The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014500	Dickeya dadantii 3937, complete sequence	4922802	177823	193465	4922802	tail,tRNA	Erwinia_phage(66.67%)	14	NA	NA
WP_013315863.1|177823_178288_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_033111511.1|178342_178933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013315865.1|178968_179742_-	DUF3142 domain-containing protein	NA	NA	NA	NA	NA
WP_013315866.1|179711_181913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013315867.1|182149_183523_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.0	2.9e-16
WP_013315868.1|183539_184238_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	32.0	4.8e-07
WP_013315869.1|184448_185009_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_033111512.1|185219_185708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013315872.1|187675_188968_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	42.1	3.3e-70
WP_013315873.1|188976_189354_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_033111513.1|189605_190790_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	52.8	5.6e-101
WP_033111514.1|190789_191410_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_033111515.1|191714_193073_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	54.3	7.9e-75
WP_013315877.1|193069_193465_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	46.1	7.3e-13
>prophage 2
NC_014500	Dickeya dadantii 3937, complete sequence	4922802	296711	354637	4922802	tRNA,integrase,tail,protease	uncultured_Caudovirales_phage(15.38%)	58	296666:296687	307297:307318
296666:296687	attL	TGTGTAGTCAGTGGTGTAGTCA	NA	NA	NA	NA
WP_013315966.1|296711_297932_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	84.4	7.6e-210
WP_013315967.1|297931_298669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033111530.1|298759_298984_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.2	3.1e-21
WP_033111531.1|299095_299290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013315970.1|299479_299701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013315971.1|299693_299909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013315972.1|299905_301675_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	45.8	5.4e-132
WP_033111532.1|302075_302255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033111533.1|302251_304177_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	55.4	6.8e-205
WP_052303353.1|304406_307235_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	38.1	9.2e-134
WP_012883002.1|307384_307681_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
307297:307318	attR	TGTGTAGTCAGTGGTGTAGTCA	NA	NA	NA	NA
WP_013315975.1|307704_308670_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_013315976.1|309022_309910_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_013315977.1|309924_311376_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_013315978.1|311365_311608_-	YhdT family protein	NA	NA	NA	NA	NA
WP_013315979.1|311801_313145_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_013315980.1|313156_313582_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_029456545.1|313617_314070_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_013315982.1|314308_314908_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_013315983.1|314974_315976_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_013315984.1|316195_317182_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013315985.1|317345_319292_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_012883014.1|319606_320650_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	5.1e-05
WP_013315987.1|320753_321890_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013315988.1|321886_322375_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013315989.1|322399_322993_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013315990.1|322982_324452_+	ribonuclease G	NA	NA	NA	NA	NA
WP_033112187.1|324562_328399_+	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_013315992.1|328445_329891_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_013315993.1|329979_330924_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_013315994.1|331262_331466_+	AaeX family protein	NA	NA	NA	NA	NA
WP_081441322.1|331497_332421_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_033112188.1|332434_334384_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_033111535.1|334390_334891_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_013315998.1|335007_335634_+	LysE family transporter	NA	NA	NA	NA	NA
WP_013315999.1|336037_336586_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_033111536.1|336776_338117_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_013316001.1|338183_338594_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_013316002.1|338774_339047_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_013316003.1|339043_339898_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	4.9e-06
WP_013316004.1|340046_340535_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_013316005.1|340628_340916_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_013316006.1|340940_342374_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_013316007.1|342421_343147_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	2.4e-22
WP_013316008.1|343162_343741_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_013316009.1|343718_344288_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_013316010.1|344284_344851_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	99.3	3.8e-71
WP_013316011.1|344900_345887_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.2	4.0e-36
WP_013316012.1|345917_346880_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_013316013.1|347161_347971_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	6.3e-19
WP_013316014.1|347974_348757_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_013316015.1|348761_349385_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_013316016.1|349402_350056_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_013316017.1|350048_350351_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_013316018.1|350483_350738_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_013316019.1|350795_352058_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013316020.1|352116_353178_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	2.6e-25
WP_013316021.1|353266_354637_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	2.7e-22
>prophage 3
NC_014500	Dickeya dadantii 3937, complete sequence	4922802	915451	948193	4922802	integrase,capsid,plate,portal,terminase,head,tail,holin	Cronobacter_phage(67.74%)	41	909903:909918	937078:937093
909903:909918	attL	GCTGACCCGCCCGGTA	NA	NA	NA	NA
