The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	302784	310060	5262222	tail	Clostridium_phage(83.33%)	8	NA	NA
WP_010075238.1|302784_303222_+	hypothetical protein	NA	A0A1J1J8Y6	Escherichia_phage	43.6	1.7e-26
WP_010075237.1|303224_303707_+	hypothetical protein	NA	A0A0A8WJB7	Clostridium_phage	42.0	8.0e-22
WP_010075236.1|303909_304251_+	hypothetical protein	NA	F6K8R7	Clostridium_phage	38.7	5.3e-12
WP_010075235.1|304250_304862_+	hypothetical protein	NA	A0A0A8WII3	Clostridium_phage	59.3	5.3e-63
WP_010075234.1|304946_305108_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010075232.1|305174_306821_+	hypothetical protein	NA	I2E8W1	Clostridium_phage	36.1	1.8e-12
WP_010075231.1|306827_307535_+|tail	tail protein	tail	NA	NA	NA	NA
WP_010075230.1|307543_310060_+	hypothetical protein	NA	B6CXF5	Clostridium_phage	36.2	1.7e-70
>prophage 2
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	922758	989314	5262222	transposase,portal,head,holin,tail,terminase,capsid,protease	Streptococcus_phage(20.59%)	67	NA	NA
WP_010073040.1|922758_924492_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010073170.1|925824_928107_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.6	8.4e-45
WP_010073169.1|928093_928591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073168.1|928577_929690_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010073167.1|929808_930159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073166.1|930290_930983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073165.1|931012_931192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073164.1|931273_932188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073163.1|932479_932695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013291611.1|933319_934021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073160.1|934414_935752_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	29.7	1.4e-36
WP_010073159.1|935769_936714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073158.1|937033_937984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073157.1|938112_939399_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010073156.1|939497_939920_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010073155.1|940065_940266_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010073154.1|940345_940573_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010073153.1|940573_940921_+	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	46.0	6.2e-08
WP_010073152.1|940920_942087_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	55.3	3.0e-115
WP_010073151.1|942088_942628_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	69.3	3.6e-63
WP_010073150.1|942640_944578_+	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	59.2	2.9e-219
WP_010073149.1|944584_946957_+	virulence-associated E family protein	NA	A0A0A7RTG3	Clostridium_phage	47.6	4.3e-217
WP_010073148.1|947207_947486_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	57.8	1.0e-21
WP_010073147.1|947482_948856_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	62.5	2.6e-166
WP_010073146.1|948889_949375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073145.1|949532_949883_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010073144.1|949884_950718_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010073143.1|950734_951376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073142.1|951613_951820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073141.1|951788_952181_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	44.4	9.7e-26
WP_010073140.1|952255_952756_+	HNH endonuclease	NA	S5YLC4	Mycobacterium_phage	33.3	2.6e-15
WP_010073139.1|952967_954221_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	61.1	6.5e-148
WP_010073138.1|954213_955560_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6A7	Streptococcus_phage	55.3	1.4e-143
WP_010073137.1|955627_956401_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	29.6	9.0e-15
WP_010073136.1|956550_957459_+	amidoligase enzyme	NA	A0A2K9V489	Faecalibacterium_phage	44.0	5.7e-61
WP_010073135.1|957561_958188_+	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	43.4	5.7e-20
WP_010073134.1|958248_958719_+|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	69.3	1.3e-56
WP_010073133.1|958723_960268_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	74.1	1.4e-232
WP_010073132.1|960332_961328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073131.1|961401_962676_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	56.8	5.3e-129
WP_010073130.1|962623_963265_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	45.7	8.2e-30
WP_010073129.1|963277_964555_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	34.7	4.6e-48
WP_010073128.1|964565_964985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073127.1|965100_965838_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	31.1	3.4e-19
