The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	1197354	1204769	3655731	tRNA	uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_013257893.1|1197354_1198470_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.2	2.0e-79
WP_148227920.1|1198532_1198880_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.0	2.3e-10
WP_148227921.1|1199033_1200590_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013257896.1|1200616_1201843_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.9	1.2e-42
WP_013257897.1|1201903_1202686_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.9	2.1e-19
WP_013257898.1|1202682_1203579_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	34.4	1.4e-11
WP_013257899.1|1203584_1204088_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_013257900.1|1204094_1204769_-	response regulator	NA	W8CYM9	Bacillus_phage	32.5	1.5e-10
>prophage 2
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	1751542	1760555	3655731	plate,tail	Vibrio_phage(66.67%)	11	NA	NA
WP_013258395.1|1751542_1752673_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	41.5	8.4e-70
WP_013258396.1|1752669_1752999_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_013258397.1|1752998_1753391_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013258398.1|1753383_1753929_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	40.0	4.1e-22
WP_013258399.1|1753928_1754945_-	late control D family protein	NA	A0A0C5AJ59	Bacteriophage	37.5	2.2e-53
WP_013258400.1|1754929_1755139_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_013258401.1|1755125_1758107_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	44.3	6.8e-87
WP_013258402.1|1758111_1758249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258403.1|1758272_1758554_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_050762420.1|1758563_1759082_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	50.0	1.7e-41
WP_013258405.1|1759103_1760555_-|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	51.1	2.7e-137
>prophage 3
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	1928496	1937546	3655731	terminase,capsid,head,transposase,protease,portal	uncultured_phage(16.67%)	11	NA	NA
WP_013258536.1|1928496_1929789_+|capsid	phage major capsid protein	capsid	D6PFE3	uncultured_phage	33.3	2.9e-42
WP_013258537.1|1929841_1930354_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	51.1	8.0e-28
WP_050762291.1|1930416_1931025_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_187288524.1|1930976_1931516_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.9	1.9e-27
WP_013258538.1|1931512_1931740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013258539.1|1931801_1931945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013258540.1|1931941_1933816_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_013258541.1|1933815_1934196_+	HNH endonuclease	NA	A0A0U4JIC7	Exiguobacterium_phage	49.2	6.1e-09
WP_013258542.1|1934201_1935821_+|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	38.4	7.2e-91
WP_148227826.1|1936000_1936459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013257321.1|1936496_1937546_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	40.6	3.5e-70
>prophage 4
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	2005412	2034773	3655731	integrase,tail,capsid,portal	Bacillus_phage(40.0%)	29	2012734:2012752	2035963:2035981
WP_013258612.1|2005412_2009048_-|tail	phage tail tape measure protein	tail	H7BVM4	unidentified_phage	40.0	1.6e-77
WP_013258613.1|2009191_2009869_-	hypothetical protein	NA	A0A127AX46	Bacillus_phage	28.8	1.7e-09
WP_013219051.1|2009884_2010346_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013258614.1|2010361_2011891_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A127AW39	Bacillus_phage	36.0	2.1e-76
WP_013258615.1|2011893_2012151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258616.1|2012163_2012712_-	hypothetical protein	NA	NA	NA	NA	NA
2012734:2012752	attL	TGGTTACTTACCGGAAGCG	NA	NA	NA	NA
WP_013258617.1|2012897_2013506_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013258618.1|2013502_2014654_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013258619.1|2014650_2015856_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005997848.1|2015857_2016568_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	1.7e-31
WP_013258620.1|2016592_2017054_+	cytochrome c	NA	NA	NA	NA	NA
