The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014501	Gloeothece verrucosa PCC 7822, complete sequence	6091620	1246218	1255356	6091620		uncultured_Caudovirales_phage(20.0%)	7	NA	NA
WP_013321250.1|1246218_1248582_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.5	1.7e-16
WP_013321251.1|1248803_1249301_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_041933146.1|1249324_1249687_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	5.5e-15
WP_013321253.1|1250074_1251055_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.7	4.3e-30
WP_013321254.1|1251207_1251591_-	plastocyanin	NA	E3SLB8	Synechococcus_phage	49.5	2.5e-18
WP_013321255.1|1252112_1252283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013321256.1|1252332_1255356_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	30.3	1.6e-19
>prophage 2
NC_014501	Gloeothece verrucosa PCC 7822, complete sequence	6091620	5961590	5975725	6091620	transposase	Bacillus_phage(12.5%)	12	NA	NA
WP_013325394.1|5961590_5963879_+	GAF domain-containing protein	NA	W8CYF6	Bacillus_phage	34.1	6.3e-32
WP_013325395.1|5963958_5964645_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_013325396.1|5964712_5965723_+	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_013325397.1|5965848_5966361_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	44.7	3.0e-27
WP_041934048.1|5966521_5968231_-	AarF/ABC1/UbiB kinase family protein	NA	C7U092	Ostreococcus_tauri_virus	31.6	5.9e-51
WP_013325399.1|5968353_5969133_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	9.0e-31
WP_013325400.1|5969350_5971108_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.5	5.7e-09
WP_013325401.1|5971096_5972380_-|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	50.3	3.6e-101
WP_013325402.1|5972488_5972962_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013325403.1|5973090_5974344_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	30.8	4.3e-51
WP_013325404.1|5974354_5974762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325405.1|5975128_5975725_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.2	4.0e-31
>prophage 1
NC_014533	Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence	879545	171662	179935	879545		Paramecium_bursaria_Chlorella_virus(33.33%)	8	NA	NA
WP_173362933.1|171662_172934_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.9	1.2e-13
WP_013334332.1|172958_173468_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_013334333.1|173503_174541_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013334334.1|174537_175641_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	33.0	4.7e-49
WP_013334335.1|175784_176492_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	53.7	3.1e-06
WP_013334336.1|176481_177441_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	30.9	2.4e-33
WP_013334337.1|177437_178721_+	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	26.9	4.9e-18
WP_013334338.1|178717_179935_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	32.9	1.0e-41
>prophage 2
NC_014533	Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence	879545	782263	821952	879545	transposase,capsid,bacteriocin	Microcystis_virus(40.0%)	39	NA	NA
WP_013334696.1|782263_782620_+|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_013334697.1|782748_785148_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
WP_013334698.1|785138_785930_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013334699.1|788539_789352_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.6	6.1e-14
WP_157871989.1|789341_789905_+	VOC family protein	NA	NA	NA	NA	NA
WP_013334701.1|790230_791142_+|capsid	minor capsid protein	capsid	A0A2D2W211	Stenotrophomonas_phage	29.4	4.8e-07
WP_013334702.1|791156_791585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334703.1|791638_791866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041934108.1|791868_792174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334705.1|792166_793033_-	prophage antirepressor	NA	A0A7D8	Microcystis_virus	54.8	1.4e-29
WP_013334706.1|793208_793412_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013334707.1|793519_793924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334708.1|793901_794312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334709.1|794289_794649_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013334710.1|794807_795149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334711.1|795178_796291_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041934109.1|796387_796678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334712.1|796925_797093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334713.1|797152_797662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334714.1|797731_798139_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_041934086.1|801279_801516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041934087.1|801567_802080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334715.1|802313_802940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871990.1|803065_803332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334717.1|803358_804501_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	58.7	1.7e-115
WP_013334718.1|804543_804771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334719.1|804773_805115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334720.1|805239_805443_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013334721.1|805495_805780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334722.1|805813_806206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041934112.1|806846_807212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083786950.1|807805_808039_+	AAA-like domain-containing protein	NA	NA	NA	NA	NA
WP_049802757.1|807965_813743_-	AAA family ATPase	NA	Q67624	IC4_retrovirus	25.9	2.2e-12
WP_013334724.1|813904_816166_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_013334725.1|816200_816902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334726.1|817041_818457_-	SagB family peptide dehydrogenase	NA	NA	NA	NA	NA
WP_013334727.1|818484_819912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334728.1|820051_821146_-	amidohydrolase	NA	NA	NA	NA	NA
WP_041934113.1|821481_821952_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_014534	Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence	473846	7900	81182	473846	integrase,transposase	Moraxella_phage(16.67%)	36	58353:58367	89136:89150
WP_013334776.1|7900_8983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041934240.1|9220_9577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049802781.1|9683_9893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049802782.1|9858_10608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334778.1|11690_12161_-	hypothetical protein	NA	A0A0R6PJC0	Moraxella_phage	32.8	4.8e-11
WP_013334779.1|12234_12594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334780.1|12609_13122_-	TniQ family protein	NA	NA	NA	NA	NA