WP_010073126.1|965931_966207_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXE3	Streptococcus_phage	42.7	1.8e-10
WP_010073125.1|966181_966538_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	46.0	1.5e-17
WP_010073124.1|966530_966923_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_010073123.1|966919_967249_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	45.0	2.6e-16
WP_010073122.1|967256_967826_+|tail	tail protein	tail	A0A1L2BYA0	Clostridium_phage	54.7	1.2e-48
WP_010073121.1|967989_968742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073120.1|968871_969195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073118.1|969401_971669_+|tail	phage tail tape measure protein	tail	M4QNS0	Tetraselmis_viridis_virus	31.8	1.1e-25
WP_010073117.1|971676_972372_+|tail	tail fiber protein	tail	Q0SPL3	Clostridium_phage	36.1	1.2e-31
WP_010073116.1|972421_972667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073115.1|972682_972868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073114.1|972879_976371_+	hypothetical protein	NA	H7BVF2	unidentified_phage	39.5	2.4e-67
WP_010073113.1|976457_976868_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	60.3	3.9e-41
WP_010073112.1|976860_977559_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	36.1	3.3e-24
WP_010073111.1|977679_978105_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013291612.1|978316_979621_+	recombinase family protein	NA	A0A1B0RXM0	Streptococcus_phage	38.8	2.0e-67
WP_013291613.1|979623_981213_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	53.2	5.7e-149
WP_010073107.1|981468_981723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073106.1|981735_982233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073105.1|982598_983534_+	peptidase C14	NA	NA	NA	NA	NA
WP_010073104.1|983530_985777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073040.1|986203_987937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041707166.1|988399_989314_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	37.7	1.1e-43
>prophage 3
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	1027659	1037245	5262222		Erysipelothrix_phage(33.33%)	8	NA	NA
WP_010076552.1|1027659_1030341_+	DUF927 domain-containing protein	NA	A0A291AXA0	Shigella_phage	35.3	1.1e-19
WP_010076551.1|1030762_1031248_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	43.5	1.9e-10
WP_010076550.1|1031588_1032035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010076549.1|1032144_1032456_+	hypothetical protein	NA	A0A2K5B282	Erysipelothrix_phage	65.7	4.7e-31
WP_010076548.1|1032559_1033333_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	28.7	1.8e-15
WP_010076547.1|1033711_1034128_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013291621.1|1034348_1035653_+	recombinase family protein	NA	E4ZFN8	Streptococcus_phage	38.5	3.4e-67
WP_013291622.1|1035655_1037245_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	54.4	3.2e-152
>prophage 4
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	1264725	1274153	5262222		Streptococcus_phage(16.67%)	8	NA	NA
WP_010076356.1|1264725_1267176_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.0	1.7e-123
WP_010076355.1|1267607_1268831_+	helix-turn-helix domain-containing protein	NA	A0A0S2GLI6	Bacillus_phage	41.8	6.2e-18
WP_010076354.1|1268972_1269467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010076352.1|1269622_1269973_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010076351.1|1270160_1271318_+	peptidase U32	NA	A0A067ZK81	Escherichia_phage	25.3	1.2e-23
WP_010076350.1|1271324_1272068_+	site-specific DNA-methyltransferase	NA	A0A1D8KJW7	Synechococcus_phage	28.1	2.3e-12
WP_010076349.1|1272119_1273451_+	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	43.1	8.9e-79
WP_010076348.1|1273625_1274153_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.2e-18
>prophage 5
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	1977979	1987498	5262222		Cyanophage(28.57%)	7	NA	NA
WP_010077435.1|1977979_1981741_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.3	4.6e-32
WP_010077434.1|1981762_1982242_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	1.7e-27
WP_010077433.1|1982241_1982955_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	45.2	1.6e-47
WP_010077432.1|1982957_1984352_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	3.8e-56
WP_010077431.1|1984377_1985370_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	44.6	1.8e-68
WP_010077430.1|1985357_1985969_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.1	5.2e-18
WP_010077429.1|1985992_1987498_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	3.7e-65
>prophage 6
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	2441182	2450704	5262222		Stx2-converting_phage(28.57%)	11	NA	NA
WP_010076999.1|2441182_2441785_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	60.0	1.4e-15
