The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	307719	317391	4024986		Streptococcus_phage(25.0%)	9	NA	NA
WP_013356907.1|307719_308832_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	5.6e-111
WP_013356908.1|309071_310175_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.7e-59
WP_013356909.1|310185_311439_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.1	1.5e-91
WP_013356910.1|311799_312531_+	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	37.5	4.9e-47
WP_013356911.1|313436_313904_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	45.3	1.0e-26
WP_013356912.1|313900_314248_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	44.7	2.4e-20
WP_013356913.1|314244_314538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013356914.1|314742_316497_+	phage-like EPS depolymerase	NA	A0A1S6L3G8	Erwinia_phage	46.4	6.1e-152
WP_003854408.1|317178_317391_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	9.3e-23
>prophage 2
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	379077	386802	4024986	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_013356969.1|379077_380226_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	2.5e-90
WP_009091760.1|380225_380558_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	5.7e-11
WP_013356970.1|380583_382431_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013356971.1|382441_383410_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.3	2.1e-45
WP_013356972.1|383469_384048_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_013356973.1|384064_384502_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	51.9	2.5e-06
WP_009091750.1|384688_385138_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_013356974.1|385141_386242_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	2.0e-47
WP_013356975.1|386331_386802_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	2.7e-30
>prophage 3
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	985496	1025650	4024986	head,integrase,tRNA,holin,bacteriocin	Salmonella_phage(20.0%)	44	1008852:1008865	1025927:1025940
WP_013357493.1|985496_986609_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003849831.1|986651_987125_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_041456761.1|987169_987832_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_013357495.1|987936_989187_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	85.2	2.2e-18
WP_148235569.1|989321_989924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013357496.1|989970_991116_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	73.0	1.8e-152
WP_041456763.1|991090_991342_-	excisionase	NA	NA	NA	NA	NA
WP_013357497.1|991367_992093_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	29.9	4.5e-08
WP_049788862.1|992092_992530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041456764.1|993022_993658_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	32.1	4.9e-19
WP_071822173.1|993756_993981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013357498.1|993973_994462_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.8	3.9e-64
WP_071822174.1|994711_994909_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_013357499.1|994898_995846_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	60.9	2.0e-85
WP_013357500.1|995858_997199_+	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	69.1	1.8e-79
WP_013357501.1|997922_998909_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_013357502.1|998916_1000251_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041456768.1|1000580_1001150_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	41.0	1.0e-28
WP_148235584.1|1001280_1002306_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.9	1.5e-158
WP_013357504.1|1002340_1002727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148235585.1|1002720_1003020_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013357506.1|1003012_1003480_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	39.9	2.7e-22
WP_013357507.1|1003479_1003734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148235570.1|1003982_1004501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041456776.1|1004668_1004920_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_041456778.1|1005020_1005335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041456779.1|1005368_1005800_+	hypothetical protein	NA	G0YQ33	Erwinia_phage	46.4	3.8e-15
WP_013357509.1|1006060_1006690_+	hypothetical protein	NA	F1C5D5	Cronobacter_phage	72.7	1.9e-84
WP_013357510.1|1006721_1007180_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	70.4	9.5e-57
WP_013357512.1|1008205_1009153_+	hypothetical protein	NA	G0ZND5	Cronobacter_phage	79.0	1.3e-135
1008852:1008865	attL	ACAGTCGCTGTCAG	NA	NA	NA	NA
WP_041456782.1|1009133_1010096_+|head	SPP1 gp7 family phage head morphogenesis protein	head	I6S615	Salmonella_phage	62.5	1.1e-99
WP_041456784.1|1010252_1010621_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	56.6	5.3e-34
WP_013357515.1|1010617_1011001_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	66.1	1.4e-45
WP_013357516.1|1011061_1012342_+	hypothetical protein	NA	A0A291AXC5	Shigella_phage	55.4	7.0e-65
WP_013357517.1|1012397_1014830_+	hypothetical protein	NA	I3PGW2	Xanthomonas_phage	36.2	3.6e-86
WP_049788863.1|1014830_1015124_+	hypothetical protein	NA	A0A191ZCU4	Erwinia_phage	55.8	8.6e-19
WP_013357518.1|1015573_1015762_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_148235586.1|1017303_1018305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041456786.1|1018570_1019551_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_041456787.1|1019929_1020367_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013357521.1|1020484_1021354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033786031.1|1022007_1022247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010260799.1|1022547_1023531_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013199813.1|1023532_1025650_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1025927:1025940	attR	CTGACAGCGACTGT	NA	NA	NA	NA
