The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	4463064	4511221	10657107	plate,tail,holin	Bacillus_phage(27.27%)	43	NA	NA
WP_014057251.1|4463064_4464585_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	33.2	3.9e-62
WP_014057252.1|4464744_4464939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057253.1|4464975_4466364_-	cyclic nucleotide-binding domain-containing protein	NA	A0A2K9L690	Tupanvirus	31.2	4.7e-22
WP_014057254.1|4466435_4467848_-	cyclic nucleotide-binding domain-containing protein	NA	A0A2K9L690	Tupanvirus	31.9	4.6e-25
WP_014057255.1|4468249_4469155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057256.1|4469209_4469710_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078505764.1|4469690_4470923_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_014057258.1|4471047_4472505_-	xylulokinase	NA	NA	NA	NA	NA
WP_014057259.1|4472623_4473796_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014057260.1|4473852_4474956_-	pectinesterase	NA	NA	NA	NA	NA
WP_014057261.1|4475260_4476538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014057262.1|4476534_4479471_-	DEAD/DEAH box helicase	NA	D4P754	Rhodococcus_phage	31.8	1.9e-41
WP_014057263.1|4479613_4479796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057264.1|4480107_4480905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043239173.1|4481007_4481544_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043239177.1|4482285_4482867_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014057267.1|4483146_4483665_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_014057268.1|4483633_4484827_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_014057269.1|4484880_4485309_-	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014057270.1|4485428_4485833_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_106685910.1|4486103_4486895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057272.1|4486925_4487852_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_014057273.1|4487913_4490442_-	DEAD/DEAH box helicase	NA	M1I6E2	Acanthocystis_turfacea_Chlorella_virus	32.5	1.4e-45
WP_014057274.1|4490578_4491370_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014057275.1|4491414_4493196_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	3.9e-05
WP_014057276.1|4493192_4495097_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.1	2.4e-05
WP_014057277.1|4495251_4495992_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_014057278.1|4496229_4496670_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014057279.1|4496805_4498659_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	1.4e-42
WP_014057280.1|4498693_4499494_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014057281.1|4499669_4499867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014057282.1|4500045_4500624_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_014057283.1|4500620_4501346_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_014057284.1|4501356_4503621_+|tail	tail protein	tail	J9PVC2	Bacillus_phage	30.9	2.4e-47
WP_014057285.1|4503641_4504097_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014057286.1|4504098_4505592_+|tail	tail protein	tail	H6WFT7	Cyanophage	30.8	4.9e-17
WP_014057287.1|4505588_4506107_+|tail	phage tail protein	tail	T2KT02	uncultured_phage	38.7	6.4e-09
WP_043236117.1|4506103_4506298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057289.1|4506294_4506966_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014057290.1|4506976_4508158_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_043236120.1|4508154_4508856_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_014057292.1|4508852_4509275_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_014057293.1|4509271_4511221_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
>prophage 2
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	5114991	5125456	10657107	transposase,integrase	Virus_Rctr41k(33.33%)	9	5106147:5106161	5126651:5126665
5106147:5106161	attL	AGGCCGCCACCGACG	NA	NA	NA	NA
WP_014057697.1|5114991_5116071_-|integrase	site-specific integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	32.4	5.6e-07
WP_014057698.1|5116529_5116913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057699.1|5116912_5118352_+	caspase family protein	NA	NA	NA	NA	NA
WP_078505316.1|5118994_5119105_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078505319.1|5119101_5119293_+	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	48.3	7.1e-06
WP_150112905.1|5119363_5119861_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_167543214.1|5119933_5120188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167543215.1|5120225_5121836_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014055863.1|5124169_5125456_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.7	2.1e-32
5126651:5126665	attR	AGGCCGCCACCGACG	NA	NA	NA	NA
>prophage 3
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	5140340	5212192	10657107	transposase	Tupanvirus(28.57%)	47	NA	NA
WP_014057717.1|5140340_5141090_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_167543216.1|5142570_5142840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057719.1|5143148_5144216_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_043236264.1|5144242_5145571_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_043236267.1|5145950_5147054_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014057722.1|5147066_5148359_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_014057723.1|5148358_5151520_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	31.8	5.2e-69
WP_014057724.1|5151516_5152755_+	MFS transporter	NA	NA	NA	NA	NA
WP_014057725.1|5152920_5154228_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_014057726.1|5154388_5154727_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_014057727.1|5155239_5156004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057728.1|5156028_5157081_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_014057729.1|5157109_5158624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086019694.1|5158637_5159810_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
WP_014057731.1|5159852_5161241_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078505789.1|5161310_5162042_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014057733.1|5162160_5163732_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_106685926.1|5163743_5165066_+	cation/H(+) antiporter	NA	NA	NA	NA	NA
