The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017632	Escherichia coli UM146, complete sequence	4993013	618056	625775	4993013		Escherichia_phage(83.33%)	6	NA	NA
WP_001279003.1|618056_618695_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590420.1|618691_619954_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|619950_620859_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001296319.1|621054_621822_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001555984.1|622883_623108_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	5.8e-07
WP_000103864.1|623213_625775_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
>prophage 2
NC_017632	Escherichia coli UM146, complete sequence	4993013	701303	783367	4993013	tail,tRNA,plate,protease,capsid,lysis,terminase,head,portal	Shigella_phage(43.75%)	84	NA	NA
WP_000531794.1|701303_702476_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
WP_001331174.1|702436_702643_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000008234.1|703658_704183_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_000081287.1|704310_705135_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135691.1|705200_705563_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000500990.1|706031_706544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|706746_707421_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|707511_707712_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|707755_708307_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|708482_708662_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001332382.1|709588_710083_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_001332383.1|710082_710736_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_000210172.1|710732_711059_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767113.1|711055_711445_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061411.1|711464_712262_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_001350764.1|712269_713259_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001047143.1|713272_714025_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_000606308.1|714210_714546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180490.1|714990_715467_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000092331.1|715463_715901_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001332386.1|715971_716223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135216.1|716871_717222_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_072011717.1|718073_719570_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605604.1|719581_719764_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466267.1|719763_721005_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_001193631.1|720982_721633_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|721647_722853_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601360.1|722902_723103_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|723105_723429_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702385.1|723425_723836_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000213503.1|723810_724317_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000779291.1|724313_724874_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000497751.1|724882_725053_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155718.1|725036_726533_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000090998.1|726532_726889_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661051.1|726888_727158_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000807182.1|727299_729135_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_001350765.1|729195_730524_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000999498.1|730520_731600_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_000103707.1|731599_732148_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000424731.1|732147_732573_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000785328.1|732559_733618_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000539246.1|733608_734193_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000356380.1|734940_735543_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_001089535.1|735514_735958_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_024179269.1|735960_736410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834403.1|736690_738598_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000353910.1|739649_740423_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000174562.1|740633_740927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183405.1|741014_741803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|742959_743442_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|743573_744050_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|744039_744330_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|744391_744733_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880938.1|744881_746543_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|746628_747507_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001332400.1|747629_748223_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077634785.1|748277_749564_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|749584_750376_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|750542_751904_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|752040_752289_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|752307_752856_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|752886_753654_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|753695_754043_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589793.1|754119_754602_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969016.1|754617_755844_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|755833_756352_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|756498_756864_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168025.1|757073_758144_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225230.1|758154_759276_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200106.1|759318_760479_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|760577_760625_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178456.1|760728_761070_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|761339_762077_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079114.1|762211_763192_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040118.1|763188_763920_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001350770.1|764049_766623_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_001298619.1|775111_776410_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001370843.1|776406_776730_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|776775_778131_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082937.1|778244_780905_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298618.1|780936_781635_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|781703_782123_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997387.1|782329_783367_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NC_017632	Escherichia coli UM146, complete sequence	4993013	1004642	1046125	4993013	tail,protease,lysis,holin,terminase,head,coat,integrase,portal	Enterobacteria_phage(96.61%)	60	1013873:1013889	1058202:1058218
WP_001163428.1|1004642_1004843_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545737.1|1004899_1005067_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000002106.1|1005139_1005424_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000253289.1|1005416_1005701_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000161575.1|1005700_1006273_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000215166.1|1006274_1006574_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000812193.1|1006570_1007089_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_001111304.1|1007183_1007480_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000951332.1|1007503_1007887_-	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_000031365.1|1007886_1008492_-	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_001243355.1|1008748_1008901_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1008885_1009017_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000392426.1|1010200_1010623_-	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000213976.1|1010680_1010881_-	antirestriction Ral family protein	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000219338.1|1010959_1011259_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_188347298.1|1011363_1011660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856967.1|1011779_1012430_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1012510_1012696_+	helix-turn-helix domain-containing protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|1012804_1013098_+	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1013120_1013393_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000431320.1|1013455_1014343_+	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
