The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	17786	65643	2939026	bacteriocin,protease,holin	Pithovirus(25.0%)	48	NA	NA
WP_003568480.1|17786_18644_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|18723_18906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|18956_19136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568484.1|19624_20860_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003568542.1|21063_23637_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|23649_24351_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.2	1.1e-16
WP_003568490.1|24630_25182_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568492.1|25225_26032_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568494.1|26036_26357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568543.1|26582_27263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659016.1|27195_27699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659018.1|27718_29869_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_003568499.1|30213_30987_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003568500.1|31164_31770_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568502.1|32109_32334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568598.1|32489_33167_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003568507.1|33331_34225_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|34273_34912_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|35140_36517_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003562527.1|38196_38541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|38616_38976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562542.1|39216_40659_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003562544.1|40853_41489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562546.1|41538_41850_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003562548.1|42018_42207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562550.1|42338_42950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659032.1|43307_43781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568611.1|43978_44317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562555.1|44650_45361_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003562558.1|45347_45677_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003659037.1|45914_46205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562560.1|46557_46773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562562.1|47119_47995_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562571.1|48340_48991_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003562575.1|49388_50081_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562576.1|50778_51099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562578.1|51287_52163_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	2.3e-11
WP_003562580.1|52255_53776_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	4.1e-11
WP_003562582.1|54190_55564_-	MFS transporter	NA	NA	NA	NA	NA
WP_003582875.1|55741_56065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568624.1|56245_59557_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003562586.1|59553_60156_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562589.1|60406_60667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|60880_61543_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|61542_62472_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|62483_63113_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562598.1|63115_64369_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003568630.1|64989_65643_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	807493	848471	2939026	protease,integrase,tRNA,capsid,head,holin,tail,terminase,portal	Lactobacillus_phage(95.24%)	49	795682:795696	816706:816720
795682:795696	attL	TTTGTTCTTTGAAAA	NA	NA	NA	NA
WP_003657812.1|807493_809905_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.3	0.0e+00
WP_003564130.1|810169_811813_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003564131.1|811817_812528_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003564132.1|812670_812886_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003564133.1|813002_813824_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003564134.1|813820_814324_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020967482.1|814647_815787_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.7	5.1e-216
WP_003657820.1|815905_816883_-	Abi family protein	NA	NA	NA	NA	NA
816706:816720	attR	TTTGTTCTTTGAAAA	NA	NA	NA	NA
WP_003657822.1|816994_817456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003657825.1|817639_818122_-	hypothetical protein	NA	A0A0P0IZP3	Lactobacillus_phage	84.4	2.3e-69
WP_003657826.1|818125_818419_-	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	94.8	2.7e-44
WP_003657829.1|818597_819476_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	92.1	5.0e-147
WP_003657831.1|819462_819822_-	helix-turn-helix transcriptional regulator	NA	A0A0P0I3L3	Lactobacillus_phage	63.0	2.3e-34
WP_003578190.1|820091_820289_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_003657834.1|820285_821083_+	ORF6N domain-containing protein	NA	A0A0P0IDD0	Lactobacillus_phage	64.8	2.8e-56
WP_003657835.1|821410_821635_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_003593165.1|821723_821936_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	98.6	9.5e-36
WP_003657839.1|821945_822821_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	94.8	6.5e-163
WP_003657841.1|822823_823018_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	95.3	7.9e-29
WP_003657844.1|823017_823872_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	72.2	1.9e-114
WP_003657846.1|823880_824126_+	helix-turn-helix domain-containing protein	NA	A0A0P0IV68	Lactobacillus_phage	93.8	7.1e-35
WP_020967483.1|824130_824976_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	97.9	2.4e-130
WP_003657850.1|825013_825835_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.3	5.2e-154
WP_003657853.1|826094_826379_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	98.9	2.0e-44
WP_003657857.1|826687_827266_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	98.4	5.9e-104
WP_003657858.1|827363_827813_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	91.9	2.5e-73
