The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	1091792	1098932	4920168		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1091792_1092431_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1092427_1093690_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1093686_1094595_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1094760_1095558_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1095608_1096265_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1096370_1098932_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	1172560	1180028	4920168	integrase,transposase	Escherichia_phage(66.67%)	6	1163499:1163512	1180338:1180351
1163499:1163512	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000878218.1|1172560_1173427_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000577254.1|1173578_1175297_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|1175298_1177047_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1177118_1177535_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1177573_1178803_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1179545_1180028_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1180338:1180351	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	1443665	1488809	4920168	lysis,portal,integrase,holin,coat,tail,terminase	Enterobacteria_phage(53.45%)	61	1441197:1441213	1490819:1490835
1441197:1441213	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|1443665_1445099_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274885.1|1445314_1446229_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|1446300_1447548_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1448077_1448278_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281185.1|1448401_1448746_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	95.6	6.5e-58
WP_000152200.1|1448803_1449604_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	1.7e-157
WP_000002088.1|1449646_1449931_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	92.6	9.4e-47
WP_000206740.1|1449923_1450613_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	79.1	4.1e-96
WP_000151160.1|1450614_1451214_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	94.1	3.8e-45
WP_001065198.1|1451210_1451855_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.1	1.1e-130
WP_000812168.1|1451851_1452370_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	6.6e-54
WP_001214452.1|1452366_1452531_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_001111278.1|1452541_1452835_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001016190.1|1452851_1453400_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.8	3.6e-103
WP_000168259.1|1453408_1453924_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.3	1.3e-65
WP_000365276.1|1453924_1454632_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_000865176.1|1455242_1455431_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_000657742.1|1455430_1455760_-	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	72.9	1.9e-14
WP_000392415.1|1455812_1456178_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
WP_000804697.1|1456235_1456514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216180.1|1456516_1456825_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	65.7	8.2e-28
WP_000872381.1|1457178_1457832_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
WP_000067727.1|1457949_1458165_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438534.1|1458274_1458571_+	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_000166207.1|1458603_1458750_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065676.1|1458742_1459642_+	hypothetical protein	NA	K7PH26	Enterobacteria_phage	99.7	6.1e-164
WP_000131504.1|1459631_1461068_+	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	99.4	4.4e-273
WP_000810178.1|1461462_1461909_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	93.2	3.4e-75
WP_000153270.1|1461905_1462433_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254255.1|1462429_1462606_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386657.1|1462608_1462968_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_000950973.1|1462967_1463144_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000002243.1|1463857_1464148_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008199.1|1464144_1464507_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994515.1|1464503_1464692_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235461.1|1464688_1465312_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_029798719.1|1465452_1465635_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.5e-26
WP_000783734.1|1465745_1466069_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1466052_1466529_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000088943.1|1466525_1466993_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.1e-75
WP_001139680.1|1466980_1467133_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001058931.1|1467336_1467822_+	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_000807791.1|1468070_1468313_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
WP_000729921.1|1468392_1468881_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	99.4	4.1e-90
WP_000417851.1|1468858_1470358_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_000752844.1|1470358_1472524_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_000373008.1|1472537_1473449_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	6.3e-161
WP_001196941.1|1473448_1474744_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	4.7e-242
WP_001349928.1|1474788_1475043_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	95.5	1.1e-25
WP_001054835.1|1475020_1475521_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	1.2e-89
WP_001122413.1|1475520_1476939_+	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	1.0e-274
WP_000785560.1|1476938_1477787_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.2	3.8e-99
WP_000614044.1|1477786_1478242_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.1e-86
WP_000964882.1|1478244_1478937_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246948.1|1478946_1480335_+	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	64.0	7.7e-150
WP_001029828.1|1480334_1482332_+	hypothetical protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
WP_000287053.1|1482421_1482682_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	98.8	3.6e-37
WP_001280400.1|1482803_1485002_+|tail	phage tail protein	tail	F8UBT4	Escherichia_phage	37.6	4.1e-105
WP_000575660.1|1485034_1486162_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.2	1.0e-19
WP_000958678.1|1486407_1487565_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
WP_000368131.1|1487876_1488809_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1490819:1490835	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	1718978	1728419	4920168		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569367.1|1718978_1719905_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
WP_000783120.1|1719909_1720641_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1720621_1720729_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1720788_1721520_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1721741_1723427_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1723423_1724143_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1724189_1724660_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1724699_1725161_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|1725285_1727286_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001349937.1|1727282_1728419_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	1740930	1804261	4920168	integrase,capsid,portal,holin,lysis,plate,tRNA,tail,head,terminase	Escherichia_phage(42.55%)	74	1768173:1768200	1799177:1799204