WP_010076998.1|2442042_2442567_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_010076997.1|2442624_2443242_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_010076996.1|2443558_2444374_+	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	41.2	1.1e-58
WP_010076995.1|2444411_2445716_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	9.5e-134
WP_010076994.1|2445812_2447024_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.8	2.5e-32
WP_010076993.1|2447169_2447925_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.8	1.7e-05
WP_010076992.1|2447921_2448527_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.9	2.3e-18
WP_010076991.1|2448543_2448969_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_010076990.1|2448937_2449573_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_010076989.1|2449654_2450704_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.0	9.3e-15
>prophage 7
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	2801554	2930566	5262222	transposase,head,holin,portal,tail,terminase,capsid,tRNA,integrase,protease	Clostridium_phage(30.23%)	105	2865319:2865378	2900824:2900960
WP_010075427.1|2801554_2802919_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	37.8	5.0e-77
WP_010075428.1|2803239_2804313_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_010075429.1|2804420_2806085_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	32.3	2.1e-24
WP_010075430.1|2806176_2807973_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.1	5.4e-87
WP_010075431.1|2807999_2809040_-	[FeFe] hydrogenase H-cluster radical SAM maturase HydE	NA	NA	NA	NA	NA
WP_010075432.1|2809062_2811201_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	3.1e-97
WP_010075433.1|2811225_2812440_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.8	2.4e-30
WP_010075434.1|2812538_2813102_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010075435.1|2813120_2815991_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	6.3e-98
WP_010075436.1|2816005_2817937_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	39.5	3.3e-114
WP_010075437.1|2818154_2820212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010075438.1|2820448_2820793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291744.1|2820891_2821722_-	flagellin	NA	NA	NA	NA	NA
WP_013291745.1|2822099_2822924_-	flagellin	NA	NA	NA	NA	NA
WP_013291746.1|2823083_2823908_-	flagellin	NA	NA	NA	NA	NA
WP_010077577.1|2824227_2824569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291747.1|2824828_2825653_-	flagellin	NA	NA	NA	NA	NA
WP_013291748.1|2826056_2826998_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013291749.1|2827101_2828262_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	23.7	1.3e-06
WP_010074445.1|2828258_2829254_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_010074444.1|2829243_2829933_-	acetyltransferase	NA	NA	NA	NA	NA
WP_010074443.1|2829967_2831023_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_010074442.1|2831040_2832210_-	LegC family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.1	2.8e-28
WP_010074441.1|2832247_2833228_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0E3IB24	Synechococcus_phage	26.2	9.0e-20
WP_010074440.1|2833388_2835200_-	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_013291750.1|2835599_2835869_-	acylphosphatase	NA	NA	NA	NA	NA
WP_010074438.1|2835897_2836296_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010074437.1|2836810_2838037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074436.1|2838380_2839526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010074435.1|2839542_2840526_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.8	6.7e-07
WP_010074434.1|2840649_2841654_-	bifunctional glycosyltransferase family 2/GtrA family protein	NA	NA	NA	NA	NA
WP_010074433.1|2841680_2842598_-	phosphodiester glycosidase family protein	NA	A0A2H4JHN3	uncultured_Caudovirales_phage	28.8	5.1e-09
WP_010074432.1|2842894_2843599_+	YukJ family protein	NA	NA	NA	NA	NA
WP_010074431.1|2843725_2844349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291751.1|2844660_2847270_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010074428.1|2847986_2849816_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.3	2.0e-113
WP_010074427.1|2850355_2851768_-	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_010074426.1|2851931_2853095_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_010074425.1|2853096_2853531_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010074424.1|2853532_2855593_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_010074423.1|2855890_2856310_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010074422.1|2856411_2857191_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_010074421.1|2857500_2858436_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_010074420.1|2858786_2859374_-	hypothetical protein	NA	A0A0E3JT82	Bacillus_phage	47.5	8.0e-40