WP_187288628.1|2017058_2018561_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011700600.1|2018530_2019016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258622.1|2019005_2019365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258623.1|2019351_2019816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258624.1|2019802_2020162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366969.1|2020181_2021045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258625.1|2021063_2021426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258626.1|2021438_2023841_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_013258627.1|2023944_2024298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258628.1|2024294_2024807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258629.1|2024803_2029393_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_011367829.1|2029392_2030901_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_013258630.1|2031064_2032588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011367831.1|2032587_2032866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258631.1|2032862_2033135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366959.1|2033275_2033470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013258632.1|2033503_2033878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013258633.1|2033858_2034773_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	28.1	1.9e-16
2035963:2035981	attR	TGGTTACTTACCGGAAGCG	NA	NA	NA	NA
>prophage 5
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	2049914	2055713	3655731		Acidithiobacillus_phage(50.0%)	7	NA	NA
WP_013258647.1|2049914_2050538_-	transcriptional repressor LexA	NA	Q9G0C2	Lactococcus_phage	36.2	5.7e-12
WP_013258648.1|2050839_2051082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013258649.1|2051116_2051641_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.2	9.4e-16
WP_013258650.1|2051633_2053220_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	39.7	5.1e-97
WP_013258651.1|2053216_2053639_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	37.7	1.7e-12
WP_013258652.1|2054582_2054888_+	integration host factor subunit alpha	NA	M4SRV7	Rhodobacter_phage	39.3	8.4e-09
WP_187288530.1|2054984_2055713_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.6	3.4e-24
>prophage 6
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	2480687	2533794	3655731	integrase,capsid,terminase,holin,transposase,portal	uncultured_Caudovirales_phage(16.67%)	48	2480639:2480686	2490467:2490514
2480639:2480686	attL	CTCCTAAGCCGTAGGCCGCCCGTTCGATTCGGGCCGGGGACACCAACG	NA	NA	NA	NA
WP_013259041.1|2480687_2481881_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	28.5	4.9e-28
WP_187288549.1|2481929_2482292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259042.1|2482504_2483647_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	36.5	3.6e-60
WP_043814340.1|2483697_2485389_-|capsid	phage major capsid protein	capsid	Q6R4V3	Vibrio_virus	42.6	3.0e-23
WP_013259044.1|2485504_2487127_-|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	40.4	7.0e-94
WP_013259045.1|2487132_2487504_-	HNH endonuclease	NA	A0A218MNA6	uncultured_virus	48.6	1.8e-13
WP_013259046.1|2487503_2489384_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_013258539.1|2489380_2489524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259047.1|2489584_2489821_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148227940.1|2489898_2490153_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_187288550.1|2490570_2490771_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
2490467:2490514	attR	CTCCTAAGCCGTAGGCCGCCCGTTCGATTCGGGCCGGGGACACCAACG	NA	NA	NA	NA
WP_013257321.1|2490837_2491887_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	40.6	3.5e-70
WP_013259049.1|2491924_2492581_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_013259050.1|2492870_2494994_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013259051.1|2495109_2497392_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_013259052.1|2497401_2498715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013259053.1|2498863_2499667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148227852.1|2499827_2500733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013259055.1|2500814_2501354_-	cache domain-containing protein	NA	NA	NA	NA	NA
WP_043814355.1|2501642_2504462_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_013259057.1|2504475_2507154_-	response regulator	NA	NA	NA	NA	NA
WP_013259058.1|2507461_2509306_+	Cache 3/Cache 2 fusion domain-containing protein	NA	NA	NA	NA	NA
WP_013259059.1|2509370_2510099_-	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_050762333.1|2510477_2513639_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013259061.1|2513646_2515164_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_013259062.1|2515227_2515416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259063.1|2515462_2516842_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_013259064.1|2517035_2517353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259065.1|2517478_2517772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259066.1|2517800_2518766_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_013259067.1|2519013_2520717_+	MFS transporter	NA	NA	NA	NA	NA
WP_013259068.1|2520781_2521015_-	TM0996/MTH895 family glutaredoxin-like protein	NA	NA	NA	NA	NA
WP_013259069.1|2521020_2521533_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013259070.1|2521539_2522727_-	permease	NA	NA	NA	NA	NA
WP_013259071.1|2522739_2523084_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013259072.1|2523202_2523580_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013259073.1|2523594_2524788_+	SO_0444 family Cu/Zn efflux transporter	NA	NA	NA	NA	NA