WP_014057735.1|5165013_5166075_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014057736.1|5166563_5166920_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014057737.1|5166916_5168293_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_014057738.1|5168298_5169816_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_014057739.1|5169869_5170517_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_014057740.1|5171256_5173155_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_014057741.1|5173366_5173651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106685694.1|5174507_5175305_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_050993718.1|5175507_5177013_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	35.5	3.9e-38
WP_043236271.1|5177003_5177291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106685695.1|5177501_5178782_-	MFS transporter	NA	NA	NA	NA	NA
WP_106685696.1|5182468_5193730_+	type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	34.3	1.4e-60
WP_014057749.1|5193726_5195070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167543217.1|5196031_5196202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014057751.1|5196240_5196810_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	44.3	1.9e-09
WP_106685927.1|5197032_5197656_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_043236273.1|5198241_5199783_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_050993979.1|5199971_5200697_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	28.1	2.1e-13
WP_014057755.1|5200708_5201113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043236276.1|5202340_5203204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014057757.1|5203902_5204268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014057758.1|5204496_5204853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014057759.1|5204866_5205493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086019633.1|5206763_5207767_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014057763.1|5208277_5210755_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	38.9	4.2e-05
WP_167543214.1|5210998_5211253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150112905.1|5211325_5211823_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_078505319.1|5211893_5212085_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	48.3	7.1e-06
WP_078505316.1|5212081_5212192_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	6282178	6309910	10657107	transposase,tail,plate	Pectobacterium_phage(25.0%)	18	NA	NA
WP_014058516.1|6282178_6286129_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_014058517.1|6286125_6289329_-|plate	putative baseplate assembly protein	plate	A0A1L2CUU9	Pectobacterium_phage	33.3	8.3e-06
WP_014058518.1|6289564_6289963_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_014058519.1|6289959_6290304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058520.1|6290340_6290874_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_014058521.1|6290906_6292046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058522.1|6292038_6292431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058523.1|6292434_6293121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058524.1|6293117_6293828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058525.1|6293864_6300413_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_014058526.1|6300409_6300703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106685958.1|6300693_6302616_-	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	37.0	5.7e-10
WP_014058528.1|6303008_6303926_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_014058529.1|6303930_6304674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058530.1|6304666_6305539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058531.1|6305562_6306087_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014058532.1|6306094_6307942_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	36.1	4.7e-46
WP_014058533.1|6308629_6309910_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	31.8	3.5e-40
>prophage 5
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	6854331	6913626	10657107	transposase	Leptospira_phage(20.0%)	49	NA	NA
WP_167543197.1|6854331_6855378_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	34.2	3.3e-44
WP_014058959.1|6855894_6856746_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014058960.1|6856779_6857262_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014058961.1|6857399_6858158_-	C4-dicarboxylate transporter/malic acid transporter	NA	NA	NA	NA	NA
WP_150112924.1|6858293_6858860_+	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_014058964.1|6859258_6860596_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014058965.1|6860849_6862946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043236629.1|6863880_6864474_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_014058967.1|6864822_6865458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014058968.1|6865667_6866939_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.8	1.0e-31
WP_014058970.1|6867185_6868268_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_043236631.1|6868820_6869486_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014058972.1|6869495_6870737_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014058973.1|6871132_6871507_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014058974.1|6871666_6873889_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_014058975.1|6874036_6874324_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_167543187.1|6875774_6876272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058978.1|6877710_6878109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014058979.1|6878105_6878954_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014058980.1|6879093_6880560_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014058981.1|6880556_6881303_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014058982.1|6881393_6881999_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014058983.1|6885485_6886400_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014058984.1|6886546_6886756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014058985.1|6887279_6889598_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014058986.1|6889680_6890628_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014058987.1|6890732_6891716_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014058989.1|6892754_6893609_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014058990.1|6893648_6894893_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_043239999.1|6894889_6895780_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014058992.1|6895831_6896896_-	alkene reductase	NA	NA	NA	NA	NA