WP_010074419.1|2859596_2860730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074417.1|2861305_2861746_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5RFX7	Helicobacter_phage	28.3	6.2e-05
WP_010074416.1|2862962_2863499_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_013291754.1|2864073_2864382_-	hypothetical protein	NA	NA	NA	NA	NA
2865319:2865378	attL	CATCGAAAACTTGTGTGGGAAAAGTGTGGGAAAATCTCATTTTTAGCCCTTCAAAATGGC	NA	NA	NA	NA
WP_013291755.1|2865662_2867756_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	50.1	6.6e-44
WP_081446452.1|2868845_2871365_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_013291757.1|2871348_2872809_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_013291758.1|2872801_2874082_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010074649.1|2874753_2875668_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WI59	Clostridium_phage	40.9	3.8e-20
WP_010074650.1|2875709_2876150_-|holin	phage holin family protein	holin	Q2I8E7	Bacillus_phage	41.2	5.8e-19
WP_010074651.1|2876210_2877230_-	hypothetical protein	NA	A0A2H4PGD9	Streptomyces_phage	30.3	1.1e-09
WP_010074652.1|2877233_2878337_-	hypothetical protein	NA	A0A2I7SBZ4	Paenibacillus_phage	35.1	2.0e-55
WP_010074653.1|2878340_2879201_-|tail	phage tail family protein	tail	A0A2K9V3G8	Faecalibacterium_phage	26.0	1.2e-15
WP_010074654.1|2879264_2881715_-|tail	tail protein	tail	A0A1S7FYZ4	Listeria_phage	29.1	2.1e-33
WP_010074655.1|2881730_2881877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074656.1|2881932_2882313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074657.1|2882335_2882890_-|tail	tail protein	tail	A6M958	Geobacillus_virus	49.5	1.2e-42
WP_010074658.1|2882905_2883232_-	hypothetical protein	NA	A6M957	Geobacillus_virus	54.6	7.6e-24
WP_010074659.1|2883233_2883614_-	HK97 gp10 family phage protein	NA	A6M956	Geobacillus_virus	37.1	2.8e-14
WP_010074660.1|2883616_2883913_-|head	phage head closure protein	head	A6XMK0	Bacillus_virus	49.5	1.1e-18
WP_010074661.1|2883902_2884178_-	DNA-packaging protein	NA	A0A1L2BY95	Clostridium_phage	51.6	1.4e-15
WP_010074662.1|2884282_2885341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074663.1|2885498_2886701_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_010074664.1|2886721_2887321_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	54.7	1.9e-52
WP_010074665.1|2887280_2888483_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.7	1.5e-133
WP_010074666.1|2888498_2890157_-|terminase	terminase large subunit	terminase	A0A1L2BY93	Clostridium_phage	83.2	7.7e-282
WP_010074667.1|2890153_2890525_-	hypothetical protein	NA	A0A1L2BY96	Clostridium_phage	75.6	3.6e-46
WP_010074668.1|2890614_2890953_-	hypothetical protein	NA	R9TNN2	Paenibacillus_phage	46.7	2.7e-16
WP_010074669.1|2890970_2891285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074670.1|2891415_2891604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074671.1|2891813_2892416_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L2BY87	Clostridium_phage	84.4	3.7e-93
WP_010074672.1|2892661_2892892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010074674.1|2893635_2894391_-	DNA adenine methylase	NA	Q0SPG6	Clostridium_phage	78.9	5.7e-115
WP_010074675.1|2894622_2895000_-	hypothetical protein	NA	A0A0A7RTL7	Clostridium_phage	41.9	2.1e-17
WP_010074677.1|2895206_2896493_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	34.7	1.8e-60
WP_010074678.1|2896514_2897387_-	replication initiator RepA	NA	NA	NA	NA	NA
WP_010074679.1|2897603_2897909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074680.1|2897923_2898226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074681.1|2898283_2898508_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTP5	Clostridium_phage	50.8	1.2e-09
WP_010074682.1|2898689_2899049_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTR3	Clostridium_phage	46.8	6.8e-18
WP_010074683.1|2899070_2899550_+	membrane protein	NA	A0A0A7RTX7	Clostridium_phage	48.6	1.2e-33
WP_010074684.1|2899576_2900752_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.4	1.7e-28
WP_013291761.1|2901559_2905048_-	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase/5'-nucleotidase	NA	NA	NA	NA	NA
2900824:2900960	attR	CATCGAAAACTTGTGTGGGAAAAGTGTGGGAAAATCTCATTTTTAGCCCTTCAAAATGGCATAAAAAAAGCCCGCAAACCGTTGCTATCAGCAGTTTGCAGACAATTTGGTGACCCCTAGGAGAATCGAACTCCTGA	NA	NA	NA	NA
WP_010074688.1|2905247_2906960_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.7e-66
WP_010074689.1|2907236_2908517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291762.1|2908509_2909631_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010074691.1|2909639_2910599_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_013291763.1|2911062_2917506_-	hemolysin-type calcium-binding protein	NA	NA	NA	NA	NA
