The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014376	[Clostridium] saccharolyticum WM1, complete sequence	4662871	563492	629490	4662871	transposase,protease,holin,integrase	Leptospira_phage(14.29%)	59	555593:555608	610088:610103
555593:555608	attL	TGGTTAATCTTGGATT	NA	NA	NA	NA
WP_013271232.1|563492_564332_+|holin	LPS cholinephosphotransferase	holin	A0A1V0SD50	Indivirus	46.3	2.6e-07
WP_013271233.1|564437_565973_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_157669055.1|566248_566821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271235.1|566908_567889_-	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_013271236.1|568173_569559_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_013271237.1|569626_569866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013271238.1|569998_570910_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013271239.1|571113_571503_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013271240.1|571522_572116_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.5	2.0e-43
WP_013271241.1|572454_572718_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013271242.1|572689_573145_+	peptide deformylase	NA	A0A2I7R224	Vibrio_phage	36.0	2.9e-13
WP_013271243.1|573195_574356_+	MFS transporter	NA	NA	NA	NA	NA
WP_081442994.1|574613_574778_+	DUF255 domain-containing protein	NA	NA	NA	NA	NA
WP_081442995.1|574790_576677_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013271244.1|576864_577830_+	choloylglycine hydrolase family protein	NA	A0A2K9L5Y5	Tupanvirus	26.0	4.7e-21
WP_013271245.1|578373_579687_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	30.2	3.4e-14
WP_013271246.1|579965_580484_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.6	7.8e-23
WP_013271247.1|580488_581238_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013271248.1|581173_581875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013271249.1|582124_582907_+	YesL family protein	NA	NA	NA	NA	NA
WP_013271250.1|583069_583648_+	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_013271251.1|583768_584980_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.4	3.8e-60
WP_013271252.1|585216_585555_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_013271253.1|585835_586741_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_013271254.1|586730_587405_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013271255.1|587421_587637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271256.1|587799_588423_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013271257.1|588446_589589_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013271258.1|589601_592661_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.6	1.4e-87
WP_013271259.1|592794_593946_+	TolC family protein	NA	NA	NA	NA	NA
WP_013271260.1|593949_595146_+	TolC family protein	NA	NA	NA	NA	NA
WP_013271261.1|595126_595774_-	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_013271262.1|595871_596936_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_013271263.1|597061_597880_+	glutamate racemase	NA	NA	NA	NA	NA
WP_013271264.1|597893_598340_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_013271265.1|598382_599603_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_013271266.1|599676_600522_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	27.3	2.2e-14
WP_013271267.1|600528_601389_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	29.3	3.3e-18
WP_013271268.1|601618_603331_+	cell wall-binding protein	NA	NA	NA	NA	NA
WP_013271269.1|604854_606399_+	polymerase	NA	NA	NA	NA	NA
WP_081442996.1|606623_606899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049791693.1|607319_608603_+	sugar transferase	NA	NA	NA	NA	NA
WP_013271271.1|608599_609742_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013271272.1|609735_610524_+	ABC transporter permease	NA	NA	NA	NA	NA
610088:610103	attR	TGGTTAATCTTGGATT	NA	NA	NA	NA
WP_041708413.1|610545_611268_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	5.4e-14
WP_013271274.1|611282_612419_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013271275.1|612423_613593_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013271276.1|613691_616031_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_081442998.1|616618_616888_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013271278.1|617189_620165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271279.1|620197_621622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271280.1|621643_622066_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_013271281.1|622062_622989_+	glycosyltransferase family 2 protein	NA	Q76H32	Enterobacteria_phage	30.4	1.4e-35
WP_013271282.1|623002_623542_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013271283.1|623576_624680_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	34.5	4.2e-50
WP_013271284.1|624676_625165_+	GtrA family protein	NA	NA	NA	NA	NA
WP_013271285.1|627063_627420_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013271286.1|627412_627757_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013271287.1|627948_629490_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.5	7.7e-66