WP_014058993.1|6897030_6897513_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014058994.1|6897515_6897956_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014058995.1|6898156_6899296_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_014058996.1|6899312_6900002_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	28.8	8.0e-07
WP_014058997.1|6899998_6900895_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014058998.1|6900963_6901773_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150112925.1|6901901_6902474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059000.1|6903077_6903902_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.1	2.0e-68
WP_014059001.1|6903955_6904381_-	heme-binding protein	NA	NA	NA	NA	NA
WP_014059002.1|6904431_6905637_-	MFS transporter	NA	NA	NA	NA	NA
WP_014059003.1|6905800_6906304_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059004.1|6906306_6907245_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059005.1|6907385_6908396_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014059006.1|6908434_6908863_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_078505832.1|6909095_6909683_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014059007.1|6910455_6911892_-	3-(3-hydroxyphenyl)propionate hydroxylase	NA	NA	NA	NA	NA
WP_043236640.1|6912007_6912973_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059009.1|6913122_6913626_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	40.4	2.4e-08
>prophage 6
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	7216404	7286969	10657107	protease,transposase	Bacillus_phage(36.36%)	54	NA	NA
WP_014059259.1|7216404_7217319_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014059260.1|7217410_7218073_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_014059261.1|7218383_7219772_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	24.3	1.6e-14
WP_014059262.1|7219768_7223764_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	23.3	4.6e-30
WP_014059263.1|7224525_7225017_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_014059264.1|7225016_7225238_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014059265.1|7225674_7226067_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_014059266.1|7226194_7226875_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_043236703.1|7226977_7227814_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014059268.1|7227937_7229113_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_014059269.1|7229195_7229771_+	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_043240182.1|7231341_7231755_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106685737.1|7232454_7235850_+	protein kinase	NA	NA	NA	NA	NA
WP_014059271.1|7235960_7237328_+	protein kinase	NA	K7YWY9	Megavirus	26.5	6.5e-08
WP_014059272.1|7237610_7238546_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_014059273.1|7238561_7238939_-	penicillinase repressor	NA	NA	NA	NA	NA
WP_106685975.1|7239045_7239663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059275.1|7239659_7240877_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014059276.1|7240971_7241808_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_014059277.1|7241804_7243250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059279.1|7243863_7245066_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059280.1|7245304_7245982_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	2.8e-28
WP_014059281.1|7245982_7247434_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.0	6.8e-16
WP_043236707.1|7247596_7248430_+	membrane protein	NA	NA	NA	NA	NA
WP_014059283.1|7248490_7249876_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014059284.1|7249872_7250535_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.0	1.6e-28
WP_014059285.1|7250544_7251219_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014059286.1|7251271_7251955_-	DedA family protein	NA	NA	NA	NA	NA
WP_014059287.1|7252076_7252448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043240193.1|7252459_7253389_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_014059290.1|7253834_7254623_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014059291.1|7255123_7255405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059292.1|7255646_7256174_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_043236713.1|7256588_7256903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059293.1|7257876_7258395_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014059294.1|7258469_7259858_-	tryptophanase	NA	NA	NA	NA	NA
WP_014059295.1|7259925_7260753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014059297.1|7263106_7264042_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014059298.1|7264863_7265514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078505440.1|7265669_7266197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059299.1|7266269_7267169_-	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_106685740.1|7267864_7268581_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014059301.1|7268579_7269533_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106685976.1|7270390_7270975_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059306.1|7273590_7273803_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_014059307.1|7273799_7274219_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_014059308.1|7275667_7277395_+	serine/threonine protein kinase	NA	M1I9Q9	Paramecium_bursaria_Chlorella_virus	26.0	1.6e-08
WP_050993785.1|7277382_7279638_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0B5J6A8	Pandoravirus	36.7	4.2e-12