WP_010074694.1|2917833_2918331_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_010074695.1|2918500_2919670_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_010074696.1|2919824_2921378_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.8	3.9e-09
WP_010074697.1|2921746_2922742_-	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010074698.1|2922868_2924020_-	homocitrate synthase	NA	NA	NA	NA	NA
WP_010074699.1|2924358_2924853_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010074700.1|2924886_2925423_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_010074701.1|2925551_2926433_-	radical SAM protein	NA	NA	NA	NA	NA
WP_013291764.1|2926655_2927270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074703.1|2927603_2927915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010074704.1|2927935_2928859_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.6	2.8e-79
WP_010074705.1|2928883_2929315_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010074706.1|2929405_2930566_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
>prophage 8
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	4302645	4346248	5262222	integrase,capsid,portal,tail	Clostridium_phage(36.67%)	55	4328873:4328888	4349628:4349643
WP_081446477.1|4302645_4302822_-|tail	tail fiber protein	tail	A0A0U4K7C7	Arthrobacter_phage	63.5	2.2e-14
WP_013291865.1|4303071_4303626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291866.1|4303681_4305385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291867.1|4305389_4307825_-	phage minor structural protein	NA	B6CXF5	Clostridium_phage	46.2	1.2e-97
WP_013291868.1|4307834_4308542_-|tail	tail protein	tail	A0A0A7RWN1	Clostridium_phage	28.3	4.1e-22
WP_013291869.1|4308547_4311382_-|tail	phage tail tape measure protein, TP901 family	tail	A0A1J1J8L9	Escherichia_phage	47.9	2.2e-18
WP_013291870.1|4311444_4312044_-	hypothetical protein	NA	A0A1J1J8Y5	Escherichia_phage	57.4	5.1e-58
WP_013291871.1|4312043_4312385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291873.1|4313061_4313490_-	chloramphenicol resistance protein	NA	A0A1J1J8Y6	Escherichia_phage	50.7	1.1e-35
WP_013291874.1|4313486_4313846_-|capsid	phage capsid protein	capsid	A0A0A8WIK8	Clostridium_phage	43.0	2.4e-18
WP_013291875.1|4313847_4314261_-	hypothetical protein	NA	A0A0A8WHV5	Clostridium_phage	39.3	2.6e-21
WP_013291876.1|4314274_4314565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291877.1|4314573_4314837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291878.1|4314882_4315827_-	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	57.6	1.5e-93
WP_013291879.1|4315860_4316454_-	DUF4355 domain-containing protein	NA	A0A1V0DZW6	Clostridioides_phage	40.4	5.2e-31
WP_013291880.1|4316576_4316771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291881.1|4316819_4317284_-	hypothetical protein	NA	M9Q2I2	Clostridium_phage	66.2	2.2e-56
WP_013291882.1|4317353_4317536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291883.1|4317535_4318969_-	NAD:arginine ADP-ribosyltransferase ART	NA	NA	NA	NA	NA
WP_157629773.1|4319114_4320428_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	44.7	4.5e-83
WP_013291885.1|4320454_4322200_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	65.0	1.2e-221
WP_013291886.1|4322273_4323074_-	prophage antirepressor	NA	A0A075KJT3	Lactobacillus_phage	36.4	2.8e-19
WP_041707193.1|4323340_4323568_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013291888.1|4323948_4324362_-	helix-turn-helix domain-containing protein	NA	A0A2H4J863	uncultured_Caudovirales_phage	37.4	2.8e-15
WP_013291889.1|4324635_4325088_-	hypothetical protein	NA	A0A0A7RTX6	Clostridium_phage	35.8	4.4e-14
WP_013291890.1|4325513_4326326_-	excinuclease ABC C subunit domain-containing protein	NA	NA	NA	NA	NA
WP_013291891.1|4326353_4328960_-	DNA primase	NA	NA	NA	NA	NA
4328873:4328888	attL	AGGGGCATTTAGTAAA	NA	NA	NA	NA
WP_013291892.1|4328986_4329598_-	hypothetical protein	NA	Q9ZXC2	Bacillus_phage	34.4	2.1e-22
WP_013291893.1|4329602_4329953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041707299.1|4329918_4330239_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	43.5	2.6e-16
WP_013291895.1|4330254_4330743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291896.1|4330755_4331043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291897.1|4331026_4331251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291898.1|4331334_4332315_-	radical SAM protein	NA	A0A1B1IPE0	uncultured_Mediterranean_phage	30.7	1.2e-27
WP_013291899.1|4332323_4332914_-	hypothetical protein	NA	A0A0A8WEV5	Clostridium_phage	47.2	1.9e-41
WP_013291900.1|4332925_4333360_-	single-stranded DNA-binding protein	NA	A0A0A8WIG9	Clostridium_phage	56.2	1.2e-27
WP_013291901.1|4333378_4334002_-	HD domain-containing protein	NA	A0A2H4J8L1	uncultured_Caudovirales_phage	44.5	1.4e-37
