The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014624	Eubacterium callanderi, complete sequence	4316707	1159792	1169537	4316707		Synechococcus_phage(42.86%)	7	NA	NA
WP_013379506.1|1159792_1163506_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.0	9.6e-30
WP_013379507.1|1163524_1164019_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.7	3.1e-29
WP_013379508.1|1164053_1164761_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	43.5	1.6e-47
WP_013379510.1|1164908_1166297_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.3	4.0e-58
WP_013379511.1|1166310_1167339_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	44.7	7.3e-73
WP_013379512.1|1167335_1167956_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	8.2e-27
WP_013379513.1|1168004_1169537_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.4	9.6e-69
>prophage 2
NC_014624	Eubacterium callanderi, complete sequence	4316707	1210243	1297543	4316707	integrase,head,tail,portal,terminase,protease,capsid,holin,lysis	Bacillus_phage(14.81%)	111	1194015:1194046	1228074:1228105
1194015:1194046	attL	TAATGGAAAATTGAGAATGGAAAATGGAAAAT	NA	NA	NA	NA
WP_013379547.1|1210243_1211035_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013379548.1|1211203_1215643_+	chitobiase/beta-hexosaminidase C-terminal domain-containing protein	NA	A0A0C5KL53	Enterococcus_phage	45.5	8.8e-06
WP_013379549.1|1215670_1219036_+	S8 family serine peptidase	NA	A0A127AWU5	Bacillus_phage	33.8	5.5e-16
WP_013379550.1|1219369_1221676_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_013379551.1|1221926_1222838_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	28.0	1.6e-18
WP_013379552.1|1223097_1226373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379553.1|1226382_1226850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379554.1|1226871_1227414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379555.1|1227427_1227967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379556.1|1228136_1228604_+	hypothetical protein	NA	NA	NA	NA	NA
1228074:1228105	attR	ATTTTCCATTTTCCATTCTCAATTTTCCATTA	NA	NA	NA	NA
WP_013379557.1|1228613_1228964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689834.1|1229080_1229629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379559.1|1229751_1230318_+	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_013379560.1|1230314_1230740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379561.1|1230736_1231363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379562.1|1231359_1231560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379563.1|1231568_1232156_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013379565.1|1232296_1232521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379567.1|1232656_1234036_-	recombinase family protein	NA	D2IZV7	Enterococcus_phage	33.4	2.8e-59
WP_123876125.1|1234207_1234858_-	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_013379570.1|1235285_1235660_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WE86	Clostridium_phage	38.1	1.3e-16
WP_013379571.1|1235817_1236018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379572.1|1236034_1236322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379573.1|1236312_1236996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379574.1|1237300_1237438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379575.1|1237440_1237581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013382843.1|1237666_1237810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379578.1|1238237_1238495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379579.1|1238481_1238994_+	siphovirus Gp157 family protein	NA	A8ATE9	Listeria_phage	31.3	4.4e-10
WP_013379580.1|1239002_1239659_+	ATP-binding protein	NA	A0A2I7R7K9	Vibrio_phage	39.1	1.3e-30
WP_013379581.1|1239661_1240180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379582.1|1240195_1240645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379583.1|1240641_1241205_+	DNA primase	NA	NA	NA	NA	NA
WP_013379584.1|1241219_1243103_+	DUF927 domain-containing protein	NA	I3VYX9	Thermoanaerobacterium_phage	30.4	3.8e-51
WP_013379586.1|1243410_1243653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379587.1|1243671_1244220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379588.1|1244222_1244633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379590.1|1244762_1245233_+	methyltransferase	NA	A8ATY8	Listeria_phage	64.9	4.1e-55