WP_003657859.1|828013_828790_-	hypothetical protein	NA	V5URQ0	Oenococcus_phage	28.8	1.8e-10
WP_020967486.1|828931_829312_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	95.2	3.4e-68
WP_041168811.1|829381_829756_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	99.2	8.0e-62
WP_003657862.1|829758_831489_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	98.6	0.0e+00
WP_003657863.1|831507_832749_+|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	98.8	2.5e-232
WP_020967488.1|832720_833428_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	97.4	3.3e-125
WP_003657865.1|833432_834665_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	95.1	7.2e-216
WP_003657866.1|834738_834987_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	93.9	1.9e-35
WP_003657868.1|835000_835327_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	96.3	6.6e-52
WP_003657869.1|835265_835604_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	97.3	1.2e-56
WP_003657870.1|835587_835917_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	98.2	7.6e-56
WP_003657872.1|835906_836290_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	98.4	1.7e-67
WP_003657874.1|836301_836949_+	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	95.8	4.1e-114
WP_003657877.1|837025_837391_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	99.2	1.3e-61
WP_191980430.1|837471_837633_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	98.1	6.3e-24
WP_003657883.1|837652_840823_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	97.6	0.0e+00
WP_003657887.1|840829_841525_+	hypothetical protein	NA	A0A1B0Y2S2	Lactobacillus_phage	97.0	1.1e-125
WP_020967489.1|841521_845829_+|tail	phage tail protein	tail	A0A0N7IRA4	Lactobacillus_phage	72.0	0.0e+00
WP_020967490.1|845857_846283_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	92.9	1.2e-66
WP_003595102.1|846285_846555_+	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	92.1	4.2e-36
WP_003657893.1|846600_846894_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	90.6	1.5e-42
WP_003657894.1|846883_847312_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	95.2	7.1e-46
WP_020967491.1|847322_848471_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	51.7	2.5e-85
>prophage 3
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	919653	928912	2939026	integrase	Streptococcus_phage(33.33%)	8	912482:912495	929352:929365
912482:912495	attL	AGCAGCTCATTTTA	NA	NA	NA	NA
WP_003564244.1|919653_922545_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003657939.1|922895_923435_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|923597_924485_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|924481_925510_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564251.1|925514_926462_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|926847_927303_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|927419_928010_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003564258.1|928414_928912_-|integrase	tyrosine-type recombinase/integrase	integrase	U5U4L5	Lactobacillus_phage	87.9	2.2e-59
929352:929365	attR	TAAAATGAGCTGCT	NA	NA	NA	NA
>prophage 4
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	983377	1031507	2939026	integrase,capsid,head,holin,tail,terminase,portal	Lactobacillus_phage(85.71%)	70	978140:978154	984772:984786
978140:978154	attL	TGAAAAAGAAACCGC	NA	NA	NA	NA
WP_020967496.1|983377_984598_-|integrase	site-specific integrase	integrase	C5J953	Streptococcus_phage	32.1	5.5e-43
WP_003657988.1|984757_985015_+	hypothetical protein	NA	NA	NA	NA	NA
984772:984786	attR	TGAAAAAGAAACCGC	NA	NA	NA	NA
WP_155242882.1|985004_985889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003657992.1|985960_986164_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	83.6	1.3e-26
WP_003657993.1|986187_986613_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	85.8	5.9e-61
WP_003657995.1|986675_987209_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003657996.1|987368_987734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020967497.1|987827_988178_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	93.1	4.9e-53
WP_003658000.1|988262_988946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658002.1|989002_989425_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	91.3	1.7e-71
WP_003658003.1|989414_989753_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	1.3e-55
WP_003658005.1|989886_990129_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	93.8	1.3e-33
WP_162139270.1|990173_990719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168789.1|990740_991025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162139271.1|991015_991189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658012.1|991276_991435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020967499.1|991497_991971_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003658015.1|991961_992288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168812.1|992650_993058_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	92.6	6.7e-70
WP_020967500.1|993070_993937_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	93.1	1.4e-149
WP_080654123.1|993917_994718_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	94.0	5.1e-146
WP_003658026.1|994730_995648_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	56.9	4.2e-88
WP_003658028.1|995660_996146_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	87.0	4.4e-60
WP_003658030.1|996161_996317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658031.1|996330_996600_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	48.4	1.3e-10
WP_003658033.1|996733_996976_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	56.5	1.8e-14
WP_003658035.1|996972_997422_+	hypothetical protein	NA	Q6J1V3	Lactobacillus_phage	90.6	2.0e-67
WP_003579405.1|997424_997808_+	DUF1064 domain-containing protein	NA	B4XYT1	Lactobacillus_phage	89.0	1.6e-60
WP_003658037.1|997828_998293_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	92.1	1.6e-11
WP_003658041.1|998531_998942_+	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	74.3	1.4e-54
WP_003658043.1|998938_999454_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	58.5	5.4e-40
WP_003658045.1|999440_999647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658047.1|999639_999846_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	98.5	1.5e-33