>prophage 2
NC_014376	[Clostridium] saccharolyticum WM1, complete sequence	4662871	800538	832128	4662871	terminase,capsid,tail,portal,protease,integrase	unidentified_phage(21.05%)	50	808287:808302	810559:810574
WP_166431295.1|800538_801585_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013271426.1|802134_802659_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WE86	Clostridium_phage	35.7	3.1e-11
WP_013271427.1|802789_802972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271428.1|803020_803182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271429.1|803222_803390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271430.1|803423_803591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668987.1|803920_804277_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_013271433.1|804279_804591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271434.1|804784_805567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271435.1|805580_805811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271436.1|805807_806023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271437.1|806083_806530_+	nuclease	NA	A0A088F897	Idiomarinaceae_phage	37.7	7.7e-11
WP_013271438.1|806526_807309_+	ParA family protein	NA	H7BUL8	unidentified_phage	37.8	5.8e-46
WP_013271439.1|807309_808368_+	ParB N-terminal domain-containing protein	NA	H7BUL7	unidentified_phage	36.4	5.9e-33
808287:808302	attL	ATTGATCCAGGCAGAG	NA	NA	NA	NA
WP_013271440.1|808496_809504_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J4W0	uncultured_Caudovirales_phage	88.0	1.5e-75
WP_013271441.1|809688_809841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271442.1|809833_810796_+	hypothetical protein	NA	A0A1C8E9A9	Bacillus_phage	23.5	2.2e-15
810559:810574	attR	ATTGATCCAGGCAGAG	NA	NA	NA	NA
WP_049791634.1|810933_811677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271444.1|811673_811949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271445.1|811989_812166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049791635.1|812396_812867_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_041708866.1|812893_813301_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_013271447.1|813452_813728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271448.1|813738_813951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271449.1|813995_814217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271450.1|814249_814627_+	HNH endonuclease	NA	Q7Y4J8	Streptococcus_phage	51.4	1.6e-25
WP_013271452.1|814791_815028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271453.1|815057_815300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271454.1|815393_815813_+	DUF3775 domain-containing protein	NA	NA	NA	NA	NA
WP_041708445.1|815888_816695_+	DNA adenine methylase	NA	A0A2H4JFS7	uncultured_Caudovirales_phage	92.9	1.1e-132
WP_013271456.1|816750_817101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041708447.1|817097_817313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271457.1|817324_817552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271458.1|817596_817998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271459.1|818191_818533_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013271460.1|818716_819040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271461.1|819029_820712_+|terminase	terminase	terminase	A0A1B1P766	Bacillus_phage	35.9	7.5e-99
WP_013271462.1|820730_821909_+|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	39.1	9.3e-72
WP_013271463.1|821925_822684_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	34.8	1.5e-27
WP_013271464.1|822688_823867_+|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	47.6	3.3e-85
WP_013271465.1|823968_824262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271466.1|824236_824584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049791695.1|824632_824965_+	HK97 gp10 family phage protein	NA	A0A1X9I688	Streptococcus_phage	47.7	5.9e-16
WP_013271468.1|824961_825294_+	hypothetical protein	NA	A0A0U4JNN6	Exiguobacterium_phage	41.5	1.3e-18
WP_013271469.1|825283_825853_+|tail	tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	48.9	4.0e-44
WP_013271470.1|825856_826231_+	hypothetical protein	NA	A0A290GJX3	Caldibacillus_phage	40.4	1.8e-13
WP_013271472.1|826403_829040_+|tail	phage tail tape measure protein, TP901 family	tail	H7BVF3	unidentified_phage	55.3	7.6e-90
WP_157668988.1|829060_829750_+	mtfA protein	NA	NA	NA	NA	NA
WP_013271474.1|829749_831684_+	phage minor structural protein	NA	H7BV46	unidentified_phage	31.8	4.6e-60
WP_013271475.1|831753_832128_+	hypothetical protein	NA	A0A2H4JD81	uncultured_Caudovirales_phage	34.4	7.9e-09
>prophage 3
NC_014376	[Clostridium] saccharolyticum WM1, complete sequence	4662871	881194	931909	4662871	tail,plate,holin,tRNA	Faecalibacterium_phage(60.0%)	52	NA	NA
