transport family permease	NA	NA	NA	NA	NA
WP_051068114.1|2673706_2674894_-	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_015500249.1|2674962_2675961_-	ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_015500250.1|2675967_2676810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044043735.1|2676930_2677191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500251.1|2677276_2677453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500252.1|2677607_2678753_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_015500253.1|2678803_2679478_+	DUF1045 domain-containing protein	NA	NA	NA	NA	NA
WP_015500254.1|2679459_2680002_-	phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN	NA	NA	NA	NA	NA
WP_015500255.1|2679998_2680682_-	phosphonate C-P lyase system protein PhnL	NA	A0A1M7XV31	Cedratvirus	27.8	6.9e-11
WP_015500256.1|2680686_2681457_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.3	8.4e-13
WP_015500257.1|2681453_2682323_-	alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ	NA	NA	NA	NA	NA
WP_015500258.1|2682319_2683408_-	carbon-phosphorus lyase complex subunit PhnI	NA	NA	NA	NA	NA
WP_015500259.1|2683407_2683968_-	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_015500260.1|2683967_2684423_-	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_015500261.1|2684516_2685230_+	phosphonate metabolism transcriptional regulator PhnF	NA	NA	NA	NA	NA
WP_015500262.1|2685234_2685876_-	chloramphenicol acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.8	1.1e-10
WP_015500263.1|2685875_2687174_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_015500264.1|2687170_2688055_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_015500265.1|2688127_2689036_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2688613:2688627	attR	CAAACCCAAAGACCT	NA	NA	NA	NA
WP_015500266.1|2689098_2689917_-	phosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	5.4e-18
WP_015500267.1|2691759_2692266_-	GFA family protein	NA	NA	NA	NA	NA
WP_015500268.1|2692474_2692990_-	OsmC family protein	NA	NA	NA	NA	NA
WP_044044752.1|2693028_2693532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500270.1|2693760_2694642_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500271.1|2698224_2698572_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	35.5	1.2e-11
WP_015500272.1|2698879_2700151_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	41.1	4.5e-80
WP_015500273.1|2700147_2700582_-	peptidase S24	NA	NA	NA	NA	NA
WP_015500274.1|2700784_2701114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500275.1|2701349_2701532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055580.1|2701718_2702198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043743.1|2702341_2702734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055581.1|2705366_2705621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500277.1|2705820_2706552_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_015500278.1|2706586_2707384_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_015500279.1|2707384_2708326_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_044043746.1|2708325_2709747_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_015500281.1|2709810_2710023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500282.1|2710805_2711132_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_015500283.1|2711191_2711659_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_044043748.1|2711672_2712494_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015500285.1|2712586_2713009_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_044043749.1|2713116_2714973_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	33.0	1.9e-71
WP_015500287.1|2715080_2715704_+	MarC family protein	NA	NA	NA	NA	NA
WP_044043750.1|2715710_2716280_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
>prophage 9
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	2800314	2810585	4812600	head,tail,capsid	Paracoccus_phage(33.33%)	12	NA	NA
WP_015500369.1|2800314_2804241_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	37.0	4.1e-225
WP_044043785.1|2804246_2804696_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.4	2.9e-26
WP_015500371.1|2804692_2805577_-	DUF2163 domain-containing protein	NA	F4YXU3	Roseobacter_phage	36.9	1.7e-46
WP_015500372.1|2805573_2806206_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.7	1.6e-57
WP_044043788.1|2806220_2806880_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	31.6	2.2e-14
WP_015500374.1|2806872_2807100_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_015500375.1|2807096_2807423_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_015500376.1|2807422_2807839_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_015500377.1|2807889_2808300_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_015500378.1|2808296_2808632_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_044043789.1|2808631_2809231_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015500380.1|2809397_2810585_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	42.1	2.8e-68
>prophage 10
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	2864397	2918208	4812600	protease,transposase,tRNA	Acinetobacter_phage(22.22%)	48	NA	NA
WP_015500428.1|2864397_2865450_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015500429.1|2865492_2868804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500430.1|2868869_2869331_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_187292469.1|2871087_2872407_+	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	53.3	7.3e-25
WP_015500433.1|2872396_2872915_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_015500434.1|2873005_2873785_-	DUF2189 domain-containing protein	NA	NA	NA	NA	NA
WP_015500435.1|2873952_2875080_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	27.2	3.2e-05
WP_044043809.1|2875160_2877686_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_044043811.1|2878452_2879682_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	41.7	1.1e-06
WP_015500438.1|2879678_2880833_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015500439.1|2880890_2882210_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_044043813.1|2882229_2882985_+	DsbA family protein	NA	NA	NA	NA	NA
WP_015500441.1|2883135_2884269_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015500442.1|2884358_2885585_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044044786.1|2885692_2886916_-	5-aminolevulinate synthase	NA	NA	NA	NA	NA
WP_187292470.1|2887430_2887583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500445.1|2887670_2889044_+	dipeptidase	NA	NA	NA	NA	NA
WP_015500446.1|2889062_2890394_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_044043816.1|2890465_2890696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055587.1|2890861_2891497_-	type I secretion protein	NA	NA	NA	NA	NA
WP_015500449.1|2892060_2892828_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015500450.1|2892971_2895080_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	6.6e-44
WP_015500451.1|2895909_2896251_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	34.5	1.8e-12
WP_051068019.1|2896838_2897096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055588.1|2897939_2898170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500453.1|2898166_2898355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500454.1|2898507_2899017_-	DUF2269 domain-containing protein	NA	NA	NA	NA	NA