WP_013379591.1|1245229_1245541_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_013379592.1|1245537_1245789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379593.1|1245772_1246141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379594.1|1246137_1246365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379596.1|1246545_1246755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379597.1|1246763_1246940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379598.1|1246949_1247330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379599.1|1247412_1247817_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_013379600.1|1247827_1247989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379601.1|1248271_1248721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379602.1|1248835_1249291_+|terminase	P27 family phage terminase small subunit	terminase	A0A0A7RUQ4	Clostridium_phage	51.4	2.0e-30
WP_013379603.1|1249277_1250951_+|terminase	terminase	terminase	A0A2P1CCE7	Lactobacillus_phage	49.4	1.3e-146
WP_123876126.1|1251058_1252255_+|portal	phage portal protein	portal	A0A2P1CD40	Lactobacillus_phage	46.6	7.7e-90
WP_013379605.1|1252232_1252847_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	54.9	1.0e-45
WP_013379606.1|1252839_1254042_+|capsid	phage major capsid protein	capsid	A0A075KJX9	Lactobacillus_phage	42.7	6.8e-78
WP_013379607.1|1254052_1254349_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013379608.1|1254358_1254685_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	36.9	8.7e-12
WP_013379609.1|1254674_1255163_+	hypothetical protein	NA	Q2I8F4	Bacillus_phage	32.3	6.9e-13
WP_013379610.1|1255162_1255507_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013379611.1|1255518_1256106_+	hypothetical protein	NA	A0A1B1P7S4	Bacillus_phage	36.6	1.3e-18
WP_013379612.1|1256118_1256421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379613.1|1256435_1256594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379614.1|1256605_1260547_+|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	38.3	1.2e-46
WP_013379615.1|1260557_1261427_+|tail	phage tail family protein	tail	A0A1P8BL47	Lactococcus_phage	24.1	2.0e-15
WP_013379616.1|1261439_1261688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379617.1|1261684_1262434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379619.1|1262780_1263044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379620.1|1263053_1263743_+	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	32.3	1.3e-09
WP_013379621.1|1263756_1264941_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0C5AMZ5	Paenibacillus_phage	33.5	2.4e-51
WP_013379622.1|1264952_1265912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379623.1|1265921_1266431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379624.1|1266452_1266806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379625.1|1266807_1266957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379626.1|1267014_1267323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379627.1|1267325_1267589_+|holin	phage holin family protein	holin	A0A0A7RW97	Clostridium_phage	51.2	1.2e-14
WP_013379628.1|1267591_1268587_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_013379629.1|1269293_1270268_+	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	28.8	2.1e-21
WP_013379630.1|1270439_1270739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379631.1|1270753_1270912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081474278.1|1271445_1271967_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	58.6	6.4e-49
WP_013379633.1|1272005_1272161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041690113.1|1272394_1272730_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013379635.1|1272831_1273341_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041690115.1|1273335_1273551_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_070081178.1|1273625_1273790_-	YjzC family protein	NA	NA	NA	NA	NA
WP_013379638.1|1273947_1274607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123876041.1|1274931_1276125_+	CoA transferase	NA	NA	NA	NA	NA
WP_013379640.1|1276274_1276565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379641.1|1276740_1276920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379642.1|1277069_1278542_+	alpha-amylase	NA	NA	NA	NA	NA
WP_050814042.1|1278570_1279491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379644.1|1279566_1280019_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_013379645.1|1280094_1280442_+	DsrE family protein	NA	NA	NA	NA	NA
WP_013379647.1|1280587_1280947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379648.1|1281202_1281763_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041690117.1|1281791_1282223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379650.1|1282330_1282630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081474279.1|1282693_1283242_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_013379652.1|1283294_1283963_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_013379653.1|1283973_1284870_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_013379654.1|1284866_1285346_+	dCMP deaminase family protein	NA	V5LNH9	Emiliania_huxleyi_virus	54.5	5.1e-45