WP_001295427.1|1740930_1742964_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1743095_1744205_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1744467_1744749_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1745041_1745584_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1745664_1746339_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945468.1|1746354_1748835_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405707.1|1748850_1749885_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1749966_1750305_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|1750523_1751348_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1751468_1751741_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|1751963_1752752_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1752748_1753549_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|1753613_1754432_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|1754483_1755230_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1755203_1756169_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846224.1|1756165_1757170_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1757166_1758444_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1758700_1759753_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1760062_1760917_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|1760945_1762208_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1762217_1762670_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1762700_1762985_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|1762988_1764344_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1764391_1765432_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1765531_1766311_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1766392_1767292_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|1767697_1768015_+	hypothetical protein	NA	NA	NA	NA	NA
1768173:1768200	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1768279_1769293_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1769408_1769708_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1769829_1770105_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217680.1|1770282_1770783_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|1770846_1771071_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277968.1|1771070_1771370_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_001113270.1|1771372_1771597_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|1771593_1771869_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268602.1|1771858_1774135_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000744812.1|1775299_1776733_+	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_001350078.1|1776725_1777298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038162.1|1777356_1778385_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_000156878.1|1778384_1780154_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001085948.1|1780327_1781182_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248584.1|1781240_1782314_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_000203430.1|1782317_1783061_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001350080.1|1783160_1783670_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000846399.1|1783669_1783873_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1783876_1784158_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144178.1|1784157_1784655_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000736570.1|1784669_1785095_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_000040687.1|1785082_1785508_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
WP_072134039.1|1785479_1785653_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_000917164.1|1785615_1786083_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	5.1e-82
WP_001001782.1|1786075_1786528_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_001093712.1|1786594_1787230_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_000127163.1|1787226_1787574_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121496.1|1787578_1788487_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_001285343.1|1788479_1789091_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000216987.1|1789087_1790371_+|tail	tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_000805553.1|1790370_1790964_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000049773.1|1790935_1791376_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000905100.1|1791821_1792415_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286686.1|1792474_1793665_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|1793677_1794196_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1794252_1794528_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1794560_1794680_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069967.1|1794672_1797120_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000978889.1|1797134_1797614_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882938.1|1797613_1798777_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|1798857_1799076_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1799348_1800710_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1799177:1799204	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1800812_1801109_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1801110_1801407_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1801615_1801948_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|1802138_1802861_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|1802857_1804261_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	2299078	2357463	4920168	integrase,lysis,portal,capsid,transposase,tail,head,terminase	Enterobacteria_phage(47.17%)	77	2294368:2294383	2326803:2326818
2294368:2294383	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000041685.1|2299078_2301505_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
WP_001295396.1|2301703_2302009_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2302116_2302827_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2302829_2303390_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2303424_2303766_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2303900_2304227_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2304432_2305647_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836076.1|2305658_2306678_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001360138.1|2306735_2306846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876956.1|2306865_2308146_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001296941.1|2308180_2308417_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048348.1|2308504_2310982_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2311074_2311266_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2311262_2311451_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|2311850_2312015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2312018_2312237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2312396_2312552_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2312718_2313126_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2313209_2313440_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|2313423_2313945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2313925_2314891_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2314931_2315354_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2315350_2315707_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_072096395.1|2316820_2317039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955178.1|2317013_2317196_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2317373_2318687_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2319123_2319456_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2319658_2319964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2319988_2320228_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2320227_2320515_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2320586_2320742_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2320958_2321210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2321276_2321555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2321556_2322606_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2322619_2323372_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2323649_2323739_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2323793_2324006_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2324306_2324522_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2325275_2325491_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2325495_2325807_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2325803_2326337_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2326333_2326831_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2326803:2326818	