WP_144055589.1|2899013_2899238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043821.1|2899327_2899876_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500456.1|2901547_2902156_+	HMP/thiamine-binding protein	NA	NA	NA	NA	NA
WP_015500457.1|2902160_2902949_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015500458.1|2902945_2903701_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.1	7.4e-06
WP_015500459.1|2903697_2904681_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500460.1|2907550_2908117_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_187292471.1|2908151_2908409_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	56.9	1.5e-14
WP_015500461.1|2909028_2910057_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_015500462.1|2910053_2910656_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_044044792.1|2910663_2910882_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_044043822.1|2911059_2911518_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_015500465.1|2911519_2911999_-	UPF0262 family protein	NA	NA	NA	NA	NA
WP_015500466.1|2912003_2913308_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_015500467.1|2913337_2913826_-	DUF2948 family protein	NA	NA	NA	NA	NA
WP_015500468.1|2913822_2915094_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_044043825.1|2915099_2915297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500470.1|2915859_2916132_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_144055590.1|2916203_2917325_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.9	1.4e-40
WP_187292472.1|2917285_2917516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015501160.1|2917512_2918208_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	8.3e-44
>prophage 11
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	2996468	3079599	4812600	integrase,transposase,holin	Mycobacterium_phage(31.58%)	73	3003957:3003997	3078858:3078898
WP_015500543.1|2996468_2997716_-|transposase	IS256-like element ISOan8 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	42.5	2.0e-85
WP_015500544.1|2998145_2999492_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_015500545.1|2999772_3001128_+|transposase	IS1380-like element ISOan2 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	31.1	7.7e-46
WP_015500546.1|3001463_3001976_+	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_015500547.1|3002335_3003388_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3003957:3003997	attL	CTGTTGGAACAGAAGTTCCACAGCCAGACACCTAATACGGT	NA	NA	NA	NA
WP_085982887.1|3004052_3005178_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015500549.1|3006766_3007834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055592.1|3008449_3009581_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044043863.1|3009694_3010036_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_187292475.1|3010410_3010764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500162.1|3010961_3011165_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_015500555.1|3012746_3013658_+	DMT family transporter	NA	NA	NA	NA	NA
WP_015500556.1|3014085_3015144_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015500557.1|3015863_3017111_-|transposase	IS256-like element ISOan5 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	44.0	9.8e-88
WP_015500558.1|3018545_3019595_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	28.7	3.5e-22
WP_015500559.1|3019855_3020488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500562.1|3023835_3024039_+	gas vesicle structural protein GvpA	NA	NA	NA	NA	NA
WP_144055729.1|3025287_3025929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044044815.1|3026021_3026996_+	gas vesicle protein GvpN	NA	NA	NA	NA	NA
WP_144055594.1|3026992_3027340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500565.1|3027400_3027961_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_144055730.1|3027950_3028724_+	GvpL/GvpF family gas vesicle protein	NA	NA	NA	NA	NA
WP_015500567.1|3028729_3028984_+	gas vesicle protein GvpG	NA	NA	NA	NA	NA
WP_083903029.1|3028970_3029336_+	gas vesicle protein	NA	NA	NA	NA	NA
WP_015500569.1|3029372_3029711_+	gas vesicle protein	NA	NA	NA	NA	NA
WP_144055595.1|3029710_3030796_+	GvpL/GvpF family gas vesicle protein	NA	NA	NA	NA	NA
WP_015500571.1|3030808_3031645_+	GvpL/GvpF family gas vesicle protein	NA	NA	NA	NA	NA
WP_015500572.1|3031634_3031859_+	gas vesicle protein	NA	NA	NA	NA	NA
WP_015500573.1|3031855_3032578_+	GvpL/GvpF family gas vesicle protein	NA	NA	NA	NA	NA
WP_015500574.1|3032574_3032973_+	gas vesicle protein K	NA	NA	NA	NA	NA
WP_015500576.1|3033322_3034537_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	6.1e-42
WP_015500577.1|3034959_3036216_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.4	1.6e-101
WP_015500578.1|3036470_3037025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500579.1|3037383_3038631_+|transposase	IS256-like element ISOan5 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	44.0	2.2e-87
WP_085982888.1|3038673_3039806_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_085982882.1|3040940_3042069_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	1.2e-55
WP_015500581.1|3042687_3043878_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_015500582.1|3043874_3044642_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_015500583.1|3044677_3045499_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_015500586.1|3046296_3046497_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_083903031.1|3046915_3047335_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015497935.1|3047479_3048232_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.5	1.4e-41
WP_015500557.1|3048775_3050023_-|transposase	IS256-like element ISOan5 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	44.0	9.8e-88
WP_015500588.1|3051188_3052394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043876.1|3052710_3053208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500590.1|3053244_3054501_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
WP_015500591.1|3054888_3055305_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_015500593.1|3056288_3057566_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	27.1	9.6e-14
WP_015500594.1|3057855_3058989_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	24.1	1.0e-11
WP_015500595.1|3059437_3060121_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500596.1|3060246_3061245_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500597.1|3061323_3061809_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_015500598.1|3061820_3063104_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_015500599.1|3063150_3064296_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_015500600.1|3064776_3065301_-	2,4'-dihydroxyacetophenone dioxygenase family protein	NA	NA	NA	NA	NA
WP_015500601.1|3065314_3066019_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144055732.1|3066015_3066645_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_015500603.1|3066647_3067562_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_015500604.1|3067542_3068232_-	RraA family protein	NA	NA	NA	NA	NA