WP_013379655.1|1285386_1286037_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_013379656.1|1286186_1287497_+	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_013379657.1|1287481_1288276_+	TIGR03915 family putative DNA repair protein	NA	NA	NA	NA	NA
WP_013379658.1|1288272_1289244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379659.1|1289245_1289692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379660.1|1289910_1291230_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_013379661.1|1291431_1292910_+	M23 family metallopeptidase	NA	C9E2L3	Enterococcus_phage	42.5	3.1e-08
WP_013379662.1|1292970_1293648_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_013379663.1|1293775_1294726_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	33.8	1.0e-36
WP_013379664.1|1294733_1295339_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013379665.1|1295461_1296178_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_013379666.1|1296331_1297543_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
>prophage 3
NC_014624	Eubacterium callanderi, complete sequence	4316707	2126206	2133316	4316707		Staphylococcus_phage(50.0%)	9	NA	NA
WP_013380591.1|2126206_2127460_-	M23 family metallopeptidase	NA	G9BW84	Planktothrix_phage	47.6	2.3e-20
WP_013380592.1|2127712_2128156_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013380593.1|2128296_2128743_+	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	31.8	1.9e-09
WP_013380594.1|2128805_2129285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013380595.1|2129509_2129668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013380596.1|2129896_2130364_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.0	1.4e-42
WP_013380597.1|2130382_2131582_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.2	4.1e-99
WP_013380598.1|2131592_2132231_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.0	4.3e-39
WP_013380599.1|2132212_2133316_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	1.2e-44
>prophage 4
NC_014624	Eubacterium callanderi, complete sequence	4316707	2830189	2913606	4316707	head,integrase,tail,portal,terminase,protease,capsid,holin,tRNA	Clostridium_phage(50.0%)	90	2865243:2865263	2901344:2901364
WP_013381353.1|2830189_2830900_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	NA	NA	NA	NA
WP_013381354.1|2830952_2831639_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	2.9e-41
WP_013381355.1|2831638_2833441_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.3	5.1e-21
WP_013381356.1|2833427_2834576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013381357.1|2834712_2835975_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013381358.1|2836035_2837778_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_013381359.1|2837829_2838786_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_038350663.1|2838782_2842301_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	40.9	2.7e-223
WP_013381362.1|2842521_2843463_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	32.0	8.1e-18
WP_013381363.1|2843514_2844237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381364.1|2844237_2845059_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013381365.1|2845071_2845806_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_013381366.1|2845805_2846516_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_070081142.1|2846636_2848490_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	34.3	4.5e-28
WP_013381368.1|2848695_2850087_-	VanZ family protein	NA	NA	NA	NA	NA
WP_013381369.1|2850271_2850655_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_013381370.1|2850658_2851300_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_013381371.1|2851465_2852458_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_013381373.1|2853010_2854507_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_013381374.1|2854669_2855302_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_013381375.1|2855444_2856932_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013381376.1|2856935_2858210_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013381377.1|2858206_2858566_+	DUF1667 domain-containing protein	NA	NA	NA	NA	NA
WP_013381378.1|2858652_2859285_-	chitobiase/beta-hexosaminidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013381379.1|2859426_2859939_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013381380.1|2859968_2860829_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_013381381.1|2860806_2862105_-	L-aspartate oxidase	NA	M1GXT4	Acanthocystis_turfacea_Chlorella_virus	30.1	1.8e-28