1013873:1013889	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_001248381.1|1014339_1015716_+	AAA family ATPase	NA	A5VW94	Enterobacteria_phage	100.0	5.7e-254
WP_000736904.1|1015990_1016431_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001254255.1|1016427_1016604_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386637.1|1016606_1016954_+	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	100.0	1.8e-63
WP_000950950.1|1016946_1017123_+	protein ninF	NA	A5VW88	Enterobacteria_phage	100.0	1.5e-26
WP_001004257.1|1017115_1017838_+	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000002245.1|1017837_1018128_+	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001008199.1|1018124_1018487_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1018483_1018672_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027549.1|1018668_1019187_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000783734.1|1019783_1020107_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1020090_1020567_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_001350934.1|1020563_1021001_+|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_001139680.1|1020988_1021141_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001109020.1|1021346_1021889_+	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_000807788.1|1022116_1022359_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113731.1|1022361_1022802_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000200779.1|1022798_1024214_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000818371.1|1024215_1026414_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000372589.1|1026504_1027398_+	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000013270.1|1027416_1028670_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_001362792.1|1028711_1028900_+	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1028880_1029342_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122367.1|1029351_1030770_+	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_000785531.1|1030769_1031471_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_000627629.1|1031470_1031926_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000964906.1|1031928_1032621_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	100.0	6.6e-118
WP_000246973.1|1032631_1033981_+	phage DNA ejection protein	NA	A5VW65	Enterobacteria_phage	100.0	4.5e-248
WP_001029855.1|1033980_1036140_+	hypothetical protein	NA	A5VW64	Enterobacteria_phage	100.0	0.0e+00
WP_000288815.1|1036140_1036464_-	hypothetical protein	NA	A5VW63	Enterobacteria_phage	100.0	4.9e-23
WP_000431541.1|1036486_1036906_-	type II toxin-antitoxin system YafO family toxin	NA	A5VW62	Enterobacteria_phage	100.0	1.6e-74
WP_001555940.1|1036890_1037472_-	hypothetical protein	NA	A5VW61	Enterobacteria_phage	100.0	1.7e-103
WP_001555939.1|1037532_1037781_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	100.0	3.1e-38
WP_001283825.1|1037804_1038062_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	100.0	4.5e-40
WP_000865489.1|1038167_1038308_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_000835351.1|1038571_1039495_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	100.0	1.7e-177
WP_000129909.1|1039595_1042541_+|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	100.0	0.0e+00
WP_000958671.1|1043723_1044881_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368123.1|1045192_1046125_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1058202:1058218	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
>prophage 4
NC_017632	Escherichia coli UM146, complete sequence	4993013	1389438	1395756	4993013		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116035.1|1389438_1390833_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	6.3e-19
WP_000183053.1|1391007_1391901_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000699397.1|1392273_1393359_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_001023638.1|1393358_1394258_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857501.1|1394315_1395191_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100795.1|1395198_1395756_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
>prophage 5
NC_017632	Escherichia coli UM146, complete sequence	4993013	2191033	2252364	4993013	tail,protease,capsid,lysis,holin,terminase,head,portal	Escherichia_phage(34.04%)	68	NA	NA
WP_000422062.1|2191033_2192083_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559260.1|2192302_2193061_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_001278741.1|2193057_2193648_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2193686_2194562_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001350892.1|2194774_2196670_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2196697_2197318_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|2197314_2198196_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2198333_2198378_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|2198469_2200032_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2200031_2201627_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195306.1|2201630_2202989_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209529.1|2203000_2204194_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443098.1|2204193_2205000_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000134814.1|2205380_2205560_+	general stress protein	NA	NA	NA	NA	NA
WP_001056507.1|2205645_2206146_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079492.1|2206191_2206698_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|2207184_2207355_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|2207469_2207739_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_029238848.1|2207803_2208463_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|2208517_2209102_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000216497.1|2209101_2212209_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_001233195.1|2212360_2212960_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000515769.1|2213027_2216507_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001332187.1|2216573_2216912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2216985_2217588_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140770.1|2217524_2218268_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	2.3e-145
WP_000847403.1|2218969_2219299_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082349.1|2219295_2221869_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000533402.1|2221849_2222263_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479101.1|2222289_2222721_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.1e-41
WP_000235110.1|2222734_2223487_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2223494_2223890_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2223886_2224420_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2224435_2224789_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201495.1|2224781_2225165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522591.1|2225216_2226245_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2226302_2226650_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253958.1|2226686_2228192_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000831813.1|2228181_2229774_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.4e-184
WP_000259002.1|2229770_2229977_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622378.1|2229960_2231889_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.2e-259
WP_000867575.1|2231860_2232409_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001331705.1|2232795_2233029_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000057035.1|2233086_2233497_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001082537.1|2233804_2234269_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000992052.1|2234567_2235101_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001351274.1|2235206_2235479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193259.1|2235444_2235789_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000372595.1|2235793_2236009_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001331708.1|2236158_2236320_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	2.3e-13