WP_148227856.1|2525063_2525633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259075.1|2525743_2526127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259076.1|2526149_2526491_-	DsrE family protein	NA	NA	NA	NA	NA
WP_013259077.1|2526487_2527678_-	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_013259078.1|2527674_2528004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043814366.1|2528533_2529223_+	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_013259079.1|2529313_2530048_+	signal peptidase I	NA	NA	NA	NA	NA
WP_013259080.1|2530121_2530526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259081.1|2530536_2531046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259082.1|2531342_2533286_+	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_013259083.1|2533386_2533794_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 7
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	2629127	2637181	3655731		Staphylococcus_phage(57.14%)	11	NA	NA
WP_013259179.1|2629127_2629592_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	4.0e-34
WP_013259180.1|2629605_2630817_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	2.0e-101
WP_050762342.1|2630858_2631374_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013259182.1|2631374_2632034_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.4	1.9e-29
WP_013259183.1|2632153_2633287_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.2	1.1e-42
WP_013259184.1|2633293_2633767_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_013259185.1|2633803_2634307_-	dCMP deaminase family protein	NA	W0LN94	Mycobacterium_phage	39.3	3.3e-18
WP_013259186.1|2634303_2634750_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_013259187.1|2634760_2636008_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_013259188.1|2636113_2636350_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	50.0	5.7e-05
WP_013259189.1|2636434_2637181_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	35.9	2.5e-06
>prophage 8
NC_014365	Desulfarculus baarsii DSM 2075, complete sequence	3655731	2770134	2888891	3655731	tail,capsid,head,terminase,bacteriocin,transposase,protease,portal	uncultured_Mediterranean_phage(13.89%)	88	NA	NA
WP_013259298.1|2770134_2773005_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.6	8.2e-37
WP_013259299.1|2773006_2775157_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.4	3.4e-27
WP_013259300.1|2775184_2776435_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_013259301.1|2776431_2778015_-	TolC family protein	NA	NA	NA	NA	NA
WP_013259302.1|2778192_2779827_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	38.8	4.9e-79
WP_013259303.1|2779965_2780565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259304.1|2781172_2781322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013259305.1|2781461_2782475_+	radical SAM protein	NA	NA	NA	NA	NA
WP_013259306.1|2782487_2783504_+	radical SAM protein	NA	NA	NA	NA	NA
WP_013259307.1|2783515_2785261_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.4	3.1e-15
WP_013259308.1|2785251_2786739_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013259309.1|2786755_2787892_+	GRRM system radical SAM/SPASM domain protein	NA	NA	NA	NA	NA
WP_013259310.1|2787955_2788219_+	NHLP leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_148227866.1|2788580_2788898_+	radical SAM protein	NA	NA	NA	NA	NA
WP_013259311.1|2788924_2790622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288560.1|2790863_2792504_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_083779012.1|2792664_2792838_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013259313.1|2792942_2796665_-	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_013259314.1|2796720_2800443_-	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_013259315.1|2800439_2801453_-	radical SAM protein	NA	NA	NA	NA	NA
WP_013259316.1|2801460_2802489_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_013259317.1|2802497_2804591_-	putative cobaltochelatase	NA	NA	NA	NA	NA
WP_013259318.1|2804597_2806097_-	nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_148227867.1|2806830_2807019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013259319.1|2806999_2807365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187288561.1|2808365_2810303_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013259321.1|2810404_2812087_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.2e-16
WP_013259322.1|2812083_2813778_+	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_148227868.1|2813912_2815709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013259324.1|2815708_2816599_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_043814497.1|2816865_2817054_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_013259325.1|2817101_2817551_-	DUF3788 domain-containing protein	NA	NA	NA	NA	NA
WP_187288562.1|2818439_2819696_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013259327.1|2820775_2821942_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	29.1	1.5e-37