WP_020967501.1|999842_1000235_+	DUF1642 domain-containing protein	NA	Q8LTB5	Lactobacillus_phage	45.3	7.2e-21
WP_003658051.1|1000237_1000732_+	hypothetical protein	NA	Q8LTB0	Lactobacillus_phage	64.6	5.8e-60
WP_003658053.1|1000728_1001145_+	hypothetical protein	NA	A0A0Y0AFD7	Bacillus_phage	38.3	2.8e-07
WP_003658055.1|1001342_1001615_+	hypothetical protein	NA	D2J038	Enterococcus_phage	32.9	3.8e-05
WP_020967502.1|1002016_1002460_+	autolysin regulatory protein arpU	NA	A0A0P0IDA8	Lactobacillus_phage	93.2	9.8e-75
WP_003658061.1|1002962_1003271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658063.1|1003321_1003639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020967503.1|1004340_1005489_+	phage protein	NA	A0A0P0I3G0	Lactobacillus_phage	95.8	4.6e-217
WP_003658067.1|1005498_1005642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658069.1|1005641_1006226_+|terminase	terminase small subunit	terminase	A0A0P0ID78	Lactobacillus_phage	91.8	1.7e-82
WP_003658071.1|1006209_1007463_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.3	6.1e-247
WP_003658073.1|1007467_1008895_+|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	91.4	1.7e-248
WP_003658074.1|1008860_1009853_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	91.5	1.1e-171
WP_003658075.1|1009977_1010616_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	96.2	4.7e-86
WP_003658077.1|1010628_1010943_+	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	93.3	4.7e-47
WP_003658079.1|1010956_1011976_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	99.1	1.2e-189
WP_003658081.1|1012203_1012578_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	1.4e-58
WP_003658082.1|1012582_1012885_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	89.0	2.0e-47
WP_003658084.1|1012881_1013247_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	96.7	1.2e-57
WP_003658086.1|1013247_1013652_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	99.3	7.8e-71
WP_003658088.1|1013663_1014263_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.9	3.4e-102
WP_003658090.1|1014349_1014685_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	99.1	1.6e-53
WP_003658091.1|1014783_1015137_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	94.0	9.0e-55
WP_003658092.1|1015129_1018459_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	75.5	3.6e-238
WP_041168791.1|1018459_1020526_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	58.6	8.9e-211
WP_020967506.1|1020526_1022962_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	61.9	1.6e-272
WP_020967507.1|1022963_1023254_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	50.0	5.0e-19
WP_020967508.1|1023408_1023795_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	3.3e-66
WP_041168793.1|1023775_1023985_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
WP_020967509.1|1023977_1024424_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	92.6	3.3e-62
WP_020967510.1|1024434_1025733_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	91.0	2.4e-214
WP_041168794.1|1025781_1026381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658471.1|1026396_1026903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658469.1|1026914_1027421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564368.1|1028037_1028232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564370.1|1028301_1028496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564372.1|1028714_1031507_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	6.2e-74
>prophage 5
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	1545479	1633693	2939026	protease,integrase,tRNA,terminase,capsid,head,holin,tail,portal	Lactobacillus_phage(59.57%)	97	1585268:1585283	1624732:1624747
WP_003565730.1|1545479_1545983_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003565731.1|1546306_1546834_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.4	6.5e-25
WP_003565734.1|1546830_1549125_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	5.1e-74
WP_003565736.1|1549399_1549771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565737.1|1550094_1550571_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003565739.1|1550576_1550810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565741.1|1550901_1552740_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.0e-20
WP_003565743.1|1552896_1553805_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003565745.1|1555908_1557072_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.4e-24
WP_003658114.1|1557184_1559059_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.8	7.5e-140
WP_003565749.1|1559088_1559679_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003565751.1|1559855_1560902_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003658112.1|1561064_1562210_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003565755.1|1562211_1563159_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003565758.1|1563165_1564071_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003565760.1|1564082_1564874_-	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	44.7	1.8e-34
WP_003565780.1|1565180_1565534_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003565782.1|1565594_1568426_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	40.0	5.8e-19
WP_003565784.1|1568446_1568746_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_003565786.1|1568748_1569042_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003565788.1|1569053_1570307_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003565790.1|1570323_1570803_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003570427.1|1571057_1575392_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	36.0	1.5e-18
WP_003565796.1|1575458_1577186_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.9	1.8e-07
WP_003565798.1|1577210_1578452_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003565800.1|1578468_1579257_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003570430.1|1579292_1580045_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.2	2.1e-21
WP_003565804.1|1580574_1581132_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003565806.1|1581131_1581851_-	UMP kinase	NA	NA	NA	NA	NA
