The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	98064	108096	3032624		Tupanvirus(33.33%)	7	NA	NA
WP_009924391.1|98064_99519_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_072215787.1|99546_99855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951082.1|100033_101644_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_012951083.1|101701_102232_+	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_003722118.1|102519_103986_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003732117.1|104146_105919_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_012951084.1|105942_108096_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
>prophage 2
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	681091	738345	3032624	portal,transposase,capsid,protease,tail,holin,integrase,terminase,head	Listeria_phage(47.06%)	67	673798:673813	736085:736100
673798:673813	attL	CCTTCTAAATCATTTT	NA	NA	NA	NA
WP_012951296.1|681091_682243_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_012951297.1|682264_682978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951298.1|683032_683533_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.9	1.4e-13
WP_012951299.1|683545_683872_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	47.1	1.6e-13
WP_012951300.1|684045_684237_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	57.6	6.2e-10
WP_012951301.1|684335_684662_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.1	4.9e-15
WP_012951302.1|684834_685749_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	52.3	1.0e-54
WP_012951303.1|685750_686107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951304.1|686103_686520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951307.1|687239_687704_+	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	96.8	5.3e-87
WP_012951308.1|687700_688414_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951309.1|688424_689369_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	95.9	1.2e-173
WP_003762551.1|689381_690062_+	hypothetical protein	NA	A8ATD7	Listeria_phage	90.7	7.9e-116
WP_012951310.1|690058_690274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951311.1|690270_690654_+	hypothetical protein	NA	A8ATZ3	Listeria_phage	78.7	4.9e-46
WP_012951312.1|690675_690924_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	85.3	6.6e-28
WP_012951313.1|690923_691505_+	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	76.3	5.2e-76
WP_012951314.1|691504_691984_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	77.5	2.9e-64
WP_012951315.1|692037_692229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951316.1|692289_692808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951317.1|692804_693347_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	4.3e-48
WP_012951318.1|693628_693856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102578311.1|693881_694157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049961585.1|694153_694516_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.1	3.5e-14
WP_012951321.1|694610_695138_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|695106_696858_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|696864_697065_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|697067_698303_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|698299_698866_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|698929_700099_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_012951326.1|700147_700486_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
WP_012951327.1|700455_700776_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|700769_701135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951329.1|701137_701536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951330.1|701556_702132_+|tail	major tail protein	tail	M1PRQ7	Streptococcus_phage	42.4	1.2e-32
WP_012951331.1|702221_702569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951333.1|702765_706965_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_012951334.1|706957_709201_+	minor structural protein GP75	NA	A0A059T682	Listeria_phage	29.4	1.6e-56
WP_012951335.1|709206_711498_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	37.9	9.8e-134
WP_030142763.1|711490_712552_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	51.3	1.9e-95
WP_003722523.1|712590_712956_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|712968_713250_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951337.1|713249_714095_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	93.3	4.8e-139
WP_003722835.1|715534_716398_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_003732618.1|716397_716757_+	lipoprotein	NA	NA	NA	NA	NA
WP_012951338.1|717288_717822_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_003722839.1|717885_718803_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_012951339.1|719068_720949_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.5	1.7e-107
WP_003722841.1|721044_721773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951340.1|721915_722566_+	hypothetical protein	NA	A0A0E3HJ81	Synechococcus_phage	27.6	3.4e-15
WP_072215777.1|722605_724426_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.6	2.9e-48
WP_003732612.1|724660_726052_+	amino acid permease	NA	NA	NA	NA	NA
WP_009925348.1|726141_726981_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|727063_727348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721765.1|727445_728396_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003721766.1|728419_729061_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989537.1|729103_731794_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003721768.1|731839_732487_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003721769.1|732495_733032_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003733993.1|733018_733939_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|734129_734339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951342.1|734406_735114_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	27.8	2.5e-19
WP_003721773.1|735157_735721_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_003721774.1|735840_736257_+	hypothetical protein	NA	NA	NA	NA	NA
736085:736100	attR	AAAATGATTTAGAAGG	NA	NA	NA	NA
WP_009925179.1|736308_736944_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_012951343.1|736933_737830_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951345.1|738060_738345_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	1160060	1169613	3032624		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1160060_1160444_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1160465_1161449_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1161463_1162477_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1162685_1164176_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1164187_1165012_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_012951453.1|1165024_1165333_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003730540.1|1165392_1165797_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951454.1|1165925_1167482_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_012951455.1|1167699_1169613_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
>prophage 4
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	1266393	1373476	3032624	portal,capsid,protease,tail,holin,integrase,terminase,tRNA	Listeria_phage(68.85%)	116	1291027:1291048	1335774:1335795
WP_012951511.1|1266393_1268802_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1268962_1269664_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_012951512.1|1269677_1273088_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003721623.1|1273185_1273638_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003721624.1|1273653_1276854_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003732773.1|1276960_1277635_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
WP_072215733.1|1277672_1278599_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1278752_1279016_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012951513.1|1279015_1279558_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003723851.1|1279650_1281363_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_010989713.1|1281385_1283743_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1283823_1284135_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003733800.1|1284210_1286022_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003732778.1|1286210_1287425_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003733801.1|1287480_1287975_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1288122_1288923_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1288935_1289682_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_012951514.1|1289685_1290297_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_012951515.1|1290333_1290858_+	metallophosphoesterase	NA	NA	NA	NA	NA