WP_015500605.1|3068244_3069276_-	C-terminal binding protein	NA	A7ITA6	Paramecium_bursaria_Chlorella_virus	26.4	8.3e-16
WP_015500606.1|3069268_3069763_-	lactoylglutathione lyase family protein	NA	NA	NA	NA	NA
WP_015500607.1|3069788_3070577_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015500608.1|3070578_3071562_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015500609.1|3071558_3073085_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.1	1.2e-10
WP_015500610.1|3073175_3074210_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500611.1|3074233_3075121_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_044044834.1|3075197_3075851_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144055596.1|3075928_3076306_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	5.7e-23
WP_015500613.1|3076790_3077726_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.3	1.4e-22
WP_083903033.1|3077996_3078188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051068026.1|3078329_3078557_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	54.7	4.9e-14
WP_015500615.1|3078583_3079306_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.5	4.3e-19
3078858:3078898	attR	ACCGTATTAGGTGTCTGGCTGTGGAACTTCTGTTCCAACAG	NA	NA	NA	NA
WP_083903035.1|3079302_3079599_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	3094378	3212592	4812600	tRNA,transposase,integrase,holin	Staphylococcus_phage(18.75%)	109	3117154:3117174	3214022:3214037
WP_085982903.1|3094378_3095136_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083903229.1|3096108_3096264_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_015500632.1|3096426_3097632_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_015500633.1|3097624_3098311_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_015500634.1|3098307_3099027_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_015500635.1|3099026_3100799_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_015500636.1|3100919_3101975_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_015500637.1|3101977_3102883_-	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_015500638.1|3102946_3103816_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015500639.1|3103849_3104737_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_015500640.1|3104733_3105771_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015500641.1|3105770_3106637_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015500642.1|3106638_3107340_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.4e-14
WP_015500643.1|3107336_3108068_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	2.8e-10
WP_015500644.1|3108140_3109400_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500645.1|3109613_3110474_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_015500646.1|3110493_3111285_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015500647.1|3111302_3112343_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044043893.1|3112353_3112683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187292476.1|3112675_3112930_+	nitrate/nitrite transporter NrtS	NA	NA	NA	NA	NA
WP_015500649.1|3113011_3113590_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500650.1|3113649_3114582_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500651.1|3114690_3115440_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	7.6e-11
WP_015500652.1|3115470_3116055_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_051068029.1|3116091_3116352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083903041.1|3116385_3116712_+	hypothetical protein	NA	NA	NA	NA	NA
3117154:3117174	attL	CGGCTTTGTTGCACAAATCGC	NA	NA	NA	NA
WP_015500656.1|3118339_3118936_-	hypothetical protein	NA	NA	NA	NA	NA
3117154:3117174	attL	CGGCTTTGTTGCACAAATCGC	NA	NA	NA	NA
WP_015500657.1|3119367_3119613_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015500659.1|3120554_3121742_+|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	33.5	1.3e-12
WP_015500660.1|3121754_3122456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500661.1|3122558_3122786_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015500662.1|3122938_3123322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500664.1|3124078_3124879_+	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144055733.1|3124886_3126167_+	DUF4910 domain-containing protein	NA	NA	NA	NA	NA
WP_015500666.1|3126747_3127899_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083903231.1|3128157_3128640_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_015500668.1|3128683_3128983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500669.1|3129149_3130769_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.8	2.6e-16
WP_187292477.1|3130781_3130931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500670.1|3131393_3131744_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015500671.1|3131733_3132195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500672.1|3132472_3133153_+	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_044044862.1|3133566_3134478_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015500674.1|3134474_3135419_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_051068033.1|3136563_3136779_+	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	66.2	3.5e-17
WP_015500676.1|3137135_3137759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500677.1|3137936_3138296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500678.1|3138295_3138940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500679.1|3138952_3139885_-|transposase	IS5-like element ISOan4 family transposase	transposase	Q9MCT5	Escherichia_phage	41.4	5.1e-57
WP_187292478.1|3139908_3140199_-	hypothetical protein	NA	NA	NA	NA	NA
3139931:3139951	attR	GCGATTTGTGCAACAAAGCCG	NA	NA	NA	NA
WP_187292479.1|3140322_3141432_+	hypothetical protein	NA	NA	NA	NA	NA
3139931:3139951	attR	GCGATTTGTGCAACAAAGCCG	NA	NA	NA	NA
WP_015500681.1|3141451_3142375_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_015500682.1|3142448_3142634_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_015500683.1|3143043_3143226_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_051068034.1|3143523_3144108_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.1	2.1e-48
WP_015500684.1|3144521_3144869_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	34.6	2.7e-11
WP_015500685.1|3145153_3145627_+	CIA30 family protein	NA	NA	NA	NA	NA
WP_015500686.1|3145688_3147116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187292480.1|3148105_3148249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500689.1|3148916_3150350_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	3.2e-42
WP_051068035.1|3150369_3150594_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_015500691.1|3150544_3150853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500692.1|3150815_3151112_-	cation transporter	NA	NA	NA	NA	NA
WP_015500693.1|3151602_3152022_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015500696.1|3152997_3153582_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015500697.1|3153633_3153807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500698.1|3153908_3154100_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_187292481.1|3157296_3157470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500700.1|3157503_3158652_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500701.1|3158762_3159275_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_015500702.1|3159289_3160618_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_015500703.1|3161129_3161963_-	DUF2182 domain-containing protein	NA	NA	NA	NA	NA