WP_041934291.1|13118_13940_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_013334782.1|13960_15646_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013334783.1|15868_17401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334785.1|18374_19820_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	39.3	1.1e-85
WP_013334786.1|20400_23400_-	toprim domain-containing protein	NA	A0A0C4K628	Synechococcus_phage	36.7	1.5e-78
WP_013334788.1|24812_29456_+	VWD domain-containing protein	NA	M1UGR9	Cyanophage	37.8	7.1e-06
WP_013334789.1|29524_30139_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_013334790.1|30405_31794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013334792.1|34340_34697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334793.1|34821_35166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334794.1|35387_35699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334795.1|35695_36187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157872016.1|36324_36573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334797.1|36942_37815_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_013334798.1|37950_38151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334799.1|39204_62340_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
58353:58367	attL	AAAACTTGATTTTTC	NA	NA	NA	NA
WP_173362888.1|62302_63084_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013334800.1|63797_65519_-	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	30.7	1.3e-13
WP_013334801.1|66255_67887_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_013334802.1|67883_70301_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013334803.1|70356_71052_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_157872018.1|71209_73330_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_157872019.1|73529_73868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334806.1|73884_75879_+	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_157872049.1|75875_76118_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013334808.1|76400_77165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334810.1|77679_79320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334811.1|79664_79892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334812.1|80225_81182_+|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	40.3	7.6e-48
89136:89150	attR	GAAAAATCAAGTTTT	NA	NA	NA	NA
>prophage 2
NC_014534	Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence	473846	294258	358628	473846	transposase,integrase	Enterobacteria_phage(28.57%)	59	343480:343505	356101:356126
WP_049802809.1|294258_296586_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013334992.1|296585_297785_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013334993.1|297774_298218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013334994.1|298776_299544_-	MGMT family protein	NA	NA	NA	NA	NA
WP_013334995.1|299594_300761_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_013334996.1|300745_301567_-	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	27.3	1.9e-10
WP_013334997.1|301856_303023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013334999.1|303546_304209_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_013335000.1|304281_304695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335001.1|305111_306284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335002.1|306632_307634_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_013335003.1|307861_308347_-	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_013335004.1|308642_308885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335005.1|308947_309628_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	33.9	6.7e-14
WP_041934268.1|309955_310273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049802813.1|310382_310592_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_041934269.1|311584_311812_+	HNH endonuclease	NA	I6WB06	Burkholderia_virus	45.6	3.2e-05
WP_013335006.1|311798_314405_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_013335007.1|314437_314806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335008.1|315193_315613_+	GFA family protein	NA	NA	NA	NA	NA
WP_013335009.1|315796_316195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335010.1|316303_317665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335011.1|318264_319071_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013335012.1|319328_321029_+	asparagine synthase	NA	M1PN68	Moumouvirus	23.9	2.8e-16
WP_013335013.1|321094_322384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335014.1|322398_323628_-	decarboxylase	NA	NA	NA	NA	NA
WP_041934270.1|323628_325359_-	asparagine synthase	NA	M4R0Q4	Ostreococcus_lucimarinus_virus	27.5	3.5e-11
WP_013335016.1|325523_326147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083786958.1|326253_326382_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_173362938.1|326388_326562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335017.1|326718_327804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335018.1|328029_328284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041934271.1|328413_328767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335019.1|328960_329641_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013335020.1|329615_330935_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_013335021.1|331232_332135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335022.1|332140_332884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335023.1|333061_333532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335024.1|333732_333921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335025.1|335592_338631_+	primase	NA	Q7M2A8	Enterobacteria_phage	24.3	7.6e-17
WP_013335026.1|338686_341179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335027.1|341466_341949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335028.1|341945_342362_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013335029.1|342470_343073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335030.1|343189_343747_+	hypothetical protein	NA	NA	NA	NA	NA
343480:343505	attL	TTACAAAAATGGGATGCTCCCAAAAA	NA	NA	NA	NA
WP_013335031.1|343706_344450_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013335032.1|345012_346776_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013334928.1|346988_347189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335033.1|347634_347826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335034.1|347926_348268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335035.1|348282_348525_+	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_157872036.1|348712_348940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325777.1|349444_350416_-	ExeA family protein	NA	NA	NA	NA	NA
WP_157872053.1|350405_352046_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013325775.1|352061_352622_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.6	6.6e-44
WP_157872037.1|355482_356082_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157872038.1|356245_357308_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
356101:356126	attR	TTTTTGGGAGCATCCCATTTTTGTAA	NA	NA	NA	NA