WP_013291902.1|4334014_4334983_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	44.2	7.7e-40
WP_013291903.1|4334982_4335150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291904.1|4336255_4336558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291905.1|4336554_4337028_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	30.1	7.2e-07
WP_013291906.1|4337044_4337635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291907.1|4337621_4337870_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	48.8	3.7e-15
WP_157629753.1|4338005_4338164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291909.1|4338193_4338748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291910.1|4338749_4338983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291913.1|4339215_4340505_-	hypothetical protein	NA	A0A0F7L4R4	uncultured_marine_virus	51.4	2.3e-23
WP_041707198.1|4340623_4340911_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_013291915.1|4340923_4341685_-	hypothetical protein	NA	A8ATY0	Listeria_phage	63.7	1.8e-84
WP_013291916.1|4341776_4341983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013291917.1|4341933_4342245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013291918.1|4342247_4343291_-	helix-turn-helix domain-containing protein	NA	A0A0A7RW33	Clostridium_phage	47.0	3.0e-29
WP_013291921.1|4344092_4344308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013291922.1|4344502_4344859_+	helix-turn-helix transcriptional regulator	NA	I2E8Z0	Clostridium_phage	39.2	1.2e-09
WP_013291923.1|4345162_4346248_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	25.4	5.6e-15
4349628:4349643	attR	TTTACTAAATGCCCCT	NA	NA	NA	NA
>prophage 9
NC_014393	Clostridium cellulovorans 743B, complete genome	5262222	4712370	4824050	5262222	head,holin,portal,tail,terminase,capsid,tRNA,protease	Erysipelothrix_phage(50.98%)	86	NA	NA
WP_010073923.1|4712370_4713243_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	35.0	4.5e-31
WP_010073924.1|4713497_4713881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073925.1|4714024_4714861_-	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_010073926.1|4714886_4715225_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_010073927.1|4715252_4715579_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_010073928.1|4715602_4716364_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_010073929.1|4716366_4717086_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_010073930.1|4717082_4717688_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010073931.1|4717705_4718293_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_010073932.1|4718319_4719612_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_010073933.1|4719696_4720347_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010073934.1|4720366_4721578_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010073935.1|4722021_4723509_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_010073936.1|4723756_4724029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073937.1|4724053_4724917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073938.1|4724897_4727123_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	6.4e-82
WP_010073939.1|4727138_4727522_-	cation transporter	NA	NA	NA	NA	NA
WP_010073940.1|4727534_4728104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157629754.1|4728436_4739098_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.8	3.7e-175
WP_010073944.1|4739438_4740476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073945.1|4740468_4740960_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010073946.1|4741156_4743352_-	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	28.7	2.5e-33
WP_010073948.1|4744565_4745498_-	serine hydrolase	NA	NA	NA	NA	NA
WP_010073949.1|4745545_4746847_-	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	28.4	1.3e-26
WP_010073950.1|4746983_4751459_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.7	1.9e-88
WP_010073951.1|4751474_4752956_-	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	27.9	8.6e-06
WP_010073952.1|4753123_4755463_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_010073953.1|4755536_4756763_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_010073954.1|4756789_4759216_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	32.3	1.1e-74
WP_010073955.1|4759243_4773085_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	2.9e-196
WP_010073956.1|4773208_4774252_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_010073957.1|4774276_4775410_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010073958.1|4775451_4775688_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_081446464.1|4775724_4776420_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010073960.1|4776422_4777331_-	recombinase family protein	NA	D0R0F3	Streptococcus_phage	39.1	1.6e-42
WP_081446465.1|4777628_4778411_-	serine hydrolase	NA	NA	NA	NA	NA