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2327193_2327406_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2327416_2327605_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2327607_2327673_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2327752_2327908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2328079_2328253_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2328404_2328815_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2328872_2329106_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2329494_2330040_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_015695614.1|2330014_2331982_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.5	0.0e+00
WP_000198149.1|2331935_2332142_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349919.1|2332138_2333740_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000123305.1|2333720_2335040_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001295978.1|2335049_2335382_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063280.1|2335437_2336463_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158921.1|2336504_2336903_+	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000753007.1|2336914_2337268_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000985119.1|2337279_2337858_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|2337854_2338250_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|2338257_2338998_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479150.1|2339013_2339436_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_000459457.1|2339417_2339852_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840335.1|2339844_2342406_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000847360.1|2342402_2342732_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_001152622.1|2342731_2343430_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_001349921.1|2343435_2344179_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_000090891.1|2344115_2344748_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000033679.1|2344808_2348222_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001233072.1|2348292_2348892_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000279140.1|2348956_2352031_+	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885611.1|2352030_2352606_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2352703_2353294_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2353610_2353844_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2353912_2354026_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2354630_2355914_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527779.1|2356002_2357463_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
>prophage 7
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	2554206	2610748	4920168	integrase,holin,plate,tRNA,tail,terminase	Escherichia_phage(75.44%)	64	2551918:2551933	2609909:2609924
2551918:2551933	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000837909.1|2554206_2555340_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001082294.1|2555480_2555915_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000701877.1|2556454_2557027_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_000117760.1|2557041_2560182_-	shikimate transporter	NA	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000902859.1|2560205_2560751_-|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000600270.1|2560753_2562307_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_001199732.1|2562303_2562930_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_001349878.1|2562913_2564140_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_000733802.1|2564161_2564701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261334.1|2565091_2565439_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_000063616.1|2566135_2566849_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001271172.1|2566848_2567856_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000209259.1|2567855_2568122_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_000056323.1|2568118_2568787_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000016439.1|2568790_2570779_-	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000703979.1|2570842_2571460_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000613371.1|2571456_2571888_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000506600.1|2571911_2573249_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_001139506.1|2573248_2574193_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000762302.1|2574179_2574620_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_000175376.1|2574616_2575057_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000780861.1|2575056_2575527_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_001272365.1|2575584_2576613_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_001349881.1|2576627_2577245_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_000059667.1|2577237_2578560_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_024190735.1|2578540_2579260_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
WP_000807710.1|2579318_2580755_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.2e-266
WP_000021163.1|2580773_2582102_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_000089432.1|2582091_2583183_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000126790.1|2583186_2583396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204039.1|2583373_2584306_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_001291099.1|2584298_2585087_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_133301706.1|2585491_2585674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014545.1|2585688_2586066_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_000950573.1|2586068_2586344_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_001349882.1|2586333_2586726_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000640164.1|2587996_2588533_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_000228041.1|2588529_2588820_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000940320.1|2588819_2589419_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000813259.1|2589887_2590043_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000064766.1|2590673_2591651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000569066.1|2591647_2592757_-	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000228824.1|2592749_2593877_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001151237.1|2594060_2594483_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000450660.1|2594498_2595260_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_000788973.1|2595282_2596029_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000899746.1|2596035_2596893_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693802.1|2596905_2597328_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072342.1|2597324_2597579_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2597658_2598078_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001169153.1|2598508_2598661_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000560220.1|2599081_2599303_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_000245530.1|2599296_2599473_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	6.3e-25