WP_013271529.1|881194_882244_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_041708882.1|882320_882983_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_013271531.1|883000_883918_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013271532.1|884047_885238_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_157669059.1|885377_886181_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_013271534.1|886177_887179_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_013271535.1|887321_887747_+	GtrA family protein	NA	NA	NA	NA	NA
WP_013271536.1|887762_890645_+	YfhO family protein	NA	NA	NA	NA	NA
WP_013271537.1|890713_892087_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_013271538.1|892343_893429_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013271539.1|893496_894021_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_013271540.1|894020_895313_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_013271541.1|895459_895942_+	YcxB family protein	NA	NA	NA	NA	NA
WP_013271542.1|895950_896841_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_013271543.1|896855_897515_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_013271544.1|897553_898351_-	histidinol-phosphatase HisJ family protein	NA	NA	NA	NA	NA
WP_013271545.1|898573_900244_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_013271546.1|900365_901397_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013271547.1|901487_902699_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013271548.1|902825_903578_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_013271549.1|903828_905367_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013271550.1|906781_908560_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	7.0e-55
WP_013271551.1|908714_909581_+	DegV family protein	NA	NA	NA	NA	NA
WP_013271552.1|909608_911051_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.2	2.4e-37
WP_041708883.1|911080_912061_+	lipoprotein	NA	NA	NA	NA	NA
WP_157669060.1|912123_914571_+	DUF4131 domain-containing protein	NA	Q332C0	Clostridium_botulinum_C_phage	29.6	6.1e-33
WP_013271555.1|914659_915631_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_013271556.1|915825_916008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013271557.1|916062_916515_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	49.3	1.4e-31
WP_013271558.1|916538_917021_-	helix-turn-helix domain-containing protein	NA	A0A2K9V426	Faecalibacterium_phage	69.1	1.3e-16
WP_013271559.1|917161_917380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271560.1|917492_917996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271561.1|917992_918235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271562.1|918236_919703_+|tail	phage tail sheath family protein	tail	A0A2K9V328	Faecalibacterium_phage	45.2	6.7e-120
WP_013271563.1|919704_920220_+|tail	phage major tail tube protein	tail	A0A2K9V323	Faecalibacterium_phage	42.3	2.7e-31
WP_013271564.1|920232_920577_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_157668989.1|920600_920747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041708463.1|920753_921053_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_049791638.1|921388_924187_+|tail	phage tail tape measure protein	tail	H9A124	Staphylococcus_phage	43.9	6.9e-49
WP_013271565.1|924188_924389_+|tail	tail protein	tail	A0A2K9V353	Faecalibacterium_phage	47.2	4.6e-08
WP_049791639.1|924470_925658_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V340	Faecalibacterium_phage	38.6	2.8e-60
WP_013271566.1|925671_926085_+|plate	phage baseplate assembly protein V	plate	A0A2K9V325	Faecalibacterium_phage	48.3	6.9e-14
WP_013271567.1|926081_926471_+|tail	phage tail protein	tail	A0A2K9V364	Faecalibacterium_phage	43.1	3.8e-22
WP_013271568.1|926481_926781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271569.1|926780_927929_+|plate	baseplate J/gp47 family protein	plate	A0A2K9V320	Faecalibacterium_phage	46.9	4.6e-92
WP_013271570.1|927921_928857_+	hypothetical protein	NA	A0A2K9V337	Faecalibacterium_phage	25.5	5.6e-11
WP_013271571.1|928903_929299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271572.1|929317_929752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041708466.1|929744_930806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271574.1|930941_931346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271575.1|931338_931479_+	XkdX family protein	NA	NA	NA	NA	NA
WP_013271576.1|931489_931909_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	40.9	5.5e-19
>prophage 4
NC_014376	[Clostridium] saccharolyticum WM1, complete sequence	4662871	1473368	1513368	4662871	terminase,plate,tail,capsid,portal,holin,integrase	Clostridium_phage(24.14%)	58	1473322:1473348	1516767:1516793
1473322:1473348	attL	TCATGGGTTCGAATCCCACTATCTCCA	NA	NA	NA	NA
WP_013272057.1|1473368_1474454_-|integrase	site-specific integrase	integrase	A0A2H4J8J9	uncultured_Caudovirales_phage	41.6	3.7e-67
WP_013272058.1|1474633_1475041_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013272059.1|1475257_1475431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013272060.1|1475452_1475707_+	hypothetical protein	NA	A0A2H4JAH0	uncultured_Caudovirales_phage	77.4	4.7e-29