1291027:1291048	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951516.1|1291143_1292298_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
WP_012951517.1|1292439_1293096_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_012951518.1|1293147_1293600_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	91.3	1.1e-78
WP_012951519.1|1293616_1293940_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1294340_1294544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951520.1|1294610_1294802_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	84.1	1.6e-21
WP_003730996.1|1294823_1295066_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1295068_1295254_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_012951522.1|1296006_1296249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951524.1|1297065_1297530_+	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	94.8	2.9e-85
WP_012951525.1|1297526_1298240_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951526.1|1298250_1299195_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_012951527.1|1299207_1299888_+	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951528.1|1299884_1300118_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951529.1|1300120_1300564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951530.1|1300756_1301236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1301236_1301866_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951532.1|1301884_1302118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951533.1|1302114_1302333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951534.1|1302302_1302494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731668.1|1302696_1302960_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	67.1	8.8e-23
WP_012951535.1|1303132_1303516_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731665.1|1303517_1303997_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1304016_1304706_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_074471730.1|1304784_1306026_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_009918373.1|1306050_1306533_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_012951538.1|1306555_1308844_+	primase	NA	R4IBW2	Listeria_phage	95.4	0.0e+00
WP_012951539.1|1309177_1309495_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_003731659.1|1309496_1309709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951540.1|1310156_1310696_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731657.1|1310692_1310962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1311181_1311607_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012951542.1|1311704_1312448_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_014930130.1|1312916_1313243_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
WP_009931610.1|1313242_1313557_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
WP_012951543.1|1313606_1313963_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_012951544.1|1313959_1315603_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.3	0.0e+00
WP_009917707.1|1315612_1316002_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	3.7e-17
WP_012951545.1|1316052_1317183_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	2.8e-214
WP_012951546.1|1317179_1317896_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	59.0	9.3e-67
WP_012951547.1|1317922_1319074_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	3.1e-213
WP_012951549.1|1319260_1319560_+	hypothetical protein	NA	A8ATA0	Listeria_phage	97.0	8.4e-46
WP_009934006.1|1319543_1319909_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_012951550.1|1319905_1320307_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009931623.1|1320303_1320687_+	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_012951551.1|1320707_1321295_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.7e-106
WP_012951552.1|1321365_1321698_+	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_012951553.1|1321913_1326845_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.1	0.0e+00
WP_012951554.1|1326832_1328482_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_012951555.1|1328494_1330789_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_031644619.1|1330778_1331873_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1331920_1332223_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1332222_1332480_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951559.1|1332479_1333325_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	83.7	5.4e-130
WP_012951560.1|1333428_1334427_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012951561.1|1334651_1334834_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_012951563.1|1335274_1335508_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951565.1|1336155_1337514_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1335774:1335795	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951566.1|1337554_1338148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009914084.1|1338301_1338709_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1338873_1339473_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1339504_1339765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1339888_1341301_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1341325_1341589_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|1341756_1342233_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012951567.1|1342270_1342516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951568.1|1342512_1343718_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1343922_1344582_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1344623_1344818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1344884_1345733_-	YitT family protein	NA	NA	NA	NA	NA
WP_009931701.1|1346352_1347066_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012951570.1|1347096_1348743_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1348761_1350246_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1350361_1350814_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012951571.1|1350860_1351325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1351513_1352434_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723560.1|1352453_1353701_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1353684_1354515_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1354650_1355790_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1355870_1356266_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1356416_1356632_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1356750_1357284_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1357301_1357967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1358228_1359167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1359281_1360565_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1360749_1362009_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1362127_1362694_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1362728_1363298_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1363399_1363942_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1363951_1364815_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1364811_1365597_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1365730_1366591_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012951572.1|1366862_1368941_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_009924616.1|1369003_1370308_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1370590_1371493_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1371513_1372053_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1372066_1373476_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
>prophage 5
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	1956515	1964801	3032624		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1956515_1957082_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_012951771.1|1957078_1958128_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722245.1|1958146_1959574_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951772.1|1959558_1961778_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722247.1|1961770_1962454_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1962457_1962703_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012951773.1|1962714_1963428_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003729814.1|1963508_1964801_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	2478064	2517295	3032624	terminase,tail,holin	Listeria_phage(98.11%)	58	NA	NA
WP_012951924.1|2478064_2478298_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