WP_001349884.1|2599547_2599823_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_000105152.1|2599924_2602525_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_000166319.1|2602517_2603327_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2603383_2603578_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2603570_2603780_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2603858_2604074_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2604075_2605311_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157422.1|2605362_2606298_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000123740.1|2606426_2607800_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2608277_2609261_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|2609515_2610748_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2609909:2609924	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 8
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	3065453	3154732	4920168	lysis,capsid,portal,integrase,plate,protease,tRNA,tail,head,terminase	Salmonella_phage(58.62%)	91	3144008:3144025	3162085:3162102
WP_000886683.1|3065453_3066746_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3066836_3068180_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3068190_3068802_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077017.1|3068956_3073024_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	9.3e-87
WP_000228473.1|3073158_3073653_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3074197_3075163_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3075285_3077052_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3077052_3078774_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3078815_3079520_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3079804_3080023_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934053.1|3080707_3082984_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3083014_3083335_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3083657_3083882_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|3083954_3085901_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3085897_3087013_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|3087163_3088120_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3088116_3089775_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3090200_3090896_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3091390_3092290_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3092433_3094086_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3094097_3095066_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|3095198_3096917_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|3096953_3097955_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136525.1|3097965_3099396_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3099494_3100508_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3100504_3101335_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3101331_3101655_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|3101780_3102296_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027201.1|3102513_3103242_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-28
WP_000756569.1|3103259_3103991_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3103997_3104714_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3104713_3105382_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3105673_3106405_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|3106579_3107707_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3107747_3108236_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3108295_3109141_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3109137_3110091_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|3110100_3111234_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126084.1|3111328_3112441_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3112791_3113268_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3113355_3114258_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189121.1|3114318_3115041_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3115024_3115312_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3115471_3115729_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3115758_3116136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3116405_3118091_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3118326_3118545_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011811.1|3118635_3119736_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	2.5e-175
WP_000980390.1|3119732_3120218_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_001282753.1|3120214_3123292_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|3123284_3123404_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3123418_3123721_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207659.1|3123775_3124291_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046154.1|3124300_3125473_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_000905033.1|3125615_3126182_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001145387.1|3126212_3126716_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.0	4.7e-49
WP_000378634.1|3126715_3127321_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	1.9e-97
WP_000104786.1|3128733_3130125_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	77.9	5.1e-162
WP_001086814.1|3130121_3130727_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000268312.1|3130719_3131628_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
WP_000177597.1|3131614_3131974_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993765.1|3131970_3132549_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000829153.1|3133595_3134042_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	1.9e-57
WP_001039935.1|3134034_3134466_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001080936.1|3134561_3134990_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.0	4.6e-45
WP_000727853.1|3134986_3135364_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069915.1|3135365_3135878_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
WP_000171568.1|3135858_3136074_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868174.1|3136077_3136281_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000673523.1|3136280_3136745_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059191.1|3136840_3137491_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742510.1|3137494_3138553_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216237.1|3138569_3139403_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098438.1|3139545_3141312_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520345.1|3141311_3142337_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
WP_000818977.1|3142377_3144159_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
3144008:3144025	attL	TATTTTTTTTGAATGGAT	NA	NA	NA	NA
WP_001059831.1|3144691_3145027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3145219_3145453_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3145463_3145652_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_000017523.1|3145804_3148219_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_000104176.1|3148215_3149073_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_000752613.1|3149069_3149297_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244226.1|3149296_3149530_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000963473.1|3149597_3149939_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000934004.1|3150020_3150269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956172.1|3150354_3150651_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460867.1|3150658_3151168_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.0e-75