>prophage 4
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	1202630	1212855	4024986	tRNA	Tupanvirus(14.29%)	12	NA	NA
WP_013357680.1|1202630_1204559_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.8e-126
WP_033732471.1|1204562_1205114_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	1.7e-15
WP_004157374.1|1205213_1205411_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003853267.1|1205455_1205812_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_106120997.1|1205934_1205979_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_013357682.1|1206126_1207110_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.9e-34
WP_013357683.1|1207124_1209512_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	32.0	5.4e-10
WP_003853259.1|1209516_1209819_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.3e-13
WP_013357684.1|1209998_1210982_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_013357685.1|1211032_1211578_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	37.4	7.7e-13
WP_013357686.1|1211578_1212328_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
WP_013357687.1|1212396_1212855_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	37.5	5.5e-12
>prophage 5
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	1659627	1783090	4024986	terminase,tail,protease,portal,integrase,tRNA,plate,holin,lysis	Erwinia_phage(24.07%)	129	1706015:1706032	1788289:1788306
WP_013358085.1|1659627_1660326_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_013358086.1|1660370_1662287_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.4e-85
WP_013358087.1|1662536_1663274_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_013358089.1|1663918_1664086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013358090.1|1664427_1664787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013358091.1|1664863_1665208_+	RidA family protein	NA	NA	NA	NA	NA
WP_013358092.1|1665220_1665415_-	YoaH family protein	NA	NA	NA	NA	NA
WP_013358093.1|1665525_1666905_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	31.5	2.0e-41
WP_013358094.1|1666888_1667452_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_013358095.1|1667638_1669003_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_013358096.1|1669228_1670791_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_013358097.1|1670927_1672520_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	8.2e-39
WP_013358100.1|1673029_1673992_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_033733019.1|1674055_1674856_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_013358102.1|1674871_1675717_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_013358103.1|1675808_1676267_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_013358104.1|1676263_1677073_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_003852684.1|1677210_1677420_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.6	5.9e-22
WP_013358105.1|1678068_1679073_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013358106.1|1679091_1679364_-	YebO family protein	NA	NA	NA	NA	NA
WP_013358107.1|1679576_1679813_+	membrane protein	NA	NA	NA	NA	NA
WP_013358108.1|1679843_1680635_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_013358109.1|1680820_1682191_+	MFS transporter	NA	NA	NA	NA	NA
WP_003852678.1|1682531_1683413_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_013358110.1|1683657_1685697_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.7	9.4e-88
WP_013358111.1|1685716_1686418_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013358112.1|1686514_1687015_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_013358113.1|1687229_1688474_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013358114.1|1688442_1691076_+	PqiB family protein	NA	NA	NA	NA	NA
WP_193372122.1|1691118_1692585_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_013358116.1|1692586_1693234_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	49.5	2.7e-57
WP_033783299.1|1693466_1693715_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_013358118.1|1693864_1695223_-	MFS transporter	NA	NA	NA	NA	NA
WP_013358119.1|1695357_1697388_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.2	4.4e-21
WP_013358120.1|1697644_1698238_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_013358121.1|1698252_1699725_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013358122.1|1699748_1701431_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.5	9.3e-57
WP_013358123.1|1701859_1702210_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_013358124.1|1702196_1702526_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_013358125.1|1702726_1703869_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	31.4	1.6e-36
WP_013358126.1|1704027_1704288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013358127.1|1704404_1704590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013358128.1|1704686_1704824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013358129.1|1705039_1706062_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.7e-25
1706015:1706032	attL	CTCAACCACTTCAACCTG	NA	NA	NA	NA
WP_013358130.1|1706351_1706636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193372133.1|1707574_1708039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041457224.1|1708561_1709380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158307098.1|1709790_1710105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013358131.1|1710133_1711168_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	90.4	7.9e-184
WP_013358132.1|1711167_1712931_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	96.3	0.0e+00
WP_013358135.1|1714024_1714447_+	hypothetical protein	NA	F1BUQ1	Erwinia_phage	70.3	1.6e-45