WP_003565808.1|1582086_1582968_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003565810.1|1583052_1583841_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003565812.1|1584236_1584506_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_020967532.1|1584495_1585230_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
1585268:1585283	attL	GGTATAATTTACCACA	NA	NA	NA	NA
WP_020967533.1|1585875_1587174_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	92.6	1.1e-219
WP_020967534.1|1587184_1587631_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	93.9	1.5e-62
WP_041168793.1|1587623_1587833_-	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
WP_020967508.1|1587813_1588200_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	3.3e-66
WP_020967536.1|1588354_1588645_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	52.2	1.6e-20
WP_020967537.1|1591066_1593079_-|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	76.5	1.6e-297
WP_041168797.1|1593079_1597006_-	tape measure protein	NA	Q6J1X5	Lactobacillus_phage	70.0	5.5e-262
WP_003658477.1|1597002_1597248_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	94.7	5.0e-36
WP_003658479.1|1597210_1597561_-|tail	tail protein	tail	Q6J1X6	Lactobacillus_phage	93.1	2.4e-52
WP_003658481.1|1597718_1598339_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	93.4	4.7e-99
WP_003658483.1|1598350_1598722_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.7	1.3e-59
WP_003658485.1|1598718_1599138_-	HK97 gp10 family phage protein	NA	A8YQJ5	Lactobacillus_phage	87.8	4.5e-61
WP_003658486.1|1599140_1599485_-|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	90.4	2.4e-52
WP_051220599.1|1599474_1599783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658489.1|1599854_1601096_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	53.8	6.3e-111
WP_020967538.1|1601095_1601812_-|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	49.4	8.5e-52
WP_155242886.1|1601789_1602977_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	52.1	6.0e-95
WP_020967539.1|1602976_1603180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658495.1|1603172_1605065_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	68.3	2.1e-259
WP_003658498.1|1605061_1605535_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	49.3	5.1e-37
WP_020967540.1|1605669_1606158_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	44.2	1.0e-32
WP_020967541.1|1606150_1606369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658503.1|1606374_1606539_-	hypothetical protein	NA	A8YQN6	Lactobacillus_phage	75.9	2.4e-10
WP_003658504.1|1606540_1607041_-	hypothetical protein	NA	A0A2D1GPN0	Lactobacillus_phage	90.6	5.2e-08
WP_003658507.1|1607053_1607395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658508.1|1607397_1607721_-	hypothetical protein	NA	A0A0N7IRA2	Lactobacillus_phage	90.7	2.5e-51
WP_003658511.1|1609590_1609809_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003658512.1|1610029_1610215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658513.1|1610362_1610893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658514.1|1611117_1611546_-	DUF1492 domain-containing protein	NA	A0A0P0IJK8	Lactobacillus_phage	96.5	2.3e-73
WP_155242887.1|1612583_1612739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658518.1|1612877_1613255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658519.1|1613300_1613819_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003658521.1|1613818_1614643_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	1.0e-117
WP_003658523.1|1614657_1615407_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.9	4.0e-36
WP_003658526.1|1615399_1615714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658527.1|1615797_1615995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658530.1|1616079_1616436_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.6e-62
WP_003658531.1|1616480_1616687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658532.1|1616706_1617234_-	hypothetical protein	NA	A0A2H4J505	uncultured_Caudovirales_phage	43.4	1.1e-16
WP_020967543.1|1617230_1617503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658534.1|1617516_1618293_-	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	81.8	2.5e-113
WP_003658535.1|1618293_1618539_-	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	1.8e-38
WP_003658536.1|1618794_1619139_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	41.1	1.9e-17
WP_003658537.1|1619131_1619554_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	40.3	9.8e-24
WP_020967544.1|1619614_1620727_+	DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.9	5.4e-21
WP_003658539.1|1620814_1621003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658541.1|1621167_1621449_+	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	54.8	3.2e-23
WP_003658544.1|1621471_1621807_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_155242888.1|1621949_1622387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658549.1|1622361_1622763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658551.1|1622734_1622944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658553.1|1623061_1623325_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.2	3.2e-09
WP_051220603.1|1623383_1624604_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	48.7	1.1e-102
WP_003564783.1|1624775_1625426_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
1624732:1624747	attR	GGTATAATTTACCACA	NA	NA	NA	NA
WP_003570435.1|1625482_1626877_+	amino acid permease	NA	NA	NA	NA	NA
WP_003564777.1|1626907_1627699_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_003564775.1|1627796_1629590_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.1	1.1e-18
WP_003564773.1|1629579_1631337_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.5	1.8e-50
WP_003564771.1|1631478_1631700_-	YneF family protein	NA	NA	NA	NA	NA
WP_003658561.1|1631760_1632006_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003564766.1|1632038_1632215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564764.1|1632441_1632789_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003564762.1|1632925_1633693_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 6
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	2324019	2385630	2939026	bacteriocin,protease	Bacillus_phage(20.0%)	58	NA	NA