WP_013381382.1|2862119_2863028_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_013381383.1|2863188_2864613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381384.1|2864716_2865130_-	hypothetical protein	NA	NA	NA	NA	NA
2865243:2865263	attL	TTACATATCGAATTTTTTATG	NA	NA	NA	NA
WP_013381385.1|2865466_2866084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381386.1|2866085_2866403_-|holin	SPP1 phage holin family protein	holin	A0A2K9V3E6	Faecalibacterium_phage	35.4	4.8e-07
WP_013381387.1|2866422_2866788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381388.1|2866865_2871878_-|tail	phage tail protein	tail	H7BVF2	unidentified_phage	47.4	8.8e-79
WP_013381389.1|2871902_2872295_-	hypothetical protein	NA	M9Q2L1	Clostridium_phage	22.2	2.5e-05
WP_013381390.1|2872294_2872555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381391.1|2872574_2873300_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013381392.1|2873300_2876807_-|tail	phage tail tape measure protein	tail	A0A068A2C9	Staphylococcus_phage	45.1	3.3e-80
WP_013381393.1|2876796_2877120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381394.1|2877197_2877539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381395.1|2877548_2878457_-	hypothetical protein	NA	A0A0A8WJB7	Clostridium_phage	51.1	1.8e-14
WP_013381396.1|2878456_2878819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381397.1|2878811_2879303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050814113.1|2879302_2879602_-|head	phage head closure protein	head	I2E8V6	Clostridium_phage	41.9	3.6e-12
WP_013381399.1|2879613_2879904_-|head,tail	phage head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	37.3	3.4e-07
WP_013381400.1|2879915_2881328_-|capsid	phage major capsid protein	capsid	Q8SBP8	Clostridium_phage	35.7	1.2e-41
WP_013381401.1|2881337_2881988_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	46.1	4.4e-39
WP_013381402.1|2881974_2883234_-|portal	phage portal protein	portal	I2E8V3	Clostridium_phage	45.0	1.5e-83
WP_013381403.1|2883236_2883422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381404.1|2883426_2885052_-|terminase	terminase	terminase	I2E8V1	Clostridium_phage	57.8	2.3e-177
WP_013381405.1|2885041_2885425_-|terminase	phage terminase small subunit P27 family	terminase	I2E8V0	Clostridium_phage	48.8	2.3e-24
WP_013381406.1|2885509_2885962_-	hypothetical protein	NA	I2E8Y8	Clostridium_phage	44.8	7.3e-17
WP_013381407.1|2886207_2886624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381409.1|2887003_2887201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381410.1|2887193_2887436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381412.1|2887781_2888396_-	AP2 domain-containing protein	NA	NA	NA	NA	NA
WP_013381413.1|2888392_2888860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381414.1|2889070_2889667_-	Holliday junction resolvase RecU	NA	A0A2K9V2V4	Faecalibacterium_phage	45.5	8.1e-40
WP_013381415.1|2889647_2889866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381416.1|2889868_2890039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381417.1|2890035_2890824_-	DNA cytosine methyltransferase	NA	A0A0C5ABP5	Bacteriophage	44.4	2.5e-52
WP_013381418.1|2890831_2891530_-	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	44.7	6.3e-52
WP_013381419.1|2891546_2891921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381420.1|2891936_2892656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381422.1|2892958_2893204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381423.1|2893193_2893412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689903.1|2893741_2894068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381426.1|2894081_2894417_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_013381427.1|2894428_2894914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381428.1|2894919_2895681_-	antA/AntB antirepressor family protein	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	32.4	1.7e-21
WP_013381430.1|2896120_2896498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013381432.1|2896584_2896749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381433.1|2896887_2897262_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WEL4	Clostridium_phage	50.8	2.9e-11
WP_013381435.1|2897600_2898986_+	3'-5' exoribonuclease	NA	A0A0A7RWA3	Clostridium_phage	32.2	1.5e-33
WP_013381436.1|2899059_2899218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013381437.1|2899301_2899499_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	63.9	1.0e-15
WP_013381438.1|2899538_2899943_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A090DBV2	Clostridium_phage	52.7	1.9e-37