WP_013358136.1|1714548_1715016_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	76.3	5.5e-60
WP_013358137.1|1715012_1715459_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	66.4	6.9e-44
WP_013358138.1|1715567_1717127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148235573.1|1717092_1717491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013358139.1|1717570_1718155_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	82.0	3.0e-87
WP_013358140.1|1718151_1718502_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	75.9	4.1e-44
WP_013358141.1|1718506_1719415_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	84.8	1.6e-135
WP_013358142.1|1719407_1720016_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	81.7	1.2e-94
WP_013358143.1|1720012_1721059_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	65.5	2.1e-123
WP_013358144.1|1721058_1721649_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	44.2	3.4e-38
WP_013358145.1|1721702_1722143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041456897.1|1722160_1722694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013358147.1|1722998_1724168_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	89.2	1.9e-197
WP_193372128.1|1724624_1725188_+	recombinase RecT	NA	E5AGD9	Erwinia_phage	69.3	2.7e-61
WP_013358149.1|1725541_1725823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041456899.1|1726001_1726466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041456900.1|1726493_1726739_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	95.0	2.0e-37
WP_013358151.1|1726735_1727053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041457228.1|1727087_1727300_+	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	81.4	3.9e-29
WP_081463845.1|1727656_1728481_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	96.0	1.2e-131
WP_013358153.1|1728789_1729137_-	YebY family protein	NA	NA	NA	NA	NA
WP_013358154.1|1729165_1730041_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_041456903.1|1730045_1730423_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_033733020.1|1730573_1730807_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.1e-15
WP_033783311.1|1730806_1731475_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_013358157.1|1731468_1733532_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_013358158.1|1733658_1734315_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_013358159.1|1734481_1735660_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_010258674.1|1735694_1736333_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_013358160.1|1736547_1738023_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.8	1.2e-76
WP_013358161.1|1738386_1739313_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013358162.1|1739373_1740816_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_013358163.1|1740901_1742134_+	MFS transporter	NA	NA	NA	NA	NA
WP_013358165.1|1742485_1743460_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_013358166.1|1743585_1744917_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.0	6.3e-16
WP_013358167.1|1744930_1745878_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_013358168.1|1745955_1746711_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	9.7e-14
WP_013358169.1|1746707_1747493_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_013358170.1|1747493_1748498_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
WP_013358173.1|1749216_1749744_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	3.8e-09
WP_013358174.1|1749781_1750525_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013358175.1|1750810_1751242_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_013358176.1|1751241_1753020_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.4	2.8e-11
WP_013358178.1|1753231_1754053_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	72.4	5.3e-50
WP_013358179.1|1754122_1754518_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_041456908.1|1754599_1755328_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_013358181.1|1755324_1756293_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_013358182.1|1756297_1756921_-	LysE family translocator	NA	NA	NA	NA	NA
WP_013358183.1|1757065_1758163_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_013358184.1|1758193_1759042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013358185.1|1759353_1760376_-	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
WP_041457231.1|1760396_1761119_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.2	3.2e-38
WP_041456910.1|1761121_1761778_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_013358188.1|1761829_1762582_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_013358189.1|1762710_1763265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013358190.1|1763261_1764590_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_013358191.1|1764718_1765576_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013358192.1|1765950_1766475_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	31.3	5.9e-18
WP_013358193.1|1766471_1767878_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	55.3	8.7e-16
WP_071822184.1|1767879_1768452_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	46.5	9.5e-46
WP_013358194.1|1768448_1769651_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	64.8	4.5e-138
WP_013358195.1|1769650_1770004_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	1.3e-50
WP_013358196.1|1770000_1770657_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	55.5	6.3e-70
WP_013358197.1|1770908_1771958_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	59.0	9.7e-113
WP_041456913.1|1771963_1772269_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	59.4	8.9e-27
WP_013358199.1|1772293_1772842_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.1	6.3e-55
WP_013358200.1|1772841_1774908_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	58.2	8.3e-225