WP_013316546.1|915451_916543_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	75.5	1.3e-157
WP_033111639.1|916650_917022_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	53.2	1.4e-29
WP_033111640.1|916999_918073_-	acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	39.1	7.7e-65
WP_033111641.1|918074_918857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033112222.1|918860_919712_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	40.3	5.0e-35
WP_013316550.1|920172_920394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013316551.1|920426_920936_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	55.8	2.4e-48
WP_167535238.1|921032_921188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013316553.1|921200_921530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013316554.1|921600_921828_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_012883471.1|921827_922151_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_013316555.1|922147_924190_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	61.8	7.4e-234
WP_042318135.1|924556_925606_-	Fic family protein	NA	S4TP71	Salmonella_phage	63.5	1.8e-119
WP_158305115.1|926083_926239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193345740.1|926245_926512_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	83.0	1.4e-36
WP_013316558.1|926565_927615_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.7	6.8e-159
WP_013316559.1|927590_929366_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	76.2	2.8e-269
WP_148226863.1|929522_930359_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	58.3	2.1e-57
WP_033111643.1|930413_931445_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.7	6.5e-154
WP_013316562.1|931448_932150_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	58.2	7.5e-69
WP_042318140.1|932246_932699_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	71.3	2.6e-54
WP_013316564.1|932695_933193_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	43.8	1.5e-34
WP_013316565.1|933189_933894_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	70.1	2.3e-86
WP_013316566.1|933896_935012_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	68.3	3.4e-140
WP_012883485.1|935008_935464_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	64.9	4.1e-52
WP_013316567.1|935472_935778_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	54.1	2.9e-17
WP_033111644.1|935764_936106_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	3.1e-44
WP_033111645.1|936105_936462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012883490.1|936594_936852_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	60.5	8.9e-20
WP_013316571.1|937039_939004_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	52.6	1.8e-192
937078:937093	attR	GCTGACCCGCCCGGTA	NA	NA	NA	NA
WP_033111646.1|939003_939333_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	5.6e-35
WP_013316573.1|939329_940514_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	69.8	9.4e-157
WP_013316574.1|940506_941139_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	62.5	2.4e-58
WP_013316575.1|941147_942569_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	49.6	3.7e-75
WP_013316576.1|942568_943189_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	36.3	3.0e-29
WP_013316577.1|943185_943911_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	36.1	1.5e-35
WP_013316578.1|943882_944410_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	58.8	4.5e-50
WP_013316579.1|944413_946066_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	58.4	9.4e-171
WP_071819869.1|946243_946435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012883501.1|946616_947123_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_013316581.1|947710_948193_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	4.7e-30
>prophage 4
NC_014500	Dickeya dadantii 3937, complete sequence	4922802	2586468	2596065	4922802	tRNA	Tupanvirus(33.33%)	11	NA	NA
WP_013318076.1|2586468_2587293_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.8	6.1e-70
WP_081441353.1|2587392_2588286_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_033112325.1|2588359_2588767_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012769674.1|2588785_2589085_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_013318079.1|2589088_2591476_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	1.1e-05
WP_013318080.1|2591491_2592475_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.0	7.6e-35
WP_106120997.1|2592654_2592699_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_012769671.1|2592896_2593253_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_013318081.1|2593296_2593494_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013318082.1|2593590_2594133_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	7.4e-16
WP_013318083.1|2594136_2596065_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 5
NC_014500	Dickeya dadantii 3937, complete sequence	4922802	2700707	2805484	4922802	transposase,plate,tail,tRNA,protease	Escherichia_phage(30.3%)	86	NA	NA
WP_148226855.1|2700707_2702068_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.8	2.0e-78
WP_013318179.1|2702156_2703305_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_107768306.1|2703675_2704146_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_013318181.1|2704217_2704895_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_013318182.1|2704894_2705614_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_013318183.1|2705610_2707173_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.7	5.4e-19
WP_013318184.1|2707172_2710943_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_013318185.1|2711271_2712162_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013318186.1|2712266_2713286_+	CAR family subclass B3 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_013318187.1|2713377_2714769_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_013318188.1|2715189_2717001_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_013318189.1|2716993_2717641_+	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_013318190.1|2717900_2719169_+	acyltransferase	NA	NA	NA	NA	NA
WP_013318191.1|2719390_2720446_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_013318192.1|2720595_2722617_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.5	2.3e-86
WP_013318193.1|2722636_2723368_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013318194.1|2723452_2723959_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033111897.1|2724269_2725508_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013318196.1|2725524_2728155_+	MCE family protein	NA	NA	NA	NA	NA
WP_013318197.1|2728264_2729713_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033111898.1|2730080_2730272_+	YebW family protein	NA	NA	NA	NA	NA