WP_015500704.1|3161978_3162617_-	DUF1326 domain-containing protein	NA	NA	NA	NA	NA
WP_015500707.1|3165480_3165852_+	LCCL-domain-containing protein	NA	NA	NA	NA	NA
WP_015500708.1|3166049_3166763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500709.1|3166956_3167544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085982882.1|3168128_3169257_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	1.2e-55
WP_015500710.1|3169355_3170864_-	malonyl-CoA synthase	NA	A0A2H4PQM9	Staphylococcus_phage	29.2	7.6e-34
WP_015500711.1|3170875_3172120_-	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_015500712.1|3172141_3174037_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_015500713.1|3174095_3175082_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_144055734.1|3175161_3175680_-	3-isopropylmalate dehydratase	NA	NA	NA	NA	NA
WP_015500715.1|3175691_3176969_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_015500716.1|3176965_3177724_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044043905.1|3177846_3178677_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_015500718.1|3178726_3179950_+	amidase	NA	NA	NA	NA	NA
WP_044043908.1|3182017_3183487_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_044043909.1|3183798_3183978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500723.1|3185472_3185943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187292482.1|3187253_3187385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055599.1|3187381_3187897_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015500726.1|3187838_3188981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500727.1|3189303_3189702_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	33.6	2.4e-16
WP_144055600.1|3190033_3190258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500728.1|3190496_3191228_-	universal stress protein	NA	NA	NA	NA	NA
WP_015500729.1|3191854_3192826_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500730.1|3193004_3194042_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044043911.1|3194054_3195122_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.9	1.5e-28
WP_015500732.1|3196487_3198368_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_187292483.1|3199747_3200023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055601.1|3200119_3201697_-	HYR domain-containing protein	NA	NA	NA	NA	NA
WP_144055602.1|3201832_3202810_-	reverse transcriptase	NA	H7BVN7	unidentified_phage	28.7	1.7e-10
WP_015500741.1|3207306_3208326_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015500742.1|3208384_3208804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500743.1|3208803_3209001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500744.1|3209138_3210017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500745.1|3210017_3211211_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.4	8.0e-79
WP_015500746.1|3211510_3211876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500747.1|3211872_3212592_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
3214022:3214037	attR	GCAGAATTAATCGACG	NA	NA	NA	NA
>prophage 13
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	3336975	3384004	4812600	protease,transposase,integrase,tRNA	Acinetobacter_phage(16.67%)	31	3339919:3339978	3365273:3365350
WP_187292486.1|3336975_3337278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085982890.1|3337195_3338325_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	3.4e-55
WP_015500866.1|3338470_3339547_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044043943.1|3339629_3339857_+|transposase	transposase	transposase	NA	NA	NA	NA
3339919:3339978	attL	ATCGGCGCGGTCTGTGCTGCCACCATTTTGATAGACCCTCTCATGATTTGCATGCAAATC	NA	NA	NA	NA
WP_044043947.1|3340241_3340892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043949.1|3342055_3343195_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015500870.1|3343198_3343960_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	9.4e-09
WP_085982891.1|3343956_3345135_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_015500872.1|3345131_3346331_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_015500873.1|3346327_3347143_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015500874.1|3347232_3348516_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015500875.1|3348615_3349692_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015500876.1|3349722_3350721_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015500877.1|3350747_3351566_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	1.5e-15
WP_015500878.1|3351562_3353530_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.0	7.5e-34
WP_044044907.1|3353693_3355625_+	PAS-domain containing protein	NA	NA	NA	NA	NA
WP_015500880.1|3355621_3356326_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144055610.1|3360429_3361698_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	27.9	2.1e-21
WP_015500883.1|3362070_3362457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043953.1|3365695_3365893_-	hypothetical protein	NA	NA	NA	NA	NA
3365273:3365350	attR	ATCGGCGCGGTCTGTGCTGCCACCATTTTGATAGACCCTCTCATGATTTGCATGCAAATCACTGCCGGGCAGTGGATG	NA	NA	NA	NA
WP_015500887.1|3366506_3367547_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_044043955.1|3367593_3367776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500888.1|3367815_3368034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044043957.1|3368072_3369296_+	MFS transporter	NA	NA	NA	NA	NA
WP_015500890.1|3369350_3371063_+|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	35.6	6.3e-85
WP_015500893.1|3374869_3375301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500894.1|3375401_3376172_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015500895.1|3378599_3379136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015500896.1|3379172_3379652_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_015500897.1|3379776_3383214_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_015500898.1|3383263_3384004_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 14
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	3390494	3453587	4812600	transposase,integrase,tRNA	Bacillus_phage(25.0%)	49	3394094:3394127	3455543:3455576
WP_015500906.1|3390494_3391736_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	9.6e-19
3394094:3394127	attL	CCTCTCGGGACATTGCTGCGCAATACCCTGCCGG	NA	NA	NA	NA
WP_015500909.1|3396156_3397221_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_015500910.1|3397207_3399505_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_015500911.1|3399657_3402822_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	33.0	1.7e-123
WP_051068121.1|3402818_3403013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044043970.1|3403104_3404244_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015500913.1|3404490_3405702_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_015500914.1|3405850_3407740_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	2.7e-41