WP_013291955.1|4778376_4778751_+	TnpV protein	NA	D0R0F4	Streptococcus_phage	95.2	5.6e-63
WP_005357924.1|4779117_4781037_+	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	98.7	0.0e+00
WP_002779755.1|4781088_4781262_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
WP_004223508.1|4781555_4781756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010073963.1|4782361_4783948_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	51.4	6.5e-145
WP_010073964.1|4783932_4785438_-	recombinase family protein	NA	M1NSJ1	Streptococcus_phage	38.5	1.9e-69
WP_010073965.1|4785472_4785658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073966.1|4785650_4786061_-	DNA-directed RNA polymerase sigma-70 factor	NA	Q6DMV1	Streptococcus_phage	36.4	6.8e-14
WP_010073967.1|4786267_4787734_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	40.5	7.0e-61
WP_010073968.1|4787735_4788146_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	71.3	6.1e-47
WP_010073970.1|4788219_4790691_-	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	70.0	0.0e+00
WP_010073971.1|4790690_4791275_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	64.6	2.4e-68
WP_010073972.1|4791267_4791465_-	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	66.2	1.1e-22
WP_010073973.1|4791479_4794005_-	hypothetical protein	NA	A0A2K5B298	Erysipelothrix_phage	69.4	0.0e+00
WP_010073974.1|4794008_4794785_-|tail	tail protein	tail	A0A2I4R672	Erysipelothrix_phage	64.0	3.1e-100
WP_010073975.1|4794797_4797410_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	82.2	1.8e-115
WP_157629755.1|4797430_4797592_-	hypothetical protein	NA	A0A2K5B296	Erysipelothrix_phage	75.6	4.6e-14
WP_010073977.1|4797618_4797999_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	67.7	2.7e-41
WP_010073978.1|4798018_4798618_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	73.6	6.8e-79
WP_010073979.1|4798620_4798962_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	46.8	1.1e-25
WP_010073980.1|4798958_4799390_-	hypothetical protein	NA	A0A2K5B292	Erysipelothrix_phage	55.9	7.1e-38
WP_010073981.1|4799382_4799715_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	62.4	1.3e-31
WP_010073982.1|4799716_4800028_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	81.0	3.2e-40
WP_010073983.1|4800045_4801224_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.3	6.8e-99
WP_013291958.1|4801236_4802010_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	62.8	3.8e-66
WP_010073985.1|4801903_4803265_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	73.6	3.1e-180
WP_010073986.1|4803283_4804885_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	70.0	1.4e-224
WP_010073988.1|4805221_4805431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073989.1|4805430_4805895_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_010073990.1|4805980_4806928_-	alpha-L-fucosidase	NA	A0A1B1IUD7	uncultured_Mediterranean_phage	36.2	5.1e-44
WP_010073991.1|4807049_4807439_-	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	65.2	1.8e-19
WP_010073992.1|4807444_4808116_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	46.8	2.4e-48
WP_010073993.1|4808302_4808851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010073994.1|4808881_4810618_-	DNA cytosine methyltransferase	NA	A0A2K9V3X0	Faecalibacterium_phage	64.8	2.5e-33
WP_010073995.1|4810610_4811867_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	49.5	3.4e-112
WP_010073996.1|4811876_4812659_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_010073997.1|4812660_4813200_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.3	3.5e-58
WP_010073998.1|4813315_4813684_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.8	7.0e-34
WP_010073999.1|4813825_4814233_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	42.2	3.8e-25
WP_010074000.1|4814235_4814466_-	hypothetical protein	NA	A0A2K5B274	Erysipelothrix_phage	53.6	7.2e-13
WP_010074001.1|4814545_4815916_-	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	62.5	4.0e-159
WP_010074002.1|4815899_4816178_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	70.0	1.1e-31
WP_010074003.1|4816394_4818662_-	hypothetical protein	NA	E4ZFK6	Streptococcus_phage	56.1	5.1e-244
WP_010074004.1|4818652_4819078_-	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	52.2	3.0e-36
WP_010074005.1|4819262_4819637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010074006.1|4819615_4819864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010074007.1|4819866_4820271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010074008.1|4820263_4821406_+	DUF2800 domain-containing protein	NA	D0R0B3	Streptococcus_phage	62.6	3.6e-137
WP_010074009.1|4821398_4821962_+	DUF2815 family protein	NA	Q6DMW3	Streptococcus_phage	78.9	3.8e-79
WP_010074010.1|4822058_4824050_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	67.6	5.3e-261