WP_001069047.1|3151233_3151437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000646893.1|3151496_3152147_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.2	4.2e-34
WP_000350737.1|3152147_3153599_+	NTPase KAP	NA	R9TRQ8	Vibrio_phage	29.7	1.8e-45
WP_000290919.1|3153679_3154732_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.8	2.1e-107
3162085:3162102	attR	ATCCATTCAAAAAAAATA	NA	NA	NA	NA
>prophage 9
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	3779859	3860353	4920168	tail,plate,head,transposase	Escherichia_phage(56.14%)	93	NA	NA
WP_001143092.1|3779859_3782304_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
WP_001474801.1|3782725_3783250_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000337186.1|3783485_3783713_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_000424754.1|3783714_3785706_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_001026710.1|3785744_3786683_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000968312.1|3786698_3786926_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001151288.1|3787170_3787434_+	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_001101152.1|3787448_3787868_+	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_000255655.1|3787868_3788168_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	99.0	2.8e-49
WP_001107930.1|3788187_3788712_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_000227260.1|3788810_3789341_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_000465551.1|3789340_3789871_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000429765.1|3789857_3790040_+	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_001058561.1|3790041_3790344_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000431116.1|3790282_3790549_-	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_000091782.1|3790619_3791171_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000133853.1|3791167_3791557_+	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000515807.1|3791634_3791853_+	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000004161.1|3791845_3792208_+	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_001163387.1|3792349_3792772_+	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000907405.1|3792866_3793382_+	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001350022.1|3793365_3793752_+	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_001001316.1|3793910_3794105_+	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_000364295.1|3794104_3794404_+	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_000606409.1|3794400_3794691_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000375394.1|3794702_3795278_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_001097325.1|3795285_3796941_+	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000532638.1|3796940_3798479_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001136431.1|3798459_3799779_+|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_001350023.1|3799775_3800246_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_000716025.1|3800442_3801528_+	hypothetical protein	NA	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_000637410.1|3801524_3802442_+|head	head protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000017158.1|3802508_3802919_+	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_001104973.1|3802915_3803341_+	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000888926.1|3803340_3803889_+	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001438403.1|3803875_3804079_+	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.1e-28
WP_001280310.1|3804075_3805563_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_000918402.1|3805572_3805929_+|tail	tail protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_000344073.1|3805938_3806373_+	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000147074.1|3806517_3808590_+	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000461070.1|3808594_3810082_+	DMT family permease	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000072824.1|3810074_3811214_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000442748.1|3811201_3811795_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000130548.1|3811791_3812229_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000331815.1|3812229_3813312_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000301695.1|3813302_3813845_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000499360.1|3813844_3815359_+|tail	tail protein	tail	C9DGQ8	Escherichia_phage	90.2	1.7e-259
WP_000972119.1|3815361_3815889_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000972171.1|3815917_3816451_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_001112250.1|3816453_3817449_-	hypothetical protein	NA	A0A077SK37	Escherichia_phage	94.7	6.4e-183
WP_000905064.1|3817478_3818060_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001300256.1|3818154_3818343_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000514023.1|3818293_3818989_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_000859525.1|3819143_3819539_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_001248925.1|3819541_3819976_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_001279403.1|3819978_3821316_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_000151523.1|3821308_3822019_-	flagellar assembly protein H	NA	NA	NA	NA	NA
WP_001293173.1|3822022_3823033_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000993687.1|3823010_3824657_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000029081.1|3824661_3825003_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001292214.1|3825017_3826004_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000922506.1|3826390_3827242_+	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_000043127.1|3827234_3827606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830280.1|3827602_3828355_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001341234.1|3828357_3828630_+	flagellar type III secretion system protein FliQ	NA	NA	NA	NA	NA
WP_001260507.1|3828631_3829414_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_000785662.1|3829403_3830543_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_001140808.1|3830526_3832620_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|3832724_3833003_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030483.1|3832995_3833352_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543895.1|3833408_3834182_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3834367_3834628_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|3834630_3834909_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3835064_3835805_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3835775_3836543_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3836748_3837327_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|3837566_3840011_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3840053_3840527_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118026.1|3840680_3841451_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420921.1|3841492_3842629_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001350058.1|3843498_3843936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350059.1|3843895_3847945_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_000103316.1|3848020_3850162_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|3850371_3850890_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037395.1|3851587_3852088_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3852122_3852347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3852397_3853873_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3853879_3854293_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3854296_3856147_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3856110_3857193_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3857217_3858498_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3858494_3859019_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246449.1|3859021_3860353_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NC_016902	Escherichia coli KO11FL, complete sequence	4920168	4598325	4697144	4920168	lysis,capsid,portal,holin,integrase,plate,transposase,protease,tRNA,tail,head,terminase	Escherichia_virus(40.0%)	98	4661678:4661724	4694356:4694402