WP_033111899.1|2730481_2732479_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_171849480.1|2733073_2733886_-	helix-turn-helix domain-containing protein	NA	Q6K1G0	Salmonella_virus	55.6	6.6e-85
WP_013318201.1|2734040_2734511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042318392.1|2734507_2735056_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	47.9	1.7e-36
WP_033111901.1|2735175_2735391_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_013318204.1|2735390_2735615_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	52.1	4.1e-13
WP_013318205.1|2735711_2737838_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	46.7	2.5e-176
WP_013318206.1|2737901_2738123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013318207.1|2738716_2738920_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	65.7	9.2e-20
WP_013318208.1|2738995_2739457_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	44.4	5.1e-26
WP_033111902.1|2739884_2740547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033111903.1|2740693_2741335_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	62.4	8.1e-70
WP_013318211.1|2741331_2741682_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	62.9	9.3e-36
WP_013318212.1|2741686_2742595_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	73.5	6.0e-119
WP_013318213.1|2742587_2743199_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	66.7	1.1e-73
WP_013318214.1|2743554_2744760_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	46.8	2.4e-107
WP_013318215.1|2744945_2746301_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_013318217.1|2746475_2747822_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_013318219.1|2748256_2748823_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_033111904.1|2749021_2749507_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	51.9	2.0e-36
WP_013318220.1|2749531_2750101_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	77.6	2.3e-76
WP_013318221.1|2750272_2750965_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	42.5	1.4e-27
WP_033112335.1|2750967_2751579_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	32.6	1.6e-22
WP_013318223.1|2751802_2752972_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	2.3e-187
WP_013318224.1|2752986_2753505_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.9	9.4e-77
WP_013318225.1|2753565_2753856_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	1.3e-22
WP_100849676.1|2753852_2754008_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.5	4.4e-14
WP_033111905.1|2754000_2755092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013318228.1|2755103_2755598_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	58.7	1.6e-41
WP_013318229.1|2755594_2756773_+	hypothetical protein	NA	Q6K1G4	Salmonella_virus	42.7	1.9e-77
WP_012769529.1|2756869_2757061_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	66.7	6.8e-17
WP_013318231.1|2757458_2758775_+	guanine deaminase	NA	NA	NA	NA	NA
WP_013318232.1|2759087_2760902_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_013318233.1|2761152_2762838_+	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_013318235.1|2763865_2765410_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	48.8	5.4e-35
WP_013318236.1|2765477_2765777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013318237.1|2766127_2766814_-	metallophosphoesterase	NA	M9P0E4	Enterobacteria_phage	58.3	4.4e-74
WP_013318238.1|2766947_2768222_+	chloride channel protein	NA	NA	NA	NA	NA
WP_013318239.1|2768270_2769872_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033111906.1|2769964_2770648_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.7	4.1e-19
WP_013318241.1|2770640_2771489_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013318242.1|2771475_2772345_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042318400.1|2772341_2773382_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013318244.1|2773523_2774201_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_013318246.1|2774760_2775861_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_013318247.1|2776133_2777843_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.7	8.0e-32
WP_033111907.1|2777904_2778345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013318249.1|2778584_2779337_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_013318250.1|2779333_2780689_+	two-component system sensor histidine kinase RstB	NA	NA	NA	NA	NA
WP_013318251.1|2780764_2781349_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_013318252.1|2781694_2782513_+|protease	serine protease	protease	NA	NA	NA	NA
WP_013318253.1|2782823_2784374_+	L-lactate permease	NA	NA	NA	NA	NA
WP_013318254.1|2784457_2785177_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_013318255.1|2785188_2786610_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_033112337.1|2786609_2787305_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_013318257.1|2787405_2791293_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.6	9.0e-55
WP_013318258.1|2791651_2792257_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_013318259.1|2792371_2792629_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_013318260.1|2792653_2795257_-	YdbH family protein	NA	NA	NA	NA	NA
WP_013318261.1|2795562_2797116_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	55.1	5.6e-40
WP_013318262.1|2797322_2798315_+	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	41.3	8.4e-66
WP_033111909.1|2798361_2798640_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_013318264.1|2798955_2800920_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_013318265.1|2801045_2801543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013318268.1|2804542_2805484_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	92.2	6.4e-140
>prophage 6
NC_014500	Dickeya dadantii 3937, complete sequence	4922802	3552763	3560548	4922802	transposase	Thermus_phage(16.67%)	9	NA	NA
WP_013316701.1|3552763_3553753_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.5	3.1e-20
WP_013318960.1|3554085_3555381_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.4	1.4e-33
WP_013318961.1|3555479_3555680_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_013318962.1|3555691_3556027_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_013318963.1|3556028_3557879_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	5.0e-104
WP_013318964.1|3557958_3558477_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_013318965.1|3558574_3558898_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
WP_013318966.1|3558925_3559309_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.8	2.4e-53
WP_013318967.1|3559333_3560548_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	7.2e-35