WP_001331709.1|2236277_2236505_-	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000935515.1|2237779_2238829_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|2238979_2239177_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000904114.1|2240218_2240593_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265108.1|2240605_2241652_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_011478175.1|2241653_2241932_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000813256.1|2242099_2242255_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_000354966.1|2242872_2243874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151216.1|2245042_2245465_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_001262357.1|2245505_2246576_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|2246647_2247073_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2247056_2247299_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|2247690_2248029_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|2248321_2248477_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|2248636_2248858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2249423_2249612_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|2249608_2249800_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048435.1|2249892_2252364_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
>prophage 6
NC_017632	Escherichia coli UM146, complete sequence	4993013	2359500	2404701	4993013	tail,tRNA,protease,capsid,lysis,terminase,head,integrase,portal	Enterobacteria_phage(50.91%)	62	2361694:2361707	2402582:2402595
WP_000654167.1|2359500_2359779_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2359775_2361836_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
2361694:2361707	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515351.1|2361894_2365377_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090917.1|2365437_2366070_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|2366006_2366750_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152661.1|2366755_2367454_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.5e-130
WP_000847405.1|2367453_2367783_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840273.1|2367779_2370341_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.7	0.0e+00
WP_000533392.1|2370333_2370723_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.1	3.8e-54
WP_000479130.1|2370749_2371172_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	90.7	3.9e-65
WP_014639761.1|2371187_2371928_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.3	2.9e-127
WP_000683145.1|2371935_2372331_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|2372327_2372906_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2372917_2373271_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2373263_2373638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522648.1|2373689_2374718_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000256840.1|2374775_2375123_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253914.1|2375159_2376665_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831761.1|2376654_2378247_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|2378243_2378450_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001304453.1|2378433_2380362_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867568.1|2380333_2380882_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|2381444_2381627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2381833_2382160_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2382640_2382934_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2383024_2383207_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2383423_2383921_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2383920_2384136_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2384724_2385807_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2385995_2386379_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2386464_2386605_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2386601_2386964_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000386643.1|2387170_2387512_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2387514_2387691_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2387687_2388215_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2388211_2388652_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2388725_2389016_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2389012_2389714_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000442609.1|2390641_2390938_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2391079_2391295_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2391370_2392066_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2392105_2392663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2392659_2393412_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2393688_2393871_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2393848_2394121_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|2394137_2394719_-	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|2394932_2395133_+	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2395315_2395684_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2395756_2395921_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2395889_2396033_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995442.1|2396108_2396405_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	3.1e-48
WP_000100847.1|2396410_2397196_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611719.1|2397192_2397873_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.2	2.5e-130
WP_000149545.1|2397869_2398052_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	1.3e-25
WP_000548550.1|2398024_2398216_+	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	93.7	1.2e-24
WP_000763374.1|2398602_2398824_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002141.1|2398823_2399150_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	91.5	2.7e-45
WP_000741335.1|2399739_2400882_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2400994_2402245_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2402416_2403070_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
2402582:2402595	attR	GATGAAGCCGGACG	NA	NA	NA	NA
WP_000476093.1|2403079_2403541_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2403594_2404701_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NC_017632	Escherichia coli UM146, complete sequence	4993013	2663510	2731800	4993013	tRNA,protease,capsid,terminase,head,integrase	Bacillus_phage(13.04%)	56	2658510:2658525	2735197:2735212
2658510:2658525	attL	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
WP_001555859.1|2663510_2664296_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|2664431_2665211_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436900.1|2665187_2666081_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011611.1|2666234_2666981_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2666977_2667160_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056555.1|2667211_2668444_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570549.1|2668480_2669467_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551261.1|2669463_2671212_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705727.1|2671248_2673513_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2673718_2674003_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2674162_2675836_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2675946_2676630_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001313710.1|2676802_2677567_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445244.1|2677735_2679019_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057124.1|2679089_2680178_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
WP_000642837.1|2680376_2681069_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194828.1|2681198_2682959_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2683364_2684222_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|2684276_2686559_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|2686750_2687491_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109282.1|2687587_2688736_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|2689049_2689676_+	hydrolase	NA	NA	NA	NA	NA
WP_000534662.1|2689711_2690575_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|2690576_2691194_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850286.1|2691204_2693649_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000886683.1|2693887_2695180_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|2695270_2696614_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2696624_2697236_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077108.1|2697394_2701438_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2701572_2702067_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|2702609_2703575_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043637.1|2703696_2705463_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	9.2e-23
WP_001202197.1|2705463_2707185_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.6e-14