WP_000187020.1|4598325_4599426_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4599465_4599825_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4599824_4600475_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4600805_4602206_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4602188_4603106_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230082.1|4603372_4604746_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|4604806_4605583_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4605590_4606595_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4606748_4607900_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005603.1|4608251_4610903_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556280.1|4611085_4612819_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274624.1|4612967_4613819_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|4613805_4614147_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204101.1|4614148_4615027_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184821.1|4614992_4617290_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4617340_4617661_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4617675_4618755_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174083.1|4619063_4621565_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4621576_4622239_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4622249_4623353_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647882.1|4623627_4624245_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001297632.1|4624271_4625177_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|4625270_4627451_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|4627779_4628670_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4629018_4631451_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001350061.1|4631453_4632614_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4632890_4633208_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000399648.1|4633455_4634436_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000797341.1|4634670_4635279_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001323627.1|4636185_4636509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015021.1|4636510_4640683_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_000710769.1|4640842_4641055_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001350069.1|4641257_4643456_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4643611_4644637_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|4644728_4645688_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4645780_4646311_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|4646320_4647652_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4647718_4648645_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4648737_4649223_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4649307_4649553_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4649977_4650823_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4650845_4652354_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4652489_4653500_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|4653595_4654342_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4654346_4654775_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4654801_4655101_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155254.1|4655312_4655753_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4655853_4656453_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4656560_4657328_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708994.1|4657382_4658138_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4658244_4659234_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4659553_4660516_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4660696_4661599_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4661678:4661724	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4661835_4662054_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882968.1|4662135_4663299_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000978900.1|4663298_4663778_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_001283070.1|4663792_4666240_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000785970.1|4666232_4666352_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4666384_4666660_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4666716_4667235_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286683.1|4667247_4668438_-|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_000014362.1|4668757_4669657_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001164149.1|4669872_4670400_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000104720.1|4670403_4672413_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001285313.1|4672423_4672954_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_001121482.1|4672946_4673855_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_000127163.1|4673859_4674207_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093706.1|4674203_4674839_-|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_001001780.1|4674905_4675358_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917179.1|4675350_4675818_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_000040682.1|4675925_4676351_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000736609.1|4676338_4676764_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	3.8e-60
WP_001144093.1|4676778_4677276_-	glycoside hydrolase family 104 protein	NA	Q7Y4E4	Escherichia_virus	100.0	6.2e-94
WP_000123124.1|4677275_4677557_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4677560_4677764_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4677763_4678273_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203449.1|4678372_4679116_-|terminase	terminase endonuclease subunit	terminase	Q94MF3	Enterobacteria_phage	99.6	2.3e-124
WP_001248591.1|4679119_4680193_-|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	100.0	8.7e-202
WP_001085948.1|4680251_4681106_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|4681279_4683052_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038147.1|4683051_4684086_+|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000368931.1|4684501_4685575_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000570053.1|4685567_4686605_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_001143634.1|4686601_4687540_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4687782_4687989_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_014640573.1|4687988_4688441_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_000268589.1|4688440_4690726_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_000027664.1|4690715_4690991_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113263.1|4690987_4691212_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_001277905.1|4691211_4691514_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_000557702.1|4691513_4691738_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_000217679.1|4691801_4692302_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000453534.1|4692471_4692744_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4692896_4693190_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023383.1|4693259_4694240_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001223800.1|4694425_4694926_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4694356:4694402	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4695075_4695774_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4695770_4697144_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