WP_015500915.1|3407749_3408493_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_144055612.1|3408934_3409156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015500916.1|3409418_3409982_-	elongation factor P	NA	NA	NA	NA	NA
WP_015494366.1|3410207_3410540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500919.1|3411200_3412655_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_015500920.1|3412698_3413844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044044921.1|3413920_3415297_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_083903234.1|3415371_3415995_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_015500925.1|3417418_3417895_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_051068049.1|3418652_3418898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015500927.1|3419140_3420082_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_144055613.1|3420558_3421128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051068050.1|3422618_3423008_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQN1	Mannheimia_phage	41.5	8.2e-17
WP_144055614.1|3423009_3423366_-	hypothetical protein	NA	A0A2H4JE37	uncultured_Caudovirales_phage	30.6	1.2e-06
WP_187292487.1|3423895_3424066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015498062.1|3424129_3424438_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083903077.1|3424458_3424914_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015500931.1|3424965_3425907_+|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
WP_144055617.1|3426084_3426252_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_051068052.1|3426275_3426503_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	35.6	3.2e-05
WP_044044928.1|3428076_3429219_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_015500935.1|3429458_3429746_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_015500936.1|3429755_3430454_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_015500937.1|3430450_3431320_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015500938.1|3431319_3432831_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	8.1e-12
WP_015500939.1|3432827_3433829_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015500940.1|3433842_3434817_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015500941.1|3434872_3435670_-	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	24.6	6.6e-05
WP_015500942.1|3435761_3436715_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144055618.1|3436980_3438753_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_015500944.1|3438763_3439573_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015500945.1|3439639_3440950_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_015500946.1|3441013_3441997_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_015500947.1|3442010_3443006_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_015500948.1|3442995_3444309_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_015500949.1|3444325_3445756_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_051068053.1|3445760_3446642_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_015500952.1|3448176_3449943_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_144055619.1|3452112_3452409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187292462.1|3452881_3453145_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_085982892.1|3453263_3453587_-|transposase	transposase	transposase	NA	NA	NA	NA
3455543:3455576	attR	CCTCTCGGGACATTGCTGCGCAATACCCTGCCGG	NA	NA	NA	NA
>prophage 16
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	3686608	3710258	4812600	transposase	Acinetobacter_phage(50.0%)	23	NA	NA
WP_015500698.1|3686608_3686800_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044044007.1|3686921_3687506_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015501151.1|3688998_3689331_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015501152.1|3689736_3690624_-	CopD family protein	NA	NA	NA	NA	NA
WP_015501153.1|3690629_3690974_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_044044975.1|3690970_3691408_-	cytochrome c	NA	NA	NA	NA	NA
WP_015501155.1|3691431_3691926_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_044044014.1|3692023_3692338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187292496.1|3692412_3692601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501158.1|3692738_3692918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187292497.1|3693972_3695178_-	amino acid decarboxylase	NA	NA	NA	NA	NA
WP_015499481.1|3695273_3695549_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015501160.1|3695545_3696241_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	8.3e-44
WP_015498857.1|3696411_3697464_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044044016.1|3697794_3698229_-	peptidase S24	NA	NA	NA	NA	NA
WP_015501162.1|3698515_3698731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051068060.1|3701588_3701972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501163.1|3701993_3702347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501164.1|3702794_3704849_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_015501165.1|3704938_3705943_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_015501168.1|3706702_3707653_+	DMT family transporter	NA	NA	NA	NA	NA
WP_044044980.1|3707862_3708171_-	peptidase S24	NA	NA	NA	NA	NA
WP_015501172.1|3709712_3710258_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.8	1.9e-64
>prophage 17
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	3795942	3849436	4812600	protease,transposase	Thermus_phage(11.11%)	40	NA	NA
WP_015501244.1|3795942_3797364_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_015501245.1|3798012_3799143_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	43.4	1.3e-25
WP_015501246.1|3799282_3801949_+	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	31.3	8.5e-105
WP_015501247.1|3802035_3802752_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_015501248.1|3802751_3803375_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_144055747.1|3803594_3804620_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_015501250.1|3804616_3805927_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015501251.1|3805923_3806691_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015501252.1|3806995_3808420_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_015501253.1|3808421_3809282_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	42.9	4.0e-16
WP_015501254.1|3809636_3809822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044044043.1|3811063_3811378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501259.1|3813779_3814661_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015501260.1|3816413_3817241_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_083903120.1|3817536_3817677_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_083903122.1|3817616_3818120_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	36.7	4.5e-15
WP_187292499.1|3818065_3818416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051068064.1|3818433_3818853_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_015501264.1|3823698_3825714_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_015501265.1|3825784_3826582_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015501266.1|3826608_3827409_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015501267.1|3827473_3828517_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_015501268.1|3828545_3828998_-	dUTP diphosphatase	NA	A0A2R8FDW2	Brazilian_cedratvirus	56.5	1.2e-32
