The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022350	Mycobacterium tuberculosis str. Haarlem, complete sequence	4408224	2936448	2974720	4408224	protease,capsid,integrase,head,tRNA,terminase	Mycobacterium_phage(33.33%)	46	2965249:2965276	2974873:2974900
WP_003413486.1|2936448_2938527_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2938635_2938863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2938859_2940245_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2940589_2941090_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2941106_2941547_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2941642_2942371_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2942355_2942709_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2942721_2943147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2943143_2943818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2943895_2944717_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2944852_2945746_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2945748_2946567_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2946581_2947763_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2947821_2948253_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2948766_2950008_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2950422_2950680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2951026_2952151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2952152_2952692_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2954168_2954450_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2954594_2955080_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2955106_2955361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2955364_2957701_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2957729_2957972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2957972_2958650_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2958845_2959502_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2959664_2960111_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2960285_2960618_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2960737_2961097_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2961198_2961657_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2961792_2962173_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2962169_2963666_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2963900_2964092_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2965249:2965276	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2965382_2965814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2965810_2966809_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2966822_2967287_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2967274_2967526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2967696_2969136_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2969143_2969677_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2969829_2970321_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2970487_2970811_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2970890_2971136_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2971132_2972560_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2972561_2972954_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2972950_2973211_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2973227_2973590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2973592_2974720_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2974873:2974900	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