WP_014059311.1|7281265_7282819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059314.1|7284687_7284840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059315.1|7284836_7285109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059316.1|7285740_7286049_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	1.2e-18
WP_106685741.1|7286045_7286366_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	38.2	3.4e-08
WP_106685742.1|7286696_7286969_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	39.5	4.1e-07
>prophage 7
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	7290849	7355656	10657107	transposase	Pandoravirus(25.0%)	52	NA	NA
WP_167543215.1|7290849_7292460_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_106685743.1|7292631_7292880_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106685744.1|7292876_7293518_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_043236735.1|7293716_7294280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059320.1|7294462_7295413_-	alpha/beta hydrolase	NA	A0A0B5J003	Pandoravirus	31.8	3.2e-14
WP_014059321.1|7295870_7296230_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_043236737.1|7297364_7298234_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059323.1|7298467_7299304_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014059324.1|7299312_7299732_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_043236739.1|7300120_7300954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106685745.1|7301138_7301549_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_014059327.1|7301545_7302400_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014059329.1|7303911_7304184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059330.1|7304817_7305213_-	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_014059331.1|7305528_7306161_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_043236741.1|7306440_7307565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059333.1|7308939_7309644_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059334.1|7309754_7310237_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_014059335.1|7310380_7311478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_123060311.1|7312432_7312645_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_014059337.1|7312885_7313302_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_014059338.1|7313416_7313869_-	VOC family protein	NA	NA	NA	NA	NA
WP_014059339.1|7313967_7314945_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043236745.1|7315613_7315949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167543234.1|7315915_7316527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043240255.1|7316780_7317077_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_167543235.1|7319321_7320245_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014059344.1|7321519_7322287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150112929.1|7322381_7323074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059347.1|7324025_7324433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150112930.1|7325338_7325650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059348.1|7325669_7326941_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.2	3.0e-31
WP_106685748.1|7327121_7328465_-	MFS transporter	NA	NA	NA	NA	NA
WP_014059351.1|7330398_7331325_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_167543236.1|7331468_7331666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059352.1|7332019_7333420_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_014059353.1|7333513_7334656_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014059354.1|7335119_7335995_-	cyclase family protein	NA	NA	NA	NA	NA
WP_014059355.1|7337392_7337740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059356.1|7337736_7337997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059357.1|7338509_7338914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106685749.1|7340257_7340647_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_014059360.1|7343554_7343980_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014059361.1|7344075_7345071_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_014059363.1|7345222_7346089_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_043236761.1|7347401_7348100_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014059366.1|7348268_7349198_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167543237.1|7349861_7349999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014059367.1|7350071_7351214_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_014059368.1|7351384_7351720_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106685751.1|7354427_7355198_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	41.2	9.5e-41
WP_014043695.1|7355347_7355656_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	2.6e-18
>prophage 8
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	7366304	7400314	10657107	transposase	Mycobacterium_phage(60.0%)	25	NA	NA
WP_014054022.1|7366304_7367576_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.8	1.0e-31
WP_150112931.1|7368414_7369407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167543238.1|7369439_7370078_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_123060295.1|7370218_7370605_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059382.1|7370950_7371646_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014059383.1|7371747_7372752_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_014059384.1|7372801_7373383_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059386.1|7374838_7375456_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059387.1|7375550_7376984_+	MFS transporter	NA	NA	NA	NA	NA
WP_014059388.1|7376980_7378264_+	serine hydrolase	NA	A0A1J0GRK9	Mycobacterium_phage	25.6	2.2e-05
WP_078505458.1|7378253_7379465_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014059390.1|7379461_7380502_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_014059391.1|7380512_7381427_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_014059392.1|7381719_7382565_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_150112932.1|7382615_7384196_+	phosphate ABC transporter substrate-binding protein, PhoT family	NA	NA	NA	NA	NA
WP_014059395.1|7384649_7385762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078505460.1|7385763_7386612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059396.1|7386782_7389260_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059397.1|7389613_7390840_+	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	29.1	1.6e-21