WP_015501269.1|3828997_3830185_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	2.2e-36
WP_044044045.1|3830258_3831137_-	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	31.8	4.9e-33
WP_015501271.1|3831234_3831768_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_015501272.1|3831764_3832340_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_015501273.1|3832398_3833088_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_015501274.1|3833175_3834687_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_144055748.1|3834656_3835349_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_044044047.1|3835540_3836494_-	glutathione synthase	NA	NA	NA	NA	NA
WP_044044049.1|3836554_3836926_-	YraN family protein	NA	NA	NA	NA	NA
WP_015501277.1|3836922_3837783_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_015501278.1|3837868_3839080_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_187292584.1|3839123_3841874_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_015501280.1|3845335_3846130_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015501281.1|3846129_3846900_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.4	3.0e-10
WP_015501282.1|3846896_3847415_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_044045012.1|3847471_3848485_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015498352.1|3849094_3849436_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	59.8	1.9e-25
>prophage 18
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	3886152	3939559	4812600	protease,transposase,tRNA	Staphylococcus_phage(20.0%)	57	NA	NA
WP_015498511.1|3886152_3887094_-|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
WP_015501321.1|3887232_3888387_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_044045019.1|3888430_3888829_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015501323.1|3888908_3889556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501324.1|3889555_3890203_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_144055641.1|3890363_3891023_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_015501326.1|3890977_3891361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501327.1|3891357_3892710_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015501328.1|3892806_3893496_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_015501329.1|3893558_3894740_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.4	5.4e-96
WP_144055642.1|3894809_3896354_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_015501331.1|3896361_3897246_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015501332.1|3897296_3897782_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_015501333.1|3897778_3898795_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.5	8.4e-45
WP_015501334.1|3898937_3899246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044045022.1|3899258_3899819_-	OmpA family protein	NA	NA	NA	NA	NA
WP_044044093.1|3900065_3901391_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_015501337.1|3901497_3902364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055751.1|3902368_3902773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144055644.1|3902942_3903389_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_015501340.1|3903548_3904058_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_015501341.1|3904057_3904762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044044095.1|3904840_3906070_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_015501343.1|3906079_3906871_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144055645.1|3906889_3907687_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_015501345.1|3908472_3908910_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_144055752.1|3909084_3909417_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_015501347.1|3909471_3910149_+	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_015501348.1|3910148_3910976_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044044100.1|3910972_3911944_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_015501350.1|3912026_3913268_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_015501351.1|3913278_3914046_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015501352.1|3914149_3915364_+	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.1	2.0e-05
WP_015501353.1|3915447_3916530_+	Zn-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015501354.1|3916621_3917851_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_015501355.1|3918006_3918603_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044044103.1|3918663_3918873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501356.1|3918871_3919525_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_015501357.1|3919521_3920466_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015501358.1|3920475_3921384_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_015501359.1|3921383_3922643_-	glycerate kinase	NA	NA	NA	NA	NA
WP_044045026.1|3922671_3923400_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015501361.1|3923831_3924080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501362.1|3924144_3924684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055646.1|3925401_3925707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051068067.1|3927549_3928374_+	TniQ family protein	NA	NA	NA	NA	NA
WP_144055647.1|3928398_3929283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501366.1|3929785_3930376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044044121.1|3930379_3930772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501368.1|3930893_3931256_-	TniQ family protein	NA	NA	NA	NA	NA
WP_015501369.1|3931255_3931849_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_015500245.1|3931967_3932291_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_187292462.1|3932410_3932674_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044044123.1|3934497_3934809_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.6	6.5e-17
WP_015501372.1|3936380_3936539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501373.1|3936973_3937285_-	ETC complex I subunit	NA	NA	NA	NA	NA
WP_015501375.1|3939211_3939559_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	31.0	8.4e-13
>prophage 19
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	4276035	4291311	4812600	transposase	Acinetobacter_phage(100.0%)	11	NA	NA
WP_015498511.1|4276035_4276977_-|transposase	IS1595-like element ISOan10 family transposase	transposase	NA	NA	NA	NA
WP_015501639.1|4278879_4279980_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015501640.1|4279976_4283138_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_187292512.1|4283584_4283731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501641.1|4284021_4284750_-	SapC family protein	NA	NA	NA	NA	NA
WP_015501642.1|4285069_4287961_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_044044239.1|4288526_4288712_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015499717.1|4289042_4289351_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083903082.1|4289371_4289647_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_187292513.1|4289732_4289981_+|transposase	transposase family protein	transposase	A0A0P0I4A4	Acinetobacter_phage	43.1	5.4e-06