WP_013381439.1|2900093_2901254_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	27.2	2.3e-22
WP_013381440.1|2901343_2902552_-	aspartate kinase	NA	NA	NA	NA	NA
2901344:2901364	attR	TTACATATCGAATTTTTTATG	NA	NA	NA	NA
WP_013381441.1|2902584_2903829_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_013381442.1|2903936_2905439_+	threonine synthase	NA	NA	NA	NA	NA
WP_013381443.1|2905454_2906348_+	homoserine kinase	NA	NA	NA	NA	NA
WP_013381444.1|2906358_2906793_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_013381445.1|2906795_2907164_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_013381446.1|2907262_2908645_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_013381447.1|2908701_2908857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689904.1|2908867_2910067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381449.1|2910082_2911462_-	MFS transporter	NA	NA	NA	NA	NA
WP_013381452.1|2911794_2912466_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013381453.1|2912526_2913606_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NC_014624	Eubacterium callanderi, complete sequence	4316707	2930889	2949643	4316707	head,tail,portal,terminase,protease,capsid,holin	Paenibacillus_phage(23.08%)	25	NA	NA
WP_013379627.1|2930889_2931153_-|holin	phage holin family protein	holin	A0A0A7RW97	Clostridium_phage	51.2	1.2e-14
WP_013379626.1|2931155_2931464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379625.1|2931521_2931671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379624.1|2931672_2932026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379623.1|2932047_2932557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379622.1|2932566_2933526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379621.1|2933537_2934722_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0C5AMZ5	Paenibacillus_phage	33.5	2.4e-51
WP_013379620.1|2934735_2935425_-	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	32.3	1.3e-09
WP_013379619.1|2935434_2935698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379617.1|2936044_2936794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379616.1|2936790_2937039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379615.1|2937051_2937921_-|tail	phage tail family protein	tail	A0A1P8BL47	Lactococcus_phage	24.1	2.0e-15
WP_013379614.1|2937931_2941873_-|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	38.3	1.2e-46
WP_013379613.1|2941884_2942043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379612.1|2942057_2942360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379611.1|2942372_2942960_-	hypothetical protein	NA	A0A1B1P7S4	Bacillus_phage	36.6	1.3e-18
WP_013379610.1|2942971_2943316_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013379609.1|2943315_2943804_-	hypothetical protein	NA	Q2I8F4	Bacillus_phage	32.3	6.9e-13
WP_013379608.1|2943793_2944120_-|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	36.9	8.7e-12
WP_013379607.1|2944129_2944426_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013379606.1|2944436_2945639_-|capsid	phage major capsid protein	capsid	A0A075KJX9	Lactobacillus_phage	42.7	6.8e-78
WP_013379605.1|2945631_2946246_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	54.9	1.0e-45
WP_123876126.1|2946223_2947420_-|portal	phage portal protein	portal	A0A2P1CD40	Lactobacillus_phage	46.6	7.7e-90
WP_013379603.1|2947527_2949201_-|terminase	terminase	terminase	A0A2P1CCE7	Lactobacillus_phage	49.4	1.3e-146
WP_013379602.1|2949187_2949643_-|terminase	P27 family phage terminase small subunit	terminase	A0A0A7RUQ4	Clostridium_phage	51.4	2.0e-30
>prophage 6
NC_014624	Eubacterium callanderi, complete sequence	4316707	2970673	3008132	4316707	integrase,tail,portal,terminase,capsid,holin	Clostridium_phage(45.0%)	50	2979498:2979513	3008708:3008723
WP_013379627.1|2970673_2970937_-|holin	phage holin family protein	holin	A0A0A7RW97	Clostridium_phage	51.2	1.2e-14
WP_013379626.1|2970939_2971248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379625.1|2971305_2971455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379624.1|2971456_2971810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013379623.1|2971831_2972341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050814072.1|2972350_2973319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381475.1|2973330_2974515_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	34.5	5.2e-54
WP_013381476.1|2974527_2975187_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	28.0	3.7e-09
WP_013381477.1|2975199_2976060_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013381478.1|2976052_2979622_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1X9IGH8	Lactococcus_phage	43.9	1.2e-24
2979498:2979513	attL	GCGCCTTTGGCACTGC	NA	NA	NA	NA