WP_013259329.1|2822642_2829071_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_013259330.1|2829228_2829435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259331.1|2829463_2832418_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	41.0	2.2e-215
WP_013259332.1|2832410_2833646_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013259333.1|2833758_2834616_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	32.9	1.2e-23
WP_043815784.1|2836195_2836630_-	GxxExxY protein	NA	A0A2K9R7P5	Dishui_lake_phycodnavirus	32.1	3.6e-05
WP_013259336.1|2836650_2838168_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	55.3	3.9e-155
WP_013259337.1|2838164_2838374_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	58.3	2.2e-16
WP_013259338.1|2838572_2838887_-|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	35.6	6.0e-10
WP_013259339.1|2838887_2839484_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013259340.1|2839532_2839973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259341.1|2839984_2841190_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	38.3	2.4e-67
WP_013259342.1|2841193_2841907_-|head,protease	HK97 family phage prohead protease	head,protease	B0VK32	Azospirillum_phage	42.5	1.0e-28
WP_043815785.1|2841887_2843126_-|portal	phage portal protein	portal	B0VK31	Azospirillum_phage	42.9	4.7e-82
WP_013259344.1|2843125_2844796_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	48.4	3.4e-152
WP_013259345.1|2844875_2845070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013259346.1|2845078_2845537_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JAK7	uncultured_Caudovirales_phage	32.4	1.1e-07
WP_043814504.1|2845855_2846197_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	47.7	1.2e-16
WP_013259350.1|2846723_2847911_-	DNA modification methylase	NA	A0A0A8ILE7	Aurantimonas_phage	53.1	6.2e-116
WP_013259352.1|2848519_2848798_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013259353.1|2848797_2849316_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013259354.1|2849449_2849734_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013259355.1|2849837_2852072_-	primase	NA	K4HZY1	Acidithiobacillus_phage	42.5	1.2e-147
WP_013259356.1|2852071_2852350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259357.1|2852454_2853039_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_013259358.1|2853198_2853519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259359.1|2853666_2855757_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_013259360.1|2855749_2856532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259361.1|2856604_2857024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259362.1|2857046_2858606_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	48.7	3.5e-90
WP_013259363.1|2858602_2859124_-	DUF2924 domain-containing protein	NA	NA	NA	NA	NA
WP_148227869.1|2859120_2859480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259364.1|2859900_2860347_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	47.7	1.1e-25
WP_013259365.1|2860373_2862362_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_013259366.1|2862358_2863150_-	phospholipase	NA	NA	NA	NA	NA
WP_013259367.1|2863142_2864990_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_050762428.1|2864986_2868814_-	helicase	NA	NA	NA	NA	NA
WP_013259369.1|2868883_2872984_-	hypothetical protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	27.6	1.8e-53
WP_013259370.1|2872977_2873613_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_013259371.1|2873609_2876807_-	helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.2	1.2e-108
WP_013259372.1|2876803_2877919_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	58.8	3.3e-111
WP_013259373.1|2877915_2878140_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	52.4	7.5e-15
WP_013259374.1|2878500_2878815_-|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	34.6	8.7e-09
WP_050762356.1|2878814_2879408_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013259377.1|2879647_2880118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013259378.1|2880130_2881423_-|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	32.9	4.3e-38
WP_013259379.1|2881467_2882205_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	56.8	1.0e-47
WP_013259380.1|2882194_2883451_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	36.3	3.4e-56
WP_013259381.1|2883447_2885148_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	47.1	2.2e-146
WP_013259382.1|2885150_2885606_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	46.9	3.5e-27
WP_013259383.1|2885661_2885916_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	42.4	5.2e-12
WP_013259384.1|2885912_2886284_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	38.8	2.8e-14
WP_013259385.1|2886292_2887711_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	52.9	2.8e-139
WP_187288633.1|2887700_2888891_-	DNA modification methylase	NA	A0A0A8ILE7	Aurantimonas_phage	52.4	2.0e-114