WP_013272061.1|1475703_1475850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272062.1|1475866_1476037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272063.1|1476090_1477365_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	64.2	9.2e-150
WP_013272064.1|1477364_1478489_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	51.1	2.2e-102
WP_013272065.1|1478502_1478952_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	42.3	6.5e-26
WP_013272066.1|1478954_1480538_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	75.2	4.7e-236
WP_013272067.1|1480551_1482759_+	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	63.2	2.1e-279
WP_013272068.1|1483077_1483476_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	65.9	1.4e-48
WP_013272069.1|1483472_1483682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272070.1|1483731_1484100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272071.1|1484113_1484461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272072.1|1484554_1484782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271450.1|1484814_1485192_+	HNH endonuclease	NA	Q7Y4J8	Streptococcus_phage	51.4	1.6e-25
WP_013271452.1|1485356_1485593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271453.1|1485622_1485865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085952057.1|1485985_1486789_+	DNA cytosine methyltransferase	NA	A0A0F7L3U1	uncultured_marine_virus	36.4	7.8e-46
WP_041708542.1|1486818_1487013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272074.1|1487002_1487200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272075.1|1487168_1487420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049791704.1|1487459_1487879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272077.1|1488215_1489157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041708970.1|1489362_1489647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272079.1|1489786_1490602_+	DUF3825 domain-containing protein	NA	NA	NA	NA	NA
WP_013272080.1|1491188_1491374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272081.1|1491444_1492146_+	helix-turn-helix domain-containing protein	NA	A0A2P1JTW4	Anoxybacillus_phage	56.6	9.5e-48
WP_013272082.1|1492138_1493425_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	55.4	1.0e-127
WP_013272083.1|1493435_1494842_+|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	57.4	7.3e-148
WP_013272084.1|1494841_1496416_+|capsid	minor capsid protein	capsid	Q20DD6	Lactobacillus_phage	27.3	8.2e-31
WP_013272085.1|1496412_1496688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272086.1|1496971_1497565_+	minor structural GP20 protein	NA	A0A0A7S0J5	Clostridium_phage	52.9	9.8e-46
WP_013272087.1|1497595_1498594_+	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	63.9	1.9e-110
WP_013272088.1|1498603_1498957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272089.1|1498949_1499288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272090.1|1499284_1499791_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_013272091.1|1499780_1500200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272092.1|1500201_1501242_+|portal	phage portal protein	portal	Q708M0	Streptococcus_phage	28.9	1.2e-35
WP_013272093.1|1501253_1501727_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	36.7	3.9e-21
WP_013272094.1|1501775_1502186_+|portal	phage portal protein	portal	S6B9X5	Thermus_phage	40.3	2.7e-18
WP_013272095.1|1502206_1502356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669070.1|1502385_1504332_+	tape measure protein	NA	S6AVU8	Thermus_phage	33.3	8.7e-75
WP_013272097.1|1504331_1504994_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	30.8	1.7e-17
WP_013272098.1|1505006_1505972_+	hypothetical protein	NA	H7BVH4	unidentified_phage	32.7	5.3e-33
WP_013272099.1|1505986_1506271_+	DNA helicase	NA	NA	NA	NA	NA
WP_013272100.1|1506272_1506659_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	48.0	1.2e-23
WP_013272101.1|1506655_1507666_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	49.6	2.0e-75
WP_013272102.1|1507670_1508204_+	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	44.7	8.3e-28
WP_013272103.1|1508204_1509440_+	hypothetical protein	NA	Q9T1A4	Listeria_phage	23.8	9.0e-09
WP_013272104.1|1509452_1509899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272105.1|1509910_1510048_+	XkdX family protein	NA	NA	NA	NA	NA
WP_041708545.1|1510063_1510498_+|holin	phage holin family protein	holin	A0A090D848	Clostridium_phage	52.0	1.7e-26
WP_013272107.1|1510566_1511400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041708976.1|1511455_1511953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013272109.1|1512069_1512993_-	DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	87.3	2.7e-159
WP_013272110.1|1513056_1513368_-	hypothetical protein	NA	A0A2H4J6S9	uncultured_Caudovirales_phage	72.8	1.5e-37
1516767:1516793	attR	TCATGGGTTCGAATCCCACTATCTCCA	NA	NA	NA	NA
>prophage 5
NC_014376	[Clostridium] saccharolyticum WM1, complete sequence	4662871	1798431	1883810	4662871	capsid,transposase,protease,portal	Bacillus_phage(33.33%)	60	NA	NA