WP_013358201.1|1774897_1775050_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	78.0	1.0e-15
WP_013358202.1|1775085_1775547_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	60.3	9.7e-41
WP_013358203.1|1775549_1775990_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	76.0	1.3e-58
WP_013358204.1|1776000_1777146_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.7	2.2e-166
WP_013358205.1|1777149_1777686_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	45.1	3.1e-38
WP_041456915.1|1778393_1778852_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	56.9	2.1e-35
WP_013358207.1|1778848_1779388_-	lysozyme	NA	H9C184	Pectobacterium_phage	73.8	3.5e-74
WP_135908398.1|1779390_1779732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013358209.1|1780641_1781175_-	antitermination protein Q	NA	U5P0A5	Shigella_phage	62.5	2.5e-40
WP_041456919.1|1781725_1782160_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013358211.1|1782172_1783090_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	61.3	2.4e-35
1788289:1788306	attR	CTCAACCACTTCAACCTG	NA	NA	NA	NA
>prophage 6
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	2598165	2606182	4024986	integrase	uncultured_Mediterranean_phage(33.33%)	6	2589343:2589356	2611231:2611244
2589343:2589356	attL	CAATAATGAATTTA	NA	NA	NA	NA
WP_013358858.1|2598165_2599635_-|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	27.3	6.2e-25
WP_013358859.1|2599792_2602354_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.6	6.2e-28
WP_009086923.1|2602487_2603480_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.6e-32
WP_013358860.1|2603537_2604638_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	1.8e-05
WP_013358862.1|2604800_2605427_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.1	9.7e-36
WP_013358863.1|2605420_2606182_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	1.1e-65
2611231:2611244	attR	CAATAATGAATTTA	NA	NA	NA	NA
>prophage 7
NC_014562	Pantoea vagans C9-1, complete sequence	4024986	2803961	2915471	4024986	tail,capsid,head,integrase,portal,tRNA,plate,holin,lysis,coat	Salmonella_phage(52.38%)	109	2856175:2856226	2878951:2879002
WP_013359030.1|2803961_2804531_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013359031.1|2804553_2805069_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013359032.1|2805094_2805790_+	molecular chaperone	NA	NA	NA	NA	NA
WP_013359033.1|2805797_2808245_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_179291187.1|2808244_2809219_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013359035.1|2809215_2810538_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.7	4.1e-60
WP_013359036.1|2810774_2811197_-	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_013359037.1|2811203_2811926_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_013359038.1|2812275_2813247_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013359039.1|2813296_2813803_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_013359040.1|2813817_2815104_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_013359041.1|2815237_2816428_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_033733897.1|2816603_2817266_+	DedA family protein	NA	NA	NA	NA	NA
WP_013359043.1|2817296_2818205_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013359044.1|2818408_2819233_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	2.3e-61
WP_013359045.1|2819307_2820738_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_013359046.1|2820880_2821618_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_013359047.1|2821663_2823937_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.8e-86
WP_013359048.1|2824129_2824894_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013359049.1|2825061_2825643_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013359050.1|2825691_2826000_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013359051.1|2826375_2827275_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033784060.1|2827368_2829264_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	2.6e-92
WP_013359053.1|2829313_2829895_-	esterase YqiA	NA	NA	NA	NA	NA
WP_013359054.1|2829898_2830726_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_008925735.1|2830768_2831194_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_013359055.1|2831190_2831802_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_013359056.1|2832040_2833507_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_013359057.1|2833648_2834320_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.1	1.3e-41
WP_013359058.1|2834327_2835488_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	3.6e-84
WP_013359059.1|2835541_2836327_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_013359061.1|2836563_2837220_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.6	1.1e-42
WP_013359062.1|2837659_2838049_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_013359063.1|2838087_2839512_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.1	1.8e-37
WP_013359064.1|2839582_2842435_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_013359065.1|2842468_2843779_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_008925741.1|2844052_2844673_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_041457092.1|2844831_2846064_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	44.6	7.2e-83
WP_013359067.1|2846079_2846898_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_013359068.1|2847089_2847449_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_003848436.1|2847557_2848163_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_013359069.1|2848389_2849403_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	5.9e-107
WP_001144069.1|2849680_2849896_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013359070.1|2850014_2851760_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.6	1.4e-71