WP_013381479.1|2979885_2980401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381480.1|2980440_2981055_-	bacteriophage Gp15 family protein	NA	A0A0A8WHV7	Clostridium_phage	40.3	2.4e-34
WP_013381481.1|2981051_2981438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381482.1|2981462_2981699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381483.1|2981740_2982229_-	hypothetical protein	NA	A0A0A8WE72	Clostridium_phage	59.1	3.2e-50
WP_013381484.1|2982241_2982703_-	hypothetical protein	NA	A0A0A8WJ92	Clostridium_phage	48.2	9.1e-31
WP_123876081.1|2982699_2982900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381486.1|2982951_2983224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013381487.1|2983178_2983490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381488.1|2983486_2983855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381489.1|2983870_2984899_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	26.5	2.0e-25
WP_013381490.1|2984911_2985526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123876082.1|2985661_2986081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381493.1|2986201_2986387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381494.1|2986376_2987957_-|capsid	phage minor capsid protein	capsid	A0A1J1J8Z3	Escherichia_phage	47.7	7.3e-104
WP_013381495.1|2987956_2989597_-|portal	phage portal protein	portal	F6K8Q7	Clostridium_phage	54.3	6.1e-138
WP_013381496.1|2989608_2990934_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J4X1	uncultured_Caudovirales_phage	65.7	9.8e-171
WP_081474283.1|2990923_2991661_-|terminase	terminase small subunit	terminase	A0A0A7RTY1	Clostridium_phage	37.7	7.2e-38
WP_013381498.1|2991837_2992197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381499.1|2992200_2992566_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_013381500.1|2992562_2992808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381501.1|2992800_2993352_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_013381502.1|2993681_2996363_-	DUF927 domain-containing protein	NA	A0A173H0P8	Pseudoalteromonas_phage	43.8	3.3e-24
WP_013381503.1|2996376_2997132_-	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	41.5	5.4e-41
WP_013381504.1|2997148_2997565_-	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	29.5	1.7e-12
WP_085948309.1|2997561_2999208_-	DEAD/DEAH box helicase	NA	I3VYY6	Thermoanaerobacterium_phage	48.0	6.4e-127
WP_013381506.1|2999266_2999593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381507.1|2999582_2999783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381508.1|2999872_3000601_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	43.2	1.6e-45
WP_013381509.1|3000600_3000927_-	hypothetical protein	NA	M1I9V9	Streptococcus_phage	46.9	1.9e-14
WP_013381511.1|3001283_3001457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381512.1|3001453_3001633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381514.1|3001733_3001949_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013379573.1|3002256_3002940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013379572.1|3002930_3003218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381515.1|3003234_3003435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013381516.1|3003596_3003974_+	helix-turn-helix transcriptional regulator	NA	Q0SPH9	Clostridium_phage	41.5	7.4e-15
WP_013381518.1|3004285_3005956_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013381519.1|3005966_3006836_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_013381520.1|3006992_3008132_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	26.6	2.7e-28
3008708:3008723	attR	GCAGTGCCAAAGGCGC	NA	NA	NA	NA
>prophage 7
NC_014624	Eubacterium callanderi, complete sequence	4316707	3502648	3509930	4316707		Bacillus_phage(28.57%)	10	NA	NA
WP_013382014.1|3502648_3503320_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	5.7e-34
WP_158308599.1|3503419_3504466_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	1.4e-26
WP_013382016.1|3504458_3505139_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	2.4e-27
WP_013382017.1|3505343_3506201_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013382018.1|3506331_3506787_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.8	3.1e-15
WP_013382019.1|3506852_3507203_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_013382020.1|3507357_3507675_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.5	5.5e-19
WP_013382021.1|3507712_3509077_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	45.5	2.2e-104
WP_013382022.1|3509097_3509514_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_123876154.1|3509519_3509930_-	rhodanese-like domain-containing protein	NA	A0A2P0VMZ4	Tetraselmis_virus	32.7	2.0e-05