WP_013271927.1|1798431_1798887_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.8	4.2e-20
WP_013272379.1|1798983_1799271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081443012.1|1799394_1800480_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_013272381.1|1800476_1800731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013272382.1|1800957_1801941_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013272383.1|1801965_1802820_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_013272384.1|1803001_1804720_+	vanomycin resistance protein VanB	NA	NA	NA	NA	NA
WP_013272385.1|1804918_1808458_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_013272386.1|1808624_1808966_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_013272387.1|1809272_1810148_+	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_013272388.1|1810234_1810660_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013272389.1|1810625_1811525_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.5e-21
WP_013272390.1|1811499_1813677_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013272392.1|1814402_1816331_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_013272393.1|1816420_1817527_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_013272394.1|1817673_1818957_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_013272395.1|1819122_1820673_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_013272396.1|1820778_1822737_-	collagen-like protein	NA	NA	NA	NA	NA
WP_013272397.1|1823191_1823929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157669008.1|1823940_1824351_-	DUF4489 domain-containing protein	NA	NA	NA	NA	NA
WP_013272399.1|1824723_1825257_-	DUF4489 domain-containing protein	NA	NA	NA	NA	NA
WP_013272400.1|1825402_1827208_-	heparinase	NA	NA	NA	NA	NA
WP_013272401.1|1827781_1829563_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013272402.1|1829559_1831113_+	response regulator	NA	NA	NA	NA	NA
WP_013272403.1|1831307_1832684_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013272404.1|1832758_1833652_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013272405.1|1833653_1834487_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013272406.1|1834577_1837607_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	31.7	1.6e-144
WP_013272407.1|1837935_1838349_+	DUF3788 domain-containing protein	NA	NA	NA	NA	NA
WP_013272408.1|1838602_1840090_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013272410.1|1840571_1842314_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	7.6e-46
WP_013272411.1|1842289_1844065_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.8e-51
WP_013272412.1|1844127_1844988_+	patatin family protein	NA	NA	NA	NA	NA
WP_013272413.1|1845536_1847825_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.3	3.0e-135
WP_013272414.1|1848017_1848308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272415.1|1848419_1849781_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.3	2.7e-54
WP_013272416.1|1849974_1851144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041708581.1|1851454_1851871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669009.1|1852412_1852661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041709044.1|1853191_1853656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272418.1|1855574_1855895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669079.1|1855920_1856469_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013272420.1|1856440_1858393_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013272421.1|1858385_1860647_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_013272422.1|1860643_1861369_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013272423.1|1861584_1861965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013271245.1|1865105_1866419_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	30.2	3.4e-14
WP_013272425.1|1866585_1872777_+	S-layer protein	NA	NA	NA	NA	NA
WP_085952047.1|1873163_1874569_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.8	1.4e-53
WP_013272428.1|1874759_1875290_+	RNA polymerase sigma24 factor	NA	NA	NA	NA	NA
WP_013272429.1|1875725_1876763_+	Rad3-related DNA helicase-like protein	NA	NA	NA	NA	NA
WP_013272430.1|1876759_1877200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669010.1|1877289_1877433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272431.1|1877486_1877744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166431291.1|1879251_1879581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013272432.1|1879917_1880184_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_013272433.1|1880173_1880479_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013272434.1|1880554_1881820_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	76.0	2.0e-189
WP_013272435.1|1881877_1882588_+|protease	Clp protease ClpP	protease	A0A1B0RXE1	Streptococcus_phage	65.8	8.9e-78
WP_013272436.1|1882601_1883810_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	68.5	2.9e-153