WP_013359071.1|2851991_2853833_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_013359072.1|2853913_2854432_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_041457094.1|2854428_2855013_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013359074.1|2855151_2855943_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
2856175:2856226	attL	GACTCATAATCGCTTGGTCGCTGGTTCAAACCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
WP_071822196.1|2856366_2856585_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	65.7	6.8e-21
WP_013359077.1|2857742_2858228_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	73.6	8.3e-59
WP_009086867.1|2861365_2861485_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	76.9	1.7e-10
WP_013359080.1|2861499_2861808_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	70.6	1.8e-30
WP_013359081.1|2861862_2862378_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	84.8	2.4e-80
WP_013359082.1|2862390_2863560_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	87.9	7.1e-197
WP_013359083.1|2863605_2864229_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	75.1	1.1e-71
WP_013359085.1|2864930_2865323_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.3	6.1e-12
WP_013359086.1|2866209_2868477_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_013359087.1|2868676_2869084_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	49.6	2.0e-26
WP_013359089.1|2869790_2870147_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	66.7	1.5e-41
WP_013359090.1|2870143_2870722_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	64.4	7.1e-65
WP_013359091.1|2870798_2871245_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	64.3	6.9e-44
WP_013359092.1|2871237_2871669_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	75.7	2.0e-56
WP_013359093.1|2871764_2872193_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	54.6	9.0e-33
WP_041457100.1|2872189_2872564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013359095.1|2872565_2873075_-	lysozyme	NA	E5G6N1	Salmonella_phage	78.0	4.7e-73
WP_013359096.1|2873055_2873268_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	60.3	3.1e-18
WP_013359097.1|2873271_2873475_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	82.1	5.4e-28
WP_013359098.1|2873474_2873939_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	70.8	1.2e-59
WP_158307100.1|2874038_2874278_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	64.6	3.7e-20
WP_013359099.1|2874223_2875225_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	66.4	7.8e-112
WP_013359101.1|2875530_2875758_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	54.7	1.1e-13
WP_041457102.1|2875827_2876166_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.9	4.8e-29
WP_071822197.1|2876129_2876318_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	62.5	6.1e-10
WP_013359103.1|2876321_2876831_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	65.5	2.0e-55
WP_041457104.1|2876865_2877102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049788878.1|2877192_2877813_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	37.7	3.0e-37
WP_013359104.1|2877817_2878831_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.0	3.4e-115
WP_148235577.1|2879655_2880132_+	hypothetical protein	NA	NA	NA	NA	NA
2878951:2879002	attR	GACTCATAATCGCTTGGTCGCTGGTTCAAACCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
WP_013359106.1|2880729_2881761_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	79.2	4.7e-160
WP_041457266.1|2881810_2883208_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_013359108.1|2883430_2884225_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	31.1	6.0e-22
WP_022549167.1|2884228_2884426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041457107.1|2884682_2884868_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	62.7	1.1e-08
WP_013359111.1|2886595_2887900_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_013359112.1|2888160_2889258_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_013359113.1|2889278_2890700_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_013359114.1|2890969_2892445_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_041457109.1|2892441_2893077_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_041457110.1|2893656_2894466_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_013359117.1|2894572_2895280_+	polyphenol oxidase family protein	NA	NA	NA	NA	NA
WP_013359118.1|2895490_2897509_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_013359119.1|2897509_2898628_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_013359120.1|2898711_2899215_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_013359121.1|2899211_2900900_-	chloride channel protein	NA	NA	NA	NA	NA
WP_013359122.1|2901046_2902033_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013359123.1|2902288_2903257_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	35.2	3.1e-33
WP_033784084.1|2903492_2904725_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_041457112.1|2905066_2905375_-	CcdB family protein	NA	NA	NA	NA	NA
WP_013359125.1|2905374_2905614_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_013359126.1|2905892_2907383_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_013359127.1|2907387_2908836_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_013359128.1|2908838_2910254_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_013359129.1|2910654_2911959_+	MFS transporter	NA	NA	NA	NA	NA
WP_013359130.1|2912045_2912822_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_003850219.1|2913145_2913820_+	DedA family protein	NA	NA	NA	NA	NA
WP_013359131.1|2913819_2914167_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_041457268.1|2914357_2914732_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_033733985.1|2914767_2915073_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_041457113.1|2915075_2915471_+|holin	phage holin family protein	holin	NA	NA	NA	NA