WP_012951925.1|2478738_2478948_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951926.1|2479049_2479454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951927.1|2479455_2479884_+	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951928.1|2479895_2480393_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_003722520.1|2480667_2481441_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951929.1|2481481_2482327_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722522.1|2482326_2482608_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2482620_2482986_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|2483024_2485187_-	hypothetical protein	NA	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_012951931.1|2485199_2486768_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951932.1|2486764_2491564_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_074046934.1|2491568_2491880_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951934.1|2491876_2492308_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_012951935.1|2492363_2493050_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_010991155.1|2493054_2493426_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951936.1|2493422_2493740_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_003733695.1|2493729_2494095_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951937.1|2494094_2494448_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_012951939.1|2494629_2495502_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_003744996.1|2495524_2496079_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951940.1|2496174_2497218_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_012951941.1|2497222_2498779_-	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_012951942.1|2498793_2500113_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.3	2.9e-263
WP_012951943.1|2500105_2500846_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_012951944.1|2500885_2501113_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951945.1|2501398_2501833_-	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951946.1|2501973_2502357_-	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951947.1|2502360_2502765_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_031645468.1|2502709_2502892_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951948.1|2502919_2503297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951949.1|2503318_2503798_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951950.1|2503794_2504196_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951951.1|2504192_2504552_-	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_031645470.1|2504573_2504804_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	73.8	1.1e-18
WP_012951953.1|2504939_2505470_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_012951954.1|2505466_2505754_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951955.1|2505750_2506734_-	DnaD domain protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951956.1|2506750_2507410_-	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951957.1|2507415_2507892_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_003734953.1|2507888_2508083_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_157862701.1|2508178_2508319_-	hypothetical protein	NA	A0A059T7Q6	Listeria_phage	97.6	9.4e-16
WP_003722564.1|2508388_2508577_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_012951958.1|2508685_2508901_-	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_012951959.1|2508897_2509431_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951960.1|2509554_2510331_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_003733685.1|2510312_2510588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951961.1|2510593_2510875_-	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_012951962.1|2510871_2511108_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951963.1|2511172_2511532_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_003733687.1|2511490_2511685_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951964.1|2511688_2511940_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_012951965.1|2512102_2512408_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951966.1|2512438_2512930_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951967.1|2512956_2513664_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	99.1	5.3e-123
WP_012951968.1|2513722_2514157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951969.1|2514361_2515876_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012951970.1|2515936_2517295_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
>prophage 7
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	2659499	2667343	3032624		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2659499_2660471_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2660478_2661447_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2661448_2662324_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012952017.1|2662431_2664162_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_012952018.1|2664203_2665265_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952019.1|2665281_2666265_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_003722610.1|2666383_2667343_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 8
NC_013766	Listeria monocytogenes 08-5578, complete sequence	3032624	2902299	2908824	3032624	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003734720.1|2902299_2903118_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_012952081.1|2903114_2904983_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_012952082.1|2904969_2905374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2905415_2905718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2905765_2906278_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_012952083.1|2906290_2906680_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003732220.1|2906957_2907374_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003732219.1|2907385_2907814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2908030_2908366_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|2908371_2908824_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
>prophage 1
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	0	14824	77054	protease,transposase	Streptococcus_phage(28.57%)	10	NA	NA
WP_003728469.1|3199_6115_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_003728468.1|6118_6673_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728467.1|6952_7312_+	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728466.1|7311_9447_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_012952127.1|9938_10484_+	YdhK family protein	NA	NA	NA	NA	NA
WP_003728511.1|10859_11468_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
WP_003728510.1|11457_11685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731679.1|11804_12083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728509.1|12045_12282_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
WP_003728507.1|12709_14824_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.4e-117
>prophage 2
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	17885	20709	77054		Bacillus_phage(50.0%)	3	NA	NA
WP_012952132.1|17885_19166_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.9	5.2e-92
WP_003726389.1|19538_19871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026747205.1|19863_20709_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	42.6	3.4e-52
>prophage 3
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	42772	44917	77054		Streptococcus_phage(100.0%)	1	NA	NA
WP_012952161.1|42772_44917_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	36.1	1.9e-83
>prophage 4
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	54054	55095	77054		Streptococcus_phage(100.0%)	1	NA	NA
WP_012952168.1|54054_55095_+	putative cell wall hydrolase	NA	A0A1S5SEZ8	Streptococcus_phage	49.6	1.9e-28
>prophage 5
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	59444	66537	77054	transposase	Ostreid_herpesvirus(20.0%)	8	NA	NA
WP_012952172.1|59444_60209_+	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
WP_003728487.1|60322_60853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728486.1|60889_61225_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_011011011.1|61398_61797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952173.1|62509_62854_+	TnpV protein	NA	NA	NA	NA	NA
WP_072235488.1|62895_63303_+	hypothetical protein	NA	H2DE57	Erwinia_phage	46.0	1.4e-11
WP_002389568.1|63868_64549_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
WP_003728481.1|65172_66537_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.9e-07
>prophage 6
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	69749	72394	77054	transposase	Streptococcus_phage(100.0%)	2	NA	NA
WP_003728476.1|69749_71633_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	5.6e-87
WP_043993356.1|71752_72394_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.0e-101
>prophage 7
NC_013767	Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence	77054	76186	76750	77054		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003728472.1|76186_76750_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	2.0e-40