WP_003567237.1|2324019_2324859_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567240.1|2324871_2325888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567242.1|2325894_2326269_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567244.1|2326432_2327704_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003567246.1|2328020_2328797_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567248.1|2328814_2329702_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	8.9e-35
WP_003567250.1|2329885_2330782_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567252.1|2330884_2332000_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003567254.1|2332021_2333386_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2333402_2333945_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2334165_2334456_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2334572_2334950_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003571381.1|2335194_2336514_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_003571383.1|2336836_2338183_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003567265.1|2338410_2339511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576229.1|2339507_2340704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2340766_2341645_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2341806_2343861_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_032774271.1|2344017_2346648_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	1.4e-88
WP_003567275.1|2346809_2347433_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003567277.1|2347933_2348605_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003567279.1|2349114_2350236_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2350249_2350534_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003571392.1|2350724_2351840_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2352027_2352234_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2352366_2352624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2352694_2352901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2353125_2353377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2353704_2354937_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567294.1|2355015_2356272_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	1.6e-98
WP_003567296.1|2356360_2357194_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	2.1e-46
WP_003567298.1|2357510_2357705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571396.1|2357958_2358495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567302.1|2358683_2359907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567303.1|2360496_2361324_-	class C sortase	NA	NA	NA	NA	NA
WP_003659562.1|2361330_2362890_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_020967581.1|2362886_2364209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571401.1|2364210_2367216_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003567312.1|2367493_2368051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567314.1|2368145_2369342_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003659566.1|2369550_2370606_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003567322.1|2371621_2371951_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567324.1|2371947_2372736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567326.1|2372788_2373577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2373621_2373900_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567331.1|2373923_2374208_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567333.1|2374400_2374697_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2374798_2376154_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2376459_2376771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2376843_2377194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567343.1|2377367_2378747_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003567347.1|2378757_2380950_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003571414.1|2381415_2381553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567349.1|2381742_2383041_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2383045_2383852_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003659579.1|2384213_2384411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567354.1|2384957_2385197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675994.1|2385456_2385630_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 7
NC_022112	Lactobacillus paracasei subsp. paracasei 8700:2, complete sequence	2939026	2890329	2902825	2939026	integrase,capsid,head,tail,terminase,portal	Lactobacillus_phage(40.0%)	18	2890213:2890232	2904856:2904875
2890213:2890232	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_003658938.1|2890329_2891487_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	4.6e-47
WP_048485949.1|2891652_2892216_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	39.7	1.2e-05
WP_003658943.1|2892360_2892636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003658945.1|2892700_2893120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658947.1|2893103_2893295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658949.1|2893340_2893616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658951.1|2893612_2893801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658953.1|2893784_2894612_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	4.0e-13
WP_003658955.1|2894604_2895996_+	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	34.0	2.4e-42
WP_003658959.1|2896369_2896540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191980428.1|2896615_2896966_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	7.9e-11
WP_003658963.1|2897114_2897585_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	2.4e-07
WP_003658965.1|2897581_2899285_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.0	1.7e-119
WP_003604811.1|2899250_2899430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658967.1|2899434_2900619_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	34.0	1.7e-60
WP_020967604.1|2900605_2902147_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.7	2.5e-40
WP_003658970.1|2902209_2902500_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003577145.1|2902483_2902825_+|head	phage head closure protein	head	A0A249XUQ2	Enterococcus_phage	38.4	4.7e-08
2904856:2904875	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