WP_041934274.1|357546_357984_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071881459.1|358022_358628_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_014534	Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence	473846	373179	431504	473846	integrase,transposase,protease,tRNA	Bacillus_phage(33.33%)	41	378403:378424	401057:401078
WP_013335047.1|373179_375249_+|protease	PatA/PatG family cyanobactin maturation protease	protease	A0A217EQY2	Bacillus_phage	31.6	6.1e-18
WP_013335048.1|375258_377658_+|protease	PatA/PatG family cyanobactin maturation protease	protease	NA	NA	NA	NA
WP_013335049.1|377755_377971_+	cyanobactin biosynthesis system PatB/AcyB/McaB family protein	NA	NA	NA	NA	NA
WP_013335050.1|378136_378337_+	cyanobactin biosynthesis PatC/TenC/TruC family protein	NA	NA	NA	NA	NA
378403:378424	attL	CAGGGCAAACGCATCTAAATTT	NA	NA	NA	NA
WP_013335051.1|380061_380316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335052.1|380610_381585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049802823.1|381908_383180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335053.1|383400_385389_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013335054.1|385395_386313_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013335055.1|386319_386811_+	TniQ family protein	NA	NA	NA	NA	NA
WP_041934279.1|386928_387600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157872041.1|387487_388975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335056.1|390511_393532_-	primase	NA	Q7M2A8	Enterobacteria_phage	22.5	6.4e-16
WP_013335057.1|395901_400923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335058.1|401717_402866_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
401057:401078	attR	CAGGGCAAACGCATCTAAATTT	NA	NA	NA	NA
WP_157872042.1|404392_404992_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_013335060.1|405138_406197_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_013335061.1|406731_407289_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_157872043.1|407297_407984_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_157872044.1|408103_409507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157872054.1|409836_410637_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_013335065.1|410642_411434_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013335066.1|411430_412411_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.6	1.9e-17
WP_013335067.1|412521_414183_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_013335068.1|414932_416003_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157872045.1|416173_417583_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_013335071.1|418830_419499_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013335073.1|419963_420719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335074.1|420829_421159_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_013335075.1|421564_422266_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071881458.1|422952_424224_-	UPF0236 family protein	NA	NA	NA	NA	NA
WP_162052191.1|424426_424579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335078.1|424548_425031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013335079.1|425165_425645_-	ester cyclase	NA	NA	NA	NA	NA
WP_083786956.1|425883_426174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335080.1|426355_427687_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_013335081.1|427811_428369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013335082.1|428611_429079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157872038.1|429121_430184_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_041934274.1|430422_430860_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071881459.1|430898_431504_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_014502	Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence	291993	13873	43305	291993	integrase,transposase	Aphanizomenon_phage(33.33%)	39	41865:41882	47053:47070
WP_083786960.1|13873_14200_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013325523.1|15849_16119_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_013325524.1|16452_16674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013325525.1|17141_17381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325526.1|17427_17604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325527.1|18295_22606_+	legume lectin beta domain-containing protein	NA	NA	NA	NA	NA
WP_173362888.1|22695_23476_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049802839.1|23547_23775_-	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_013325528.1|23897_24260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325529.1|24256_24571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325530.1|25970_26159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041934409.1|26155_26500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041934377.1|26591_26906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041934378.1|27031_27685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325535.1|27729_28026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157872055.1|28138_28567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325537.1|28574_28742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325538.1|28755_29151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325539.1|29233_29869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325540.1|29927_30185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325541.1|30197_31079_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_013325542.1|31107_31410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325543.1|31500_32019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325544.1|32073_32796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325545.1|32861_33674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325546.1|33778_34315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325547.1|34314_34728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325548.1|34724_34949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325549.1|35030_35462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013325550.1|35551_35968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041934412.1|36301_36517_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013325552.1|36798_39033_+	AAA family ATPase	NA	A0A2H4PAV8	Aphanizomenon_phage	49.5	9.2e-20
WP_013325553.1|39735_39960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083786961.1|40004_40916_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_049802843.1|40912_41488_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.9	3.9e-07
WP_157872056.1|41509_41827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041934380.1|41853_42234_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
41865:41882	attL	CAAAAATGGGATGCTCCC	NA	NA	NA	NA
WP_049802845.1|42267_42585_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_013325554.1|42726_43305_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	40.8	3.5e-32
47053:47070	attR	CAAAAATGGGATGCTCCC	NA	NA	NA	NA