WP_014059398.1|7390956_7392174_+	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	35.2	3.7e-23
WP_014059399.1|7395212_7395821_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014059400.1|7395817_7396717_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059401.1|7396770_7397562_+	inositol phosphatase	NA	NA	NA	NA	NA
WP_167543197.1|7397796_7398843_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	34.2	3.3e-44
WP_014059403.1|7399096_7400314_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	7435242	7572185	10657107	transposase	Burkholderia_virus(22.22%)	50	NA	NA
WP_106685978.1|7435242_7435614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059434.1|7435710_7436802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078505466.1|7436834_7437155_-	Lsr2 family protein	NA	NA	NA	NA	NA
WP_014059436.1|7438473_7438824_+	SseB family protein	NA	NA	NA	NA	NA
WP_043236793.1|7438810_7439365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059438.1|7439361_7443909_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_043240316.1|7443922_7444678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043240320.1|7445775_7446864_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059443.1|7447250_7448081_-	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_014043695.1|7449861_7450170_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	2.6e-18
WP_106685742.1|7450816_7451089_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	39.5	4.1e-07
WP_078505468.1|7451085_7452225_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_167543240.1|7452118_7452547_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	56.1	6.0e-37
WP_014059446.1|7453272_7456038_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059449.1|7477923_7496430_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014059450.1|7497018_7497927_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.3	1.7e-28
WP_014059451.1|7498742_7499753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059452.1|7499833_7501354_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014059453.1|7502857_7503679_-	mycofactocin-coupled SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014059454.1|7503750_7505202_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014059455.1|7505272_7506376_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.2	1.8e-21
WP_014059456.1|7506372_7517418_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	28.5	5.2e-31
WP_078505471.1|7517446_7533061_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	28.3	1.8e-29
WP_014059458.1|7534085_7535789_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014059459.1|7535965_7536781_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043236799.1|7536883_7537732_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_150112935.1|7537791_7539189_+	carboxylesterase family protein	NA	NA	NA	NA	NA
WP_014059462.1|7539958_7541134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078505472.1|7541304_7541877_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014059463.1|7542285_7542498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059464.1|7542950_7543301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059466.1|7543593_7545669_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_043236804.1|7546099_7546888_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014059469.1|7547087_7548383_+	D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit	NA	NA	NA	NA	NA
WP_014059470.1|7548379_7549543_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_014059471.1|7549592_7550585_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_014059472.1|7550581_7551532_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014059473.1|7551627_7552479_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014059474.1|7553224_7554310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167543241.1|7554394_7554787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014059475.1|7556394_7557633_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_014059477.1|7559163_7559949_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014059478.1|7560156_7561035_+	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_014059479.1|7561090_7561993_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014059481.1|7562782_7564189_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	43.9	1.9e-87
WP_043236810.1|7564420_7565422_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014059483.1|7567635_7568397_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014059484.1|7568587_7569460_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014054022.1|7569621_7570893_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.8	1.0e-31
WP_014059485.1|7571096_7572185_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_015957	Streptomyces violaceusniger Tu 4113, complete sequence	10657107	8773338	8806108	10657107	capsid,integrase,portal,head,protease,transposase,terminase	Gordonia_phage(14.29%)	44	8773569:8773586	8810409:8810426
WP_014043695.1|8773338_8773647_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.9	2.6e-18
8773569:8773586	attL	GCTCAAGCGGGCGAACGA	NA	NA	NA	NA
WP_014043694.1|8773643_8774564_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	38.7	2.4e-43
WP_050993834.1|8774751_8775387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060510.1|8775500_8776100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060511.1|8776096_8776288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060512.1|8776382_8776679_+	putative ATP-grasp-modified RiPP	NA	NA	NA	NA	NA
WP_014060513.1|8776678_8777644_+	ATP-grasp ribosomal peptide maturase	NA	S5VKI3	Leptospira_phage	28.9	1.8e-28
WP_014060514.1|8777643_8778774_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_014060515.1|8778848_8779166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060516.1|8779398_8780595_+	helix-turn-helix transcriptional regulator	NA	A0A1J0MCE6	Streptomyces_phage	29.1	3.4e-29
WP_014060517.1|8780697_8781297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060518.1|8781293_8781485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060519.1|8781692_8782781_+	methyltransferase domain-containing protein	NA	A0A1J0MC37	Streptomyces_phage	39.2	1.7e-59