WP_001241673.1|2707226_2707931_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2708215_2708434_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350182.1|2709474_2710029_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001029748.1|2710039_2711041_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000415806.1|2711971_2713279_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101565.1|2713608_2716842_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000097881.1|2716838_2717822_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_000934041.1|2718714_2720991_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2721021_2721342_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_002430406.1|2721624_2721885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133395.1|2722034_2722316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639771.1|2722572_2723085_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	45.9	8.2e-33
WP_000224594.1|2723321_2723735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380879.1|2723747_2724083_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907460.1|2724094_2725150_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	2.7e-70
WP_000796963.1|2725149_2725356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126681.1|2725771_2726194_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001260558.1|2726190_2726448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141033067.1|2726736_2728236_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	3.9e-91
WP_000791984.1|2728480_2728780_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000549001.1|2728785_2729013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206975.1|2729932_2730142_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_000092882.1|2730561_2731800_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	3.1e-126
2735197:2735212	attR	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
>prophage 8
NC_017632	Escherichia coli UM146, complete sequence	4993013	3319977	3362569	4993013	plate,transposase,integrase	Streptococcus_phage(28.57%)	40	3309290:3309349	3321997:3322072
3309290:3309349	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCGCTGCTCTACCA	NA	NA	NA	NA
WP_000068783.1|3319977_3321909_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000893305.1|3322186_3323440_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
3321997:3322072	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCGCTGCTCTACCAACTGAGCTATATCGGC	NA	NA	NA	NA
WP_001285288.1|3323451_3324555_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749902.1|3324843_3325899_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_000174703.1|3326008_3326410_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189577.1|3326467_3327712_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291988.1|3327803_3328262_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292999.1|3328522_3329980_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602123.1|3330036_3330651_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000521577.1|3330647_3331787_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_001059895.1|3331976_3332429_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263500.1|3332438_3332837_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3332839_3333133_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226168.1|3333184_3334240_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207544.1|3334310_3335096_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001555810.1|3335040_3336780_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_128888917.1|3336858_3337104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006241.1|3337098_3337596_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093936.1|3337771_3338521_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|3338832_3339573_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001331866.1|3339543_3340311_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3340515_3341094_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973137.1|3341333_3343778_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532690.1|3343820_3344294_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118042.1|3344447_3345218_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001298174.1|3345488_3345977_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227712.1|3346070_3346574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513317.1|3347824_3348115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528852.1|3348089_3349529_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000571853.1|3349521_3350568_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000053636.1|3350674_3352657_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
WP_001142963.1|3352877_3353396_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041480.1|3354101_3354605_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111582.1|3354627_3356112_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000946068.1|3356116_3356542_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000863402.1|3356547_3358389_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000896714.1|3358352_3359402_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000433564.1|3359406_3360699_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001013423.1|3360695_3361220_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000224516.1|3361222_3362569_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NC_017630	Escherichia coli UM146 plasmid pUM146, complete sequence	114550	52815	111122	114550	transposase,integrase	Escherichia_phage(31.25%)	45	54480:54500	77918:77938
WP_000952372.1|52815_53988_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|53987_54785_+	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
54480:54500	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_001298676.1|54778_55609_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000343766.1|56027_57248_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|57266_57785_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619112.1|57919_58168_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|58164_58602_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000340835.1|59877_60270_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|60274_61246_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|61474_62119_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|62112_62388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159871.1|63334_63640_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|63641_63860_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000990667.1|66181_66823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309253.1|67996_68974_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_001066947.1|69216_69957_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001332784.1|70077_70266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245172.1|70952_71801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298664.1|74161_76132_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|76138_76930_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|77668_78448_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
77918:77938	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
WP_001310017.1|78447_79470_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|80549_80897_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|80893_81298_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|81799_83308_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000143800.1|84416_85916_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000065240.1|85912_86668_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_001020413.1|87989_89165_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|89233_91495_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|91663_92440_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|92447_93323_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_001080732.1|95792_96128_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|96256_96604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|96623_97133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|97129_97390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874189.1|100296_100782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|100806_101292_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|101278_101974_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000964653.1|103097_104381_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|104383_105763_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_001243578.1|105866_108374_-	iron transporter	NA	NA	NA	NA	NA
WP_012372823.1|108666_109482_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949451.1|109664_110171_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_077459403.1|110160_110388_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001067837.1|110417_111122_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