WP_015500866.1|4290234_4291311_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	4350968	4377228	4812600	transposase,integrase	Leptospira_phage(16.67%)	22	4350376:4350390	4377934:4377948
4350376:4350390	attL	TCTTCTTCTTTTGTG	NA	NA	NA	NA
WP_015497970.1|4350968_4351292_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_187292462.1|4351411_4351675_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044042951.1|4353492_4353804_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.6	3.8e-17
WP_015501702.1|4354251_4354563_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_015501703.1|4354559_4355177_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_044045090.1|4355166_4355997_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_015493774.1|4356011_4356323_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_015501705.1|4356448_4357624_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.1	6.6e-09
WP_015501706.1|4357710_4359828_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.3	4.7e-58
WP_015501707.1|4359843_4360314_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_015493770.1|4360326_4360698_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_015501708.1|4360958_4361861_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015501709.1|4362162_4366416_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	1.2e-65
WP_015501710.1|4366495_4370638_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.2	1.3e-27
WP_015501711.1|4370904_4371276_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_015501712.1|4371345_4371861_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_044044260.1|4372239_4372470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083903184.1|4372456_4372825_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_187292462.1|4375553_4375817_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015501713.1|4375936_4376260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_187292516.1|4376378_4376957_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_187292517.1|4376853_4377228_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	73.3	2.4e-37
4377934:4377948	attR	TCTTCTTCTTTTGTG	NA	NA	NA	NA
>prophage 21
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	4426543	4516978	4812600	transposase,integrase,tRNA	Enterobacteria_phage(15.38%)	89	4432975:4433001	4480306:4480332
WP_015501751.1|4426543_4427989_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_015501752.1|4428231_4430631_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_051068083.1|4430623_4430839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501754.1|4431965_4432166_-	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	55.6	4.3e-06
WP_083903190.1|4432502_4432925_+|transposase	transposase	transposase	NA	NA	NA	NA
4432975:4433001	attL	GAGTTTTTCAACAGAATAGGCCGGAAG	NA	NA	NA	NA
WP_144055670.1|4433298_4433799_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_083903192.1|4433764_4433995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083903194.1|4434053_4434653_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	35.0	9.1e-15
WP_044044283.1|4434681_4434912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044045102.1|4434926_4435109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501757.1|4435385_4435772_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_187292589.1|4435871_4436042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501758.1|4436047_4437265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501759.1|4437261_4438206_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015501760.1|4438208_4439018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501761.1|4439019_4439730_+	3-demethylubiquinone-9 3-O-methyltransferase	NA	NA	NA	NA	NA
WP_051068137.1|4439729_4440203_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_044044290.1|4440734_4441031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501764.1|4441182_4441815_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044044291.1|4441962_4442172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501766.1|4442241_4442637_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_015501767.1|4442667_4443237_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_015501768.1|4443233_4443446_-	DUF2805 domain-containing protein	NA	NA	NA	NA	NA
WP_015501769.1|4443646_4443985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501770.1|4444036_4444942_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015501771.1|4445282_4446071_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_044044294.1|4446067_4446679_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015501773.1|4446675_4447482_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015501774.1|4447478_4448243_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_144055764.1|4448605_4448845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044044296.1|4448932_4449586_+	TIGR02594 family protein	NA	R9TRQ2	Rhizobium_phage	37.4	1.0e-27
WP_015501777.1|4449885_4451421_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	26.7	5.9e-34
WP_015501778.1|4451491_4451935_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_044045108.1|4451924_4452476_-	response regulator	NA	NA	NA	NA	NA
WP_015501781.1|4453453_4454671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187292519.1|4454900_4455062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501783.1|4455324_4456140_+	bacteriorhodopsin	NA	NA	NA	NA	NA
WP_044044298.1|4456199_4457060_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_015501785.1|4457049_4458558_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_015501786.1|4458554_4459406_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_044044300.1|4459392_4460502_+	lycopene cyclase	NA	NA	NA	NA	NA
WP_015501788.1|4460498_4461371_+	Brp/Blh family beta-carotene 15,15'-dioxygenase	NA	NA	NA	NA	NA
WP_015501789.1|4461435_4461633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501790.1|4462847_4465436_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_015501791.1|4465773_4467033_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	28.3	1.0e-28
WP_044044302.1|4467686_4468568_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015501793.1|4468572_4468854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051068087.1|4470727_4471183_+	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_015501795.1|4472163_4473468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501796.1|4473464_4474760_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015501797.1|4475368_4476304_-	ion transporter	NA	NA	NA	NA	NA
WP_015501798.1|4476339_4477401_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144055671.1|4477773_4478214_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_144055672.1|4478210_4480202_-	hypothetical protein	NA	I6NPA6	Burkholderia_phage	23.3	1.3e-09
WP_015501800.1|4480586_4481519_-|transposase	IS5-like element ISOan4 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.0	6.7e-57
4480306:4480332	attR	CTTCCGGCCTATTCTGTTGAAAAACTC	NA	NA	NA	NA