WP_106685778.1|8782867_8784160_-|integrase	site-specific integrase	integrase	A0A160DFH7	Gordonia_phage	26.6	1.8e-20
WP_014060522.1|8785100_8785316_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_106686002.1|8785855_8788168_+	DUF3987 domain-containing protein	NA	A0A2I6UGE7	Salinibacter_virus	38.1	1.3e-29
WP_014060525.1|8788248_8788671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060526.1|8788657_8788849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060527.1|8788845_8789298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060528.1|8789404_8789596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060529.1|8789639_8790152_+	single-stranded DNA-binding protein	NA	A0A222ZFS3	Arthrobacter_phage	59.3	5.5e-45
WP_014060530.1|8790206_8790383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106685779.1|8790573_8791002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043237074.1|8791202_8791997_+	phosphotransferase	NA	NA	NA	NA	NA
WP_014060533.1|8792052_8793555_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014060534.1|8794130_8794619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060535.1|8794615_8794930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060536.1|8794926_8795130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060537.1|8795126_8795330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106686003.1|8795392_8795641_+	endonuclease	NA	NA	NA	NA	NA
WP_014060539.1|8795826_8796156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060540.1|8796152_8796398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060542.1|8796819_8797194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060543.1|8797607_8797895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060544.1|8797973_8798165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043237080.1|8799353_8799536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060546.1|8799748_8800072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014060547.1|8800088_8800361_+	HNH endonuclease	NA	A0A1L6BZD8	Pasteurella_phage	52.7	7.0e-07
WP_014060548.1|8800365_8800803_+	hypothetical protein	NA	A0A1D8EX78	Mycobacterium_phage	44.8	4.9e-26
WP_014060549.1|8801186_8801423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106686004.1|8801457_8802891_+|terminase	terminase	terminase	G9FHH3	Rhodococcus_phage	39.5	1.8e-85
WP_014060551.1|8802902_8804054_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	28.6	1.6e-28
WP_014060552.1|8804050_8804800_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	40.9	1.6e-21
WP_014060553.1|8804890_8806108_+|capsid	phage major capsid protein	capsid	A0A2K9VGS3	Pontimonas_phage	40.2	2.0e-61
8810409:8810426	attR	GCTCAAGCGGGCGAACGA	NA	NA	NA	NA
>prophage 1
NC_015951	Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence	290055	104999	148846	290055	transposase,integrase	Escherichia_phage(20.0%)	40	134909:134928	151976:151995
WP_014043534.1|104999_106613_-|transposase	ISL3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	1.2e-05
WP_078505979.1|107359_107692_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_014043535.1|108625_109270_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_014043536.1|109266_110130_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_014043537.1|110126_111302_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_106686061.1|111458_112052_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_014043539.1|112147_113758_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_063644483.1|114015_116835_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_014043541.1|117785_118340_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014043542.1|118450_119407_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014043543.1|119637_120231_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_150112974.1|120378_120573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014043544.1|120869_121121_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014043545.1|121117_121375_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_167543316.1|121936_122107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043242275.1|122223_123567_+	recombinase	NA	NA	NA	NA	NA
WP_167543317.1|123876_124050_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_014043547.1|124157_125429_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.8	5.0e-31
WP_043242280.1|126302_127844_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_050994194.1|128032_128758_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	29.4	1.6e-13
WP_014043550.1|128769_129174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106686045.1|129860_130826_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_014043552.1|131420_131834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167543318.1|131930_133388_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014043554.1|133487_133790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014043555.1|133782_134055_+	hypothetical protein	NA	NA	NA	NA	NA
134909:134928	attL	CATCCGCCGCTGCTGCGGCC	NA	NA	NA	NA
WP_043242286.1|134993_135254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014043557.1|135473_136298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014043558.1|136299_136845_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_167543319.1|136880_137045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150112975.1|137535_137994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014043561.1|138515_139796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043242437.1|140053_140743_-	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	36.2	8.0e-15
WP_014043563.1|140946_141174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014043564.1|141621_141822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014043566.1|142234_143152_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	27.6	7.9e-10
WP_014043567.1|143185_143611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014043568.1|143607_145779_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_014043569.1|145775_147494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086019724.1|147493_148846_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
151976:151995	attR	CATCCGCCGCTGCTGCGGCC	NA	NA	NA	NA