WP_187292520.1|4481603_4482014_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_015501802.1|4482201_4482528_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015501800.1|4483040_4483973_+|transposase	IS5-like element ISOan4 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.0	6.7e-57
WP_015501804.1|4485392_4486370_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_015501805.1|4486366_4487170_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_015501806.1|4487383_4488841_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144055765.1|4489026_4489665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501808.1|4489704_4494243_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_015501809.1|4494410_4495178_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_015501810.1|4495244_4495910_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_144055673.1|4496023_4497049_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_044044309.1|4497104_4498274_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_015501813.1|4498312_4499242_+	DMT family transporter	NA	NA	NA	NA	NA
WP_044044311.1|4499302_4499488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015501814.1|4499495_4500365_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_015501815.1|4500512_4501016_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015501816.1|4501020_4501722_+	response regulator	NA	W8CYM9	Bacillus_phage	37.2	6.4e-36
WP_015501817.1|4501814_4502738_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	33.1	3.8e-44
WP_015501818.1|4502734_4502971_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_144055674.1|4502927_4503833_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_015501820.1|4503846_4505754_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_015501821.1|4505824_4506682_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015501822.1|4506735_4507224_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044044368.1|4507170_4507857_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	39.8	1.3e-36
WP_144055675.1|4508128_4508901_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_187292521.1|4509384_4510158_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.9	4.3e-49
WP_015500153.1|4510277_4510601_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_044044316.1|4511186_4511462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015501825.1|4511461_4512355_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_051068088.1|4512399_4512918_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015501826.1|4512916_4514170_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_015501827.1|4514170_4515046_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_015496946.1|4515419_4515545_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_015501829.1|4515817_4516978_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	4.4e-42
>prophage 22
NC_020911	Octadecabacter antarcticus 307, complete sequence	4812600	4713605	4765310	4812600	protease,transposase,integrase,tRNA	Escherichia_phage(18.18%)	49	4734087:4734102	4770326:4770341
WP_015502014.1|4713605_4714658_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_015502015.1|4714740_4715136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015502016.1|4715083_4715797_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	35.9	9.1e-22
WP_015502017.1|4716092_4716758_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015502018.1|4716747_4717614_-	ribokinase	NA	NA	NA	NA	NA
WP_015502019.1|4717630_4719886_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_044044344.1|4720024_4722643_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	19.2	4.1e-19
WP_015502021.1|4722632_4723205_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015502022.1|4723217_4724282_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_015502023.1|4724398_4725106_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_015502024.1|4725105_4725714_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_015502025.1|4725706_4726855_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_015502026.1|4726851_4727742_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	29.2	1.1e-11
WP_015502027.1|4727738_4728557_-	ParA family protein	NA	Q8JL10	Natrialba_phage	36.2	4.1e-18
WP_015502028.1|4728546_4729167_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_015502029.1|4729163_4731041_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_044044346.1|4731044_4732331_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_015502031.1|4732362_4733676_-	transcription termination factor Rho	NA	NA	NA	NA	NA
4734087:4734102	attL	GATCATCAAGGATATC	NA	NA	NA	NA
WP_015502032.1|4734193_4734793_+	Maf family protein	NA	NA	NA	NA	NA
WP_015502033.1|4734789_4735623_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_044044348.1|4735619_4736213_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_015502035.1|4736205_4736934_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	45.9	8.6e-52
WP_015502036.1|4736941_4737457_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_015502037.1|4737513_4738011_-	FxsA family protein	NA	NA	NA	NA	NA
WP_015502038.1|4738134_4738794_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_015502039.1|4738874_4739846_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_015502040.1|4739842_4740433_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_015502041.1|4740411_4741659_-	MFS transporter	NA	NA	NA	NA	NA
WP_015502042.1|4741696_4743001_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.4	4.5e-43
WP_015502043.1|4742993_4743554_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_015502044.1|4743665_4743986_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.9	4.7e-18
WP_015502045.1|4744047_4747434_-	double-strand break repair helicase AddA	NA	U5PSZ2	Bacillus_phage	44.8	2.6e-05
WP_044044351.1|4747430_4750367_-	double-strand break repair protein AddB	NA	NA	NA	NA	NA
WP_015502047.1|4750356_4751040_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_044044353.1|4751036_4751999_-	phosphotransferase	NA	NA	NA	NA	NA
WP_015502049.1|4751991_4752462_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_015502050.1|4752502_4754104_-	PAS-domain containing protein	NA	NA	NA	NA	NA
WP_015502051.1|4754165_4755548_-	ActS/PrrB/RegB family redox-sensitive histidine kinase	NA	NA	NA	NA	NA
WP_015502052.1|4755636_4756254_+	SCO family protein	NA	NA	NA	NA	NA
WP_015502053.1|4756318_4756864_+	ActR/PrrA/RegA family redox response regulator transcription factor	NA	NA	NA	NA	NA
WP_015502054.1|4756937_4757813_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015502055.1|4757910_4758075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015502056.1|4758244_4758835_-	HD family hydrolase	NA	A0A0K1Y6I9	Rhodobacter_phage	44.4	5.1e-18
WP_015502057.1|4758944_4760333_+	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_051068094.1|4760477_4760801_+	extensin family protein	NA	NA	NA	NA	NA
WP_015502058.1|4760908_4761250_+	DUF2853 family protein	NA	NA	NA	NA	NA
WP_051068095.1|4761360_4762020_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	35.0	3.9e-19
WP_187292527.1|4762526_4763306_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.5	4.4e-46
WP_083903198.1|4764998_4765310_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4770326:4770341	attR	GATATCCTTGATGATC	NA	NA	NA	NA